Supplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated
|
|
- Leon Kelly
- 5 years ago
- Views:
Transcription
1 Supplementary Figure Legends Supplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated with either vehicle (left; n=3) or CCl 4 (right; n=3) were co-immunostained for NRP-1 (green) and stellate cell markers, (A) desmin, (B) α-sma and (C) NG2. Representative images for each staining are shown in the left column for NRP-1 staining (in green), middle column for desmin or α-sma or NG2 (in red), and overlay of the two (in yellow) in the right column. Below each image is the colocalization analysis including Pearson s correlation for each of the overlay images. White bar over the overlay image represents the area selected for colocalization. Supplementary Fig. 2. (A) KDR expression was determined in LX2, hhsc, and endothelial cells (HUVEC) by immunoblotting (n=3). (B) KDR mrna presence was assessed by semiquantitative reverse transcript PCR from liver endothelial cells, HSC and LX2. β2 microglobulin (β2-mg) was used as PCR control. (C) hhsc treated with VEGF or PDGF were subjected to Western blotting with antibodies recognizing phospho-pdgfrβ and β-actin, used as loading control. (D) Immunoblot of hhscs treated alone or with combinations of the putative NRP-1 ligand, Sema3A and PDGF-BB ligand was probed with phospho-pdgfrβ and β-actin as loading control. (Representative autoradiographs or western blots are from three independent experiments). (E) Boyden chamber cell migration assay was conducted with hhsc using PDGF or Sema3A as the chemotactic
2 agent (n=3, p<.5). (F) Akt phosphorylation was assessed by Western blot by treating liver endothelial cells, HHSEC, or LX2 cells with VEGF at different time intervals. Total Akt and actin were used as internal loading control. While VEGF increased AKT phosphorylation in liver endothelial cells, AKT phosphorylation was not changed in response to VEGF in LX2. White line/box indicates splicing of non-contiguous samples. Supplementary Fig. 3. A. Left, human liver EC transfected with c-abl sirna were plated on growth factor reduced Matrigel, incubated with and without VEGF and tubulogenesis was measured after 24 hours. Right, human liver EC transfected with c-abl sirna or scramble sirna were lysed and c-abl knockdown was confirmed by Western blot. B. Cell migration was studied with human liver EC after knockdown of c-abl (p<.5). C. Human liver EC were assessed for c-abl activity in presence or absence of VEGF. c-abl activity was low in EC despite VEGF stimulation. VEGF positive control included p-akt which was increased in response to VEGF. Supplementary Fig. 4. A. Cell migration was studied with hhsc after knockdown of PDGFRβ using real time lapse videomicroscopy. Cellular distance traveled was measured by MetaMorph imaging software. PDGF-induced HSC migration was absent in PDGFRβ silenced cells despite presence of endogenous NRP-1 (n=3, p<.5). B. Cell migration was studied in LX2 with NRP-1 sirna mediated knockdown in the presence of FGF or PDGF. NRP-1 enhances FGF
3 induced migration in a statistically significant manner but to a quantitatively lower extent than that observed with PDGF. Western blot from lysates of LX2 cells transfected with sirna confirmed knockdown of NRP-1. Supplementary Fig. 5. A. The specificity of the binding of I 125 PDGF to cells was validated by using non-labeled PDGF (cold PDGF) to compete the labeled (hot PDGF). B. HSC incubated with NRP-1 sirna prior to incubation with PDGF ligand evidenced diminished binding to PDGF (n=3, p<.5). Supplementary Fig. 6. A. Protein lysates from human HSC, human liver EC, LX2 cells, and HepG2 cells were probed with NRP-1, PDGFR and actin antibody for Western blot analysis. B. Protein lysates from primary mouse HSC and primary mouse liver EC were probed with NRP-1 antibody for Western blot analysis. Arrows show the distinction of an additional higher molecular weight form of NRP-1 in human and mouse HSC. White line indicates splicing of a noncontiguous sample from the same membrane. Supplementary Fig. 7. HSC incubated with PDGF were harvested and lysed for co-immunoprecipitation assay using anti-phosphotyrosine antibody and then the precipitates were analyzed by SDS-PAGE and Western blot with PDGFR and p85 antibodies respectively.
4 Supplementary Fig. 8. Liver endothelial cells were plated on growth factor reduced Matrigel and incubated with VEGF and/or NRP-1b Ab and tubulogenesis was measured within each experimental group after 24 hours (n=3 separate experiments). Supplementary Fig. 9 Mouse HSC (mhsc) isolated from WT and NRP-1 f/f mice were used to study cell migration using Boyden Chamber with and without PDGF. mhsc from WT mice were pre-treated with NRP-1 antibody to study cell migration with and without PDGF. In parallel, mhsc from NRP-1 f/f mice were treated with Ad-Cre to delete NRP-1 from transduced cells. Ad-LacZ was used as a control. Depicted data are a juxtaposition of the data from Figure 4 and Figure 8 in order to allow side-by-side quantitative comparison of the effects of genetic and antibody based disruption of NRP-1 function on HSC migration.
5 Supplementary Fig. 1 Vehicle CCl 4 A NRP-1 Desmin Merge NRP-1 Desmin Merge 14 Intensity (AU) Pearson's Correlation Rr=.52 Intensity (AU) Pearson's Correlation Rr=.47 B NRP-1 α-sma Merge NRP-1 α-sma Merge 2 Intensity (AU) Pearson's Correlation Rr=.44 Intensity (AU) Pearson's Correlation Rr=.45 C NRP-1 NG2 Merge NRP-1 NG2 Merge Intensity(AU) Pearson's Correlation Rr=. Intensity (AU) Pearson's Correlation Rr=.41
6 Control VEGF PDGF Supplementary Fig. 2 A B KDR β-actin IB: p-pdgfrβ β-actin HUVEC LX2 hhsc D IB: p-pdgfrβ C Control PDGF BB Sema 3A PDGF BB+Sema 3A β-actin 2 Number of cells migrated HHSEC LX2 VEGF(1ng/ml, min) IB: p-akt IB: AKT IB: Actin Control PDGF-BB Sema-3A HHSEC hhsc LX2 HHSEC hhsc LX2 E KDR β2 MG F
7 Supplementary Fig. 3 A NS Tube Length (AU) Control VEGF c-abl Actin Srcamble C-abl sirna Scrambled sirna c-abl sirna B % of cells migrated NS Control VEGF C VEGF(1ng/ml, min) 3 IP: c-abl p-crk c-abl 3 lysates p-akt total-akt 4 2 Scrambled sirna c-abl sirna
8 Scrambled sirna PDGFR-β sirna PDGFR-β sirna Supplementary Fig. 4 A 2 PDGFRβ β-actin Scram ble sirna Scram ble sirna + PDGF PDGFRβ sirna PDGFRβ sirna+ PDGF Srcamble NRP-1 sirna Distance migrated (% of Control) B 2 NRP1 Control Actin FGF PDGF Scrambled sirna NRP-1 sirna % of cells migrated
9 Supplementary Fig. 5 A I125 PDGF I125 PDGF+cold PDGF (2 ng/ml) B Scramble sirna NRP-1 sirna Specific binding (ng/ml) Concentration of I125 PDGF (ng/ml) 1/ Specific binding (ng/ml) Concentration of I125 PDGF (ng/ml)
10 EC (mouse) HSC(mouse) Supplementary Fig. 6 A. B. HepG2 (human) LX2 (Human) HSC (Human) EC (Human) IB NRP-1 PDGFR Ab: NP-1(Goat anti-rat) Actin NRP-1
11 Supplementary Fig. 7 IP: p-tyrosine PDGF PDGFR P85 RFP NRP1 LX2
12 Supplementary Fig. 8 Tube length (% of control) Control NRP1-Ab Control- VEGF NRP1- Ab-VEGF
13 Supplementary Fig. 9 2 % of cells migrated Vehicle PDGF Vehicle NRP-1 antibody Ad-GFP Ad-Cre WT mhsc NRP-1 f/f mhsc
J. Cell Sci. 128: doi: /jcs : Supplementary Material. Supplemental Figures. Journal of Cell Science Supplementary Material
Supplemental Figures Figure S1. Trio controls endothelial barrier function. (A) TagRFP-shTrio constructs were expressed in ECs. Western blot shows efficient Trio knockdown in TagRFP-expressing ECs. (B)
More informationSarker et al. Supplementary Material. Subcellular Fractionation
Supplementary Material Subcellular Fractionation Transfected 293T cells were harvested with phosphate buffered saline (PBS) and centrifuged at 2000 rpm (500g) for 3 min. The pellet was washed, re-centrifuged
More informationJournal of Cell Science Supplementary Material
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 SUPPLEMENTARY FIGURE LEGENDS Figure S1: Eps8 is localized at focal adhesions and binds directly to FAK (A) Focal
More informationSupplemental Figure 1
Supplemental Fig. 1. Kinetics of,,, AKT and ERK activation in BMMCs following SCF stimulation. Starved BMMCs were stimulated with 250ng/mL of SCF for the indicated time. Soluble Cell Lysates (SCLs) were
More informationFlag-Rac Vector V12 V12 N17 C40. Vector C40 pakt (T308) Akt1. Myc-DN-PAK1 (N-SP)
a b FlagRac FlagRac V2 V2 N7 C4 V2 V2 N7 C4 p (T38) p (S99, S24) p Flag (Rac) NIH 3T3 COS c +Serum p (T38) MycDN (NSP) Mycp27 3 6 2 3 6 2 3 6 2 min p Myc ( or p27) Figure S (a) Effects of Rac mutants on
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Nakajima and Tanoue, http://www.jcb.org/cgi/content/full/jcb.201104118/dc1 Figure S1. DLD-1 cells exhibit the characteristic morphology
More informationSupplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators.
Supplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators. (a) A graphic depiction of the approach to determining the stability of
More informationSupplementary Figure 1. Confirmation of sirna in PC3 and H1299 cells PC3 (a) and H1299 (b) cells were transfected with sirna oligonucleotides
Supplementary Figure 1. Confirmation of sirna in PC3 and H1299 cells PC3 (a) and H1299 (b) cells were transfected with sirna oligonucleotides targeting RCP (SMARTPool (RCP) or two individual oligos (RCP#1
More informationSupplementary Figure 1. GST pull-down analysis of the interaction of GST-cIAP1 (A, B), GSTcIAP1
Legends Supplementary Figure 1. GST pull-down analysis of the interaction of GST- (A, B), GST mutants (B) or GST- (C) with indicated proteins. A, B, Cell lysate from untransfected HeLa cells were loaded
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Bays et al., http://www.jcb.org/cgi/content/full/jcb.201309092/dc1 Figure S1. Specificity of the phospho-y822 antibody. (A) Total cell
More informationSupplementary Figure 1. APP cleavage assay. HEK293 cells were transfected with various
Supplementary Figure 1. APP cleavage assay. HEK293 cells were transfected with various GST-tagged N-terminal truncated APP fragments including GST-APP full-length (FL), APP (123-695), APP (189-695), or
More informationSupplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
More informationAIP1 functions as an endogenous inhibitor of VEGFR2-mediated signaling and inflammatory angiogenesis
SUPPLEMENTAL MATERIALS functions as an endogenous inhibitor of VEGFR2-mediated signaling and inflammatory angiogenesis Haifeng Zhang 1*, Yun He 1*, Shengchuan Dai 1*, Zhe Xu 2*, Yan Luo 2, Ting Wan 2,
More informationSupplementary Figure 1 a. d 0.8 CON LPS PAN. 2nd ab nephrin podocin CON LPS PAN. upar. -tubulin. upar. upar / -tubulin CON LPS PAN
Supplementary Figure 1 a Efferent arteriole Podocytes Afferent arteriole FP Endothelium GBM Glomerular filtration barrier b 188kD HEK + GFP HEK + GFP-Nphs1 Differentiated Podocytes HEK + GFP HEK + GFP-Nphs2
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Rainero et al., http://www.jcb.org/cgi/content/full/jcb.201109112/dc1 Figure S1. The expression of DGK- is reduced upon transfection
More informationSupplementary Information. Conversion of vascular endothelial cells into multipotent stem-like cells
Supplementary Information Conversion of vascular endothelial cells into multipotent stem-like cells Damian Medici 1, Eileen M. Shore 2,3,4, Vitali Y. Lounev 2,4, Frederick S. Kaplan 2,4,5, Raghu Kalluri
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2271 Supplementary Figure a! WM266.4 mock WM266.4 #7 sirna WM266.4 #10 sirna SKMEL28 mock SKMEL28 #7 sirna SKMEL28 #10 sirna WM1361 mock WM1361 #7 sirna WM1361 #10 sirna 9 WM266. WM136
More informationBeta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand
SUPPLEMENTAL FIGURES Beta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand C. Ravelli et al. FIGURE S. I Figure S. I: Gremlin
More informationa KYSE270-CON KYSE270-Id1
a KYSE27-CON KYSE27- shcon shcon sh b Human Mouse CD31 Relative MVD 3.5 3 2.5 2 1.5 1.5 *** *** c KYSE15 KYSE27 sirna (nm) 5 1 Id2 Id2 sirna 5 1 sirna (nm) 5 1 Id2 sirna 5 1 Id2 [h] (pg per ml) d 3 2 1
More informationSupplementary Figure 1. Drawing of spinal cord open-book preparations and DiI tracing. Nature Neuroscience: doi: /nn.3893
Supplementary Figure 1 Drawing of spinal cord open-book preparations and DiI tracing. Supplementary Figure 2 In ovo electroporation of dominant-negative PlexinA1 in commissural neurons induces midline
More informationPost-translational modification
Protein expression Western blotting, is a widely used and accepted technique to detect levels of protein expression in a cell or tissue extract. This technique measures protein levels in a biological sample
More informationSupplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2
Supplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2 female) or wild-type (5 months old, 1 male; 11 months old,
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Han et al., http://www.jcb.org/cgi/content/full/jcb.201311007/dc1 Figure S1. SIVA1 interacts with PCNA. (A) HEK293T cells were transiently
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2743 Figure S1 stabilizes cellular protein level, post-transcriptionally. (a, b) and DDR1 were RNAi-depleted from HEK.293.-CBG cells. Western blots with indicated antibodies (a). RT-PCRs
More informationElectrophoretic Mobility Shift Assay (EMSA). Nuclear extracts were. oligonucleotide spanning the NF-kB site (5 -GATCC-
SUPPLEMENTARY MATERIALS AND METHODS Electrophoretic Mobility Shift Assay (EMSA). Nuclear extracts were prepared as previously described. (1) A [ 32 P] datp-labeled doublestranded oligonucleotide spanning
More informationSupplementary Figure 1.
Supplementary Figure 1. Quantification of western blot analysis of fibroblasts (related to Figure 1) (A-F) Quantification of western blot analysis for control and IR-Mut fibroblasts. Data are expressed
More informationSupplementary Information
Supplementary Information Sam68 modulates the promoter specificity of NF-κB and mediates expression of CD25 in activated T cells Kai Fu 1, 6, Xin Sun 1, 6, Wenxin Zheng 1, 6, Eric M. Wier 1, Andrea Hodgson
More informationSupplementary Figures and Legends.
Supplementary Figures and Legends. Supplementary Figure 1: Impact of injury on Rb1 and PPARϒ expression. Following ipsilateral axotomy injury, adult DRG expression of Rb1 mrna declined (*p
More informationRer1 and calnexin regulate endoplasmic reticulum retention of a peripheral myelin protein 22 mutant that causes type 1A Charcot-Marie-Tooth disease
Rer1 and calnexin regulate endoplasmic reticulum retention of a peripheral myelin protein mutant that causes type 1A Charcot-Marie-Tooth disease Taichi Hara, Yukiko Hashimoto, Tomoko Akuzawa, Rika Hirai,
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2386 Figure 1 Src-containing puncta are not focal adhesions, podosomes or endosomes. (a) FAK-/- were stained with anti-py416 Src (green) and either (in red) the focal adhesion protein paxillin,
More informationSupplementary Figure S1. N-terminal fragments of LRRK1 bind to Grb2.
Myc- HA-Grb2 Mr(K) 105 IP HA 75 25 105 1-1163 1-595 - + - + - + 1164-1989 Blot Myc HA total lysate 75 25 Myc HA Supplementary Figure S1. N-terminal fragments of bind to Grb2. COS7 cells were cotransfected
More informationConservation of oncofetal antigens on human embryonic stem cells enables discovery of monoclonal antibodies against cancer.
Title Conservation of oncofetal antigens on human embryonic stem cells enables discovery of monoclonal antibodies against cancer. Authors H.L. Tan 1, *, C. Yong 1, B.Z. Tan 1, W.J. Fong 1, J. Padmanabhan
More informationStargazin regulates AMPA receptor trafficking through adaptor protein. complexes during long term depression
Supplementary Information Stargazin regulates AMPA receptor trafficking through adaptor protein complexes during long term depression Shinji Matsuda, Wataru Kakegawa, Timotheus Budisantoso, Toshihiro Nomura,
More informationhnrnp C promotes APP translation by competing with FMRP for APP mrna recruitment to P bodies
hnrnp C promotes APP translation by competing with for APP mrna recruitment to P bodies Eun Kyung Lee 1, Hyeon Ho Kim 1, Yuki Kuwano 1, Kotb Abdelmohsen 1, Subramanya Srikantan 1, Sarah S. Subaran 2, Marc
More informationhnrnp D/AUF1 Rabbit IgG hnrnp M
Mouse IgG Goat IgG Rabbit IgG Mouse IgG hnrnp F Goat IgG Mouse IgG Kb 6 4 3 2 15 5 Supplementary Figure S1. In vivo binding of TERRA-bound RBPs to target RNAs. Immunoprecipitation (IP) assay using 3 mg
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3363 Supplementary Figure 1 Several WNTs bind to the extracellular domains of PKD1. (a) HEK293T cells were co-transfected with indicated plasmids. Flag-tagged proteins were immunoprecipiated
More informationTranscriptional regulation of BRCA1 expression by a metabolic switch: Di, Fernandez, De Siervi, Longo, and Gardner. H3K4Me3
ChIP H3K4Me3 enrichment.25.2.15.1.5 H3K4Me3 H3K4Me3 ctrl H3K4Me3 + E2 NS + E2 1. kb kb +82 kb Figure S1. Estrogen promotes entry of MCF-7 into the cell cycle but does not significantly change activation-associated
More informationSupplementary Figure 1. ERK signaling is not activated at early hypertension. a, Western blot analysis for the level of phospho-erk (perk) and total
Supplementary Figure 1. ERK signaling is not activated at early hypertension. a, Western blot analysis for the level of phospho-erk (perk) and total ERK in the aortic tissue from the saline- or AngII-infused
More information(a) Immunoblotting to show the migration position of Flag-tagged MAVS
Supplementary Figure 1 Characterization of six MAVS isoforms. (a) Immunoblotting to show the migration position of Flag-tagged MAVS isoforms. HEK293T Mavs -/- cells were transfected with constructs expressing
More informationHPV E6 oncoprotein targets histone methyltransferases for modulating specific. Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu,
1 HPV E oncoprotein targets histone methyltransferases for modulating specific gene transcription 3 5 Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu, Cheng-Ming Chiang, Sheng-Chung
More information3 P p25. p43 p41 28 FADD. cflips. PE-Cy5 [Fluorescence intensity]
L S p4 3 D3 76 N S L Ve ct or p4 3 D3 76 N S L Ve ct or A aspase 8 FADD TRAF2 D95-R - + Vector D95L TL I S L D376N T RAIL-R1 T RAIL-R2 D95-R E-y5 [Fluorescence intensity] Supplemental Fig. 1 Different
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/5/233/ra50/dc1 Supplementary Materials for Epidermal Growth Factor Receptor Is Essential for Toll-Like Receptor 3 Signaling Michifumi Yamashita, Saurabh Chattopadhyay,
More informationFig. S1. eif6 expression in HEK293 transfected with shrna against eif6 or pcmv-eif6 vector.
Fig. S1. eif6 expression in HEK293 transfected with shrna against eif6 or pcmv-eif6 vector. (a) Western blotting analysis and (b) qpcr analysis of eif6 expression in HEK293 T cells transfected with either
More informationSupplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53
Supplementary data Supplemental Figure 1 A sienigma #2 sienigma sicontrol a-enigma - + ++ - - - - - - + ++ - - - - - - ++ B sienigma F-Enigma F-EnigmaSM a-flag HLK3 cells - - - + ++ + ++ - + - + + - -
More informationSupplementary Methods
Supplementary Methods Antibodies Rabbit polyclonal VEGFR-1, VEGFR-2, Angiopoietin-1, Angiopoietin- 2 and GAPDH specific antibodies were from Santa Cruz Biotechnology. Rabbit polyclonal Akt1, Akt2, ps473
More informationSupplemental Figure 1
Supplemental Figure 1 A IL-12p7 (pg/ml) 7 6 4 3 2 1 Medium then TLR ligands MDP then TLR ligands Medium then TLR ligands + MDP MDP then TLR ligands + MDP B IL-12p4 (ng/ml) 1.2 1..8.6.4.2. Medium MDP Medium
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Dynamic Phosphorylation of HP1 Regulates Mitotic Progression in Human Cells Supplementary Figures Supplementary Figure 1. NDR1 interacts with HP1. (a) Immunoprecipitation using
More informationSUPPLEMENTAL FIGURES AND TABLES
SUPPLEMENTAL FIGURES AND TABLES A B Flag-ALDH1A1 IP: α-ac HEK293T WT 91R 128R 252Q 367R 41/ 419R 435R 495R 412R C Flag-ALDH1A1 NAM IP: HEK293T + + - + D NAM - + + E Relative ALDH1A1 activity 1..8.6.4.2
More informationDescription of supplementary material file
Description of supplementary material file In the supplementary results we show that the VHL-fibronectin interaction is indirect, mediated by fibronectin binding to COL4A2. This provides additional information
More informationSingle cell resolution in vivo imaging of DNA damage following PARP inhibition. Supplementary Data
Single cell resolution in vivo imaging of DNA damage following PARP inhibition Katherine S. Yang, Rainer H. Kohler, Matthieu Landon, Randy Giedt, and Ralph Weissleder Supplementary Data Supplementary Figures
More informationSupplementary Fig. 1 Identification of Nedd4 as an IRS-2-associated protein in camp-treated FRTL-5 cells.
Supplementary Fig. 1 Supplementary Fig. 1 Identification of Nedd4 as an IRS-2-associated protein in camp-treated FRTL-5 cells. (a) FRTL-5 cells were treated with 1 mm dibutyryl camp for 24 h, and the lysates
More informationSupplementary Figure 1. TRIM9 does not affect AP-1, NF-AT or ISRE activity. (a,b) At 24h post-transfection with TRIM9 or vector and indicated
Supplementary Figure 1. TRIM9 does not affect AP-1, NF-AT or ISRE activity. (a,b) At 24h post-transfection with TRIM9 or vector and indicated reporter luciferase constructs, HEK293T cells were stimulated
More informationSupplementary Table 1. Sequences for BTG2 and BRCA1 sirnas.
Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas. Target Gene Non-target / Control BTG2 BRCA1 NFE2L2 Target Sequence ON-TARGET plus Non-targeting sirna # 1 (Cat# D-001810-01-05) sirna1: GAACCGACAUGCUCCCGGA
More informationSupplementary Fig. 1. (A) Working model. The pluripotency transcription factor OCT4
SUPPLEMENTARY FIGURE LEGENDS Supplementary Fig. 1. (A) Working model. The pluripotency transcription factor OCT4 directly up-regulates the expression of NIPP1 and CCNF that together inhibit protein phosphatase
More informationSupplemental Fig. 1: PEA-15 knockdown efficiency assessed by immunohistochemistry and qpcr
Supplemental figure legends Supplemental Fig. 1: PEA-15 knockdown efficiency assessed by immunohistochemistry and qpcr A, LβT2 cells were transfected with either scrambled or PEA-15 sirna. Cells were then
More informationSupplementary Figure 1. IFN-γ induces TRC dormancy. a, IFN-γ induced dormancy
Supplementary Figure 1. IFN-γ induces TRC dormancy. a, IFN-γ induced dormancy of various tumor type TRCs, including H22 (murine hepatocarcinoma) and CT26 (murine colon cancer). Bar, 50 µm. b, B16 cells
More informationSupplementary Figures and supplementary figure legends
Supplementary Figures and supplementary figure legends Figure S1. Effect of different percentage of FGF signaling knockdown on TGF signaling and EndMT marker gene expression. HUVECs were subjected to different
More informationSupplementary Figure 1. Reconstitution of human-acquired lymphoid system in
Supplementary Figure 1. Reconstitution of human-acquired lymphoid system in mouse NOD/SCID/Jak3 null mice were transplanted with human CD34 + hematopoietic stem cells. (Top) Four weeks after the transplantation
More informationsupplementary information
DOI: 10.1038/ncb2172 Figure S1 p53 regulates cellular NADPH and lipid levels via inhibition of G6PD. (a) U2OS cells stably expressing p53 shrna or a control shrna were transfected with control sirna or
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/304/ra104/dc1 Supplementary Materials for Lysine Methylation Promotes VEGFR-2 Activation and Angiogenesis Edward J. Hartsough, Rosana D. Meyer, Vipul Chitalia,
More informationFigure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.
/ 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG
More informationSupplementary Figure 1. The Hsp70 acetylation level is related to the co-chaperone binding of Hsp70 under various stress conditions.
Supplementary Figure 1. The Hsp70 acetylation level is related to the co-chaperone binding of Hsp70 under various stress conditions. 1 (a) Etoposide treatment gradually changes acetylation level and co-chaperone
More informationSupplementary Figure 1 (A), (B), and (C) Docking of a physiologic ligand of integrin αvβ3, the tenth type III RGD domain of wild-type fibronectin
Supplementary Figure 1 (A), (B), and (C) Docking of a physiologic ligand of integrin αvβ3, the tenth type III RGD domain of wild-type fibronectin (A), D1-CD2 (B), and the D1-CD2 variant 3 (C) to Adomain
More informationSupplementary Figure 1. Co-localization of GLUT1 and DNAL4 in BeWo cells cultured
Supplementary Figure 1. Co-localization of GLUT1 and DNAL4 in BeWo cells cultured under static conditions. Cells were seeded in the chamber area of the device and cultured overnight without medium perfusion.
More informationSupplementary Figure 1. TSA (10 nmol/l), non-class-selective HDAC inhibitor, potentiates
Supplementary Figure 1. TSA (10 nmol/l), non-class-selective HDAC inhibitor, potentiates vascular calcification (VC). (a) Von Kossa staining shows that TSA potentiated the Pi-induced VC. Scale bar, 100
More informationtranscription and the promoter occupancy of Smad proteins. (A) HepG2 cells were co-transfected with the wwp-luc reporter, and FLAG-tagged FHL1,
Supplementary Data Supplementary Figure Legends Supplementary Figure 1 FHL-mediated TGFβ-responsive reporter transcription and the promoter occupancy of Smad proteins. (A) HepG2 cells were co-transfected
More informationSupplementary methods Shoc2 In Vitro Ubiquitination Assay
Supplementary methods Shoc2 In Vitro Ubiquitination Assay 35 S-labelled Shoc2 was prepared using a TNT quick Coupled transcription/ translation System (Promega) as recommended by manufacturer. For the
More informationInhibition of Twist1 mediated invasion by Chk2 promotes premature senescence in p53 defective cancer cells
Inhibition of Twist1 mediated invasion by Chk2 promotes premature senescence in p53 defective cancer cells Debasis Nayak, a,1 Anmol Kumar, b Souneek Chakraborty, a,1 Reyaz ur Rasool, a,1 Hina Amin, a Archana
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3230 a GM13267(ZW) WCE C N M H 2 O 2 : p(s1981) 2 2 LDH Lamin A/C β-integrin c b d AT Flag- WT Flag- RQ H 2 O 2 IgG p (S1981) p (S1981) 2 IP: Flag N.S. 2 e f A: Untreated AT5 cells B: AT5
More informationLi et al., Supplemental Figures
Li et al., Supplemental Figures Fig. S1. Suppressing TGM2 expression with TGM2 sirnas inhibits migration and invasion in A549-TR cells. A, A549-TR cells transfected with negative control sirna (NC sirna)
More informationDocument S1. Supplemental Experimental Procedures and Three Figures (see next page)
Supplemental Data Document S1. Supplemental Experimental Procedures and Three Figures (see next page) Table S1. List of Candidate Genes Identified from the Screen. Candidate genes, corresponding dsrnas
More informationFigure S1. Specificity of polyclonal anti stabilin-1 and anti stabilin-2 antibodies Lysates of 293T cells transfected with empty vector, mouse
Figure S1. Specificity of polyclonal anti stabilin-1 and anti stabilin-2 antibodies Lysates of 293T cells transfected with empty vector, mouse stabilin-1, or mouse stabilin-2 were immunoblotted using anti
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3240 Supplementary Figure 1 GBM cell lines display similar levels of p100 to p52 processing but respond differentially to TWEAK-induced TERT expression according to TERT promoter mutation
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/429/ra54/dc1 Supplementary Materials for Dephosphorylation of the adaptor LAT and phospholipase C by SHP-1 inhibits natural killer cell cytotoxicity Omri Matalon,
More informationSupplementary Figure 1. α-synuclein is truncated in PD and LBD brains. Nature Structural & Molecular Biology: doi: /nsmb.
Supplementary Figure 1 α-synuclein is truncated in PD and LBD brains. (a) Specificity of anti-n103 antibody. Anti-N103 antibody was coated on an ELISA plate and different concentrations of full-length
More informationSupplemental Information
Supplemental Information Intrinsic protein-protein interaction mediated and chaperonin assisted sequential assembly of a stable Bardet Biedl syndome protein complex, the BBSome * Qihong Zhang 1#, Dahai
More informationFigure S1. Verification of ihog Mutation by Protein Immunoblotting Figure S2. Verification of ihog and boi
Figure S1. Verification of ihog Mutation by Protein Immunoblotting Extracts from S2R+ cells, embryos, and adults were analyzed by immunoprecipitation and immunoblotting with anti-ihog antibody. The Ihog
More informationGFP CCD2 GFP IP:GFP
D1 D2 1 75 95 148 178 492 GFP CCD1 CCD2 CCD2 GFP D1 D2 GFP D1 D2 Beclin 1 IB:GFP IP:GFP Supplementary Figure 1: Mapping domains required for binding to HEK293T cells are transfected with EGFP-tagged mutant
More informationSupplementary Materials
Supplementary Materials Supplementary Figure 1. PKM2 interacts with MLC2 in cytokinesis. a, U87, U87/EGFRvIII, and HeLa cells in cytokinesis were immunostained with DAPI and an anti-pkm2 antibody. Thirty
More informationMa, et al. Supplemental Data
Ma, et al Supplemental Data Title: Calpain mediates pulmonary vascular remodeling in rodent models of pulmonary hypertension and its inhibition attenuates pathologic features of disease Authors: Wanli
More informationB. ADM: C. D. Apoptosis: 1.68% 2.99% 1.31% Figure.S1,Li et al. number. invaded cells. HuH7 BxPC-3 DLD-1.
A. - Figure.S1,Li et al. B. : - + - + - + E-cadherin CK19 α-sma vimentin β -actin C. D. Apoptosis: 1.68% 2.99% 1.31% - : - + - + - + Apoptosis: 48.33% 45.32% 44.59% E. invaded cells number 400 300 200
More informationp53 is activated in response to disruption of the pre-mrna splicing machinery.
p53 is activated in response to disruption of the pre-mrna splicing machinery. Nerea Allende-Vega, Saurabh Dayal, Usha Agarwala, Alison Sparks, Christophe Bourdon and Mark K. Saville. Jean- Supplementary
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature12138 Supplementary Figure 1. Knockdown of KRAS leads to a reduction in macropinocytosis. (a) KRAS knockdown in MIA PaCa-2 cells expressing KRASspecific shrnas
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full//59/ra7/dc1 Supplementary Materials for Dok-7 ctivates the Muscle Receptor Kinase MuSK and Shapes Synapse Formation kane Inoue, Kiyoko Setoguchi, Yosuke Matsubara,
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Thompson et al., http://www.jcb.org/cgi/content/full/jcb.200909067/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Modification-specific antibodies do not detect unmodified
More informationSupplemental Material
Supplemental Material 1 Figure S1. Phylogenetic analysis of Cep72 and Lrrc36, comparative localization of Cep72 and Lrrc36 and Cep72 antibody characterization (A) Phylogenetic alignment of Cep72 and Lrrc36
More informationSupplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and
Supplementary Figure Legend: Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and ATRIP protein peptides identified from our mass spectrum analysis were shown. Supplementary
More informationThe Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit
Cell Reports, Volume 5 Supplemental Information The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit Andrey Poleshko, Katelyn M. Mansfield, Caroline
More informationSupplement Figure 1. Plin5 Plin2 Plin1. KDEL-DSRed. Plin-YFP. Merge
Supplement Figure 1 Plin5 Plin2 Plin1 KDEL-DSRed Plin-YFP Merge Supplement Figure 2 A. Plin5-Ab MitoTracker Merge AML12 B. Plin5-YFP Cytochrome c-cfp merge Supplement Figure 3 Ad.GFP Ad.Plin5 Supplement
More informationRecruitment of Grb2 to surface IgG and IgE provides antigen receptor-intrinsic costimulation to class-switched B cells
SUPPLEMENTARY FIGURES Recruitment of Grb2 to surface IgG and IgE provides antigen receptor-intrinsic costimulation to class-switched B cells Niklas Engels, Lars Morten König, Christina Heemann, Johannes
More informationSupplementary Fig.1 Luton
Supplementary Fig.1 Luton a 175 Brain Thymus Spleen Small Intestine Kidney Testis HeLa b 250 Lung Kidney MDCK c EFA6B si Control si Mismatch #637 #1564 #1770 83 62 47.5 175 IB: anti-efa6b #B1 130 66 Lysates
More informationsupplementary information
DOI: 10.1038/ncb1977 Figure S1 a. Immunofluorescence analysis of IFT20 localization in PBL costained with anti-β-tubulin antibodies. b. Immunofluorescence analysis of IFT20 localization in Jurkat cells,
More informationSUPPLEMENTARY INFORMATION. Small molecule activation of the TRAIL receptor DR5 in human cancer cells
SUPPLEMENTARY INFORMATION Small molecule activation of the TRAIL receptor DR5 in human cancer cells Gelin Wang 1*, Xiaoming Wang 2, Hong Yu 1, Shuguang Wei 1, Noelle Williams 1, Daniel L. Holmes 1, Randal
More informationFigure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or
Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or absence of the acetyltransferase CBP and acetylated TDP-43
More informationcells (MLEC) that produce luciferase under the control of the PAI-1 promoter in response to
Supplemental Materials and Methods TGF bioassay. To quantify the levels of active and total TGF, we used mink lung epithelial cells (MLEC) that produce luciferase under the control of the PAI-1 promoter
More informationFIGURE LEGENDS HDAC3-FcεRIβ interaction occurs in mast cells isolated from ears of BALB/c mouse in mouse model of chronic allergic inflammation.
FIGURE LEGENDS FIGURE 1. -FcεRIβ interaction occurs in mast cells isolated from ears of L/c mouse in mouse model of chronic allergic inflammation. L/c mice were given intravenous (i.v.) injection of DNP-specific
More informationSupplementary Information
Supplementary Information Supplementary Figure 1: Over-expression of CD300f in NIH3T3 cells enhances their capacity to phagocytize AC. (a) NIH3T3 cells were stably transduced by EV, CD300f WT or CD300f
More informationFig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.
Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.SCUBE2, E-cadherin.Myc, or HA.p120-catenin was transfected in a combination
More informationJCB. Supplemental material THE JOURNAL OF CELL BIOLOGY. Kimura et al.,
Supplemental material JCB Kimura et al., http://www.jcb.org/cgi/content/full/jcb.201503023/dc1 THE JOURNAL OF CELL BIOLOGY Figure S1. TRIMs regulate IFN-γ induced autophagy. (A and B) HC image analysis
More informationsupplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
More information