Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe, 5 CACGUUAAAACCAUACGCACUACGAAACCCC; let7-2 OMe, 5 CUAAAACUAUACAACCUACUACCUCAUCCCA; mir-122wt, 5 UGGAGUGUGACAAUGGUGUUUGU; mir-122p3, 5 UGCAGUGUGACAAUGGUGUUUGU; mir-122*, 5 AAACGCCAUUAUCACACUAAAUA. Duplexes were formed between the wt or p3 forms of mir-122 and mir-122*. The mir-122 sensor plasmid egfp-122 was constructed by PCR-mediated insertion of the sequence 5 ACAAACACCAUUGUCACACUCCA, which has exact complementarity to mir-122, at the Not I restriction site in the 3 noncoding region (NCR) of plasmid pd2egfp-n1 (Clontech). To construct the control vector egfp-124, the sequence 5 TTAAGGCACGCGGTGAATGCCA, which is complementary to the brain-specific mir-124, was inserted. Substitution mutations were introduced into the 3 and 5 NCRs of the H77c replicon vector (1) by overlap PCR using mutagenic primers, and subsequent ligation of the PCR products into the parent vector. The replicon used to measure secreted alkaline phosphatase was synthesized from plasmid Ntat2ANeo(SI), containing the hepatitis delta virus ribozyme sequence downstream of the viral cdna to allow 1
generation of replicon RNAs with authentic 3 end sequences. The p3 mutation in the 5 NCR was created by excision and ligation of a fragment spanning the 5 NCR from the H77c p3 mutant plasmid. Cell culture and transfection The Huh7, HeLa and HepG2 cell lines were cultured in Dulbecco s modified Eagle medium supplemented with 10% fetal bovine serum and 1% non-essential amino acids (Gibco, Carlsbad). The Huh7 cell line containing the dicistronic replicon NNeo/C-5B has been described previously (3) and was maintained in the presence of 1mg/ml G418. The cell line En5-3, which was isolated after stable transformation of Huh7 cells with plasmid pltr-seap (2) was maintained in 2µg/ml blasticidin. In vitro transcribed H77c genomic RNA was introduced into Huh7 cells by electroporation as described (1) and RNA was prepared and processed 5 days later. The same method was used to introduce Ntat2ANeo RNA into En5-3 cells. To observe protein synthesis from replication-deficient H77c RNA, we used Dmrie-C (Invitrogen, Carlsbad) to deliver RNA into Huh7 cells, and protein lysates were prepared and processed 20 hours later. This method was used because electroporated cells were not fully adherent at such early timepoints. DNA constructs and oligonucleotides were introduced into cells using lipofectamine 2000 (Invitrogen), according to the manufacturer s instructions. The 2 -O-methylated oligonucleotides and the mir-122 RNA duplexes were delivered at a concentration of 2
50nM into cells in 6-well plates. Transfected cells were cultured for 48 hours before harvesting. RNA isolation and Northern blotting Total RNA was extracted from cells using Trizol reagent (Invitrogen), according to the manufacturer s instructions. For detection of mirna expression, 10µg of total RNA was separated on 15% polyacrylamide gels containing 7M urea in 45mM Tris-HCl, 45mM boric acid, 1mM ethylenediaminetetraacetic acid (EDTA) ph 8, transferred to Hybond N+ membrane (Amersham), and hybridized to a 5 32 P-labelled oligonucleotide complementary to mir-122 with the sequence 5 ACAAACACCAUUGUCACACUCCA. For analysis of mrna levels, 2.5µg of RNA from the NNeo/C-5B replicon cells, or 10µg of RNA from cells transfected with H77c RNA, was separated in 1% agarose gels containing 20mM 3-(N-morpholino) propanesulfonic acid (MOPS) ph 7.0, 5mM sodium acetate, 1mM EDTA buffer and 2.2M formaldehyde, and transferred to Zeta-probe membrane (Bio-Rad). The membranes were hybridized in ExpressHyb (Clontech) to random-primed 32 P-labelled DNA probes corresponding to nucleotides 84-374 of HCV, 40-814 of egfp, and 685-1171 of γ-actin as indicated. Western blotting and metabolic labeling Protein samples were obtained by scraping cells into RIPA buffer, containing 50mM Tris-HCl ph 7.2, 0.1% sodium dodecylsulfate, 150mM NaCl, 0.5% deoxycholic acid, 1% 3
Triton X-100 and a complete protease inhibitor cocktail (Roche, Nutley). 10µg of protein was separated by 12% SDS-PAGE and transferred to Immobilon-P membrane (Millipore). Membranes were probed with the antibody 6G7 directed against the HCV core protein (a gift from Harry Greenberg, Stanford University), or antibodies directed against egfp (Roche) or actin (Sigma, St. Louis). For metabolic labeling, cells were incubated in methionine-free medium for 1 hour before incubation with 35 S-methionine for 1 hour and extraction of protein. 25µg of protein was precipitated using trichloroacetic acid and 35 S-methionine incorporation was quantitated by filter binding. Alkaline phosphatase assay SEAP activity was determined in the culture media of cells transfected with Ntat2ANeo replicons as described in (2). Measurements were made over the first 21 hours without change of medium, after which the culture medium was changed every 24 hours. Sequence data Sequences of 5 and 3 NCRs of different HCV genotypes were obtained from the HCV database (http://hcv.lanl.gov), and representative examples of each genotype are shown in Supplemental Table 1. The strains were: H77c (genotype 1a), GenBank accession no. AF011751; HCV-N (1b), AF139594; JFH-1 (2a), AB047639; NZL1 (3a), D17763; HEMA51 (4a), D45193 and D45194; FR741 (5a), D50466 and D50467; TH271 (6f), D37848 and D37858. 4
References 1. M. Yi, S. M. Lemon, J. Virol. 78, 7904 (2004). 2. M. Yi, F. Bodola, S.M. Lemon, Virol. 304, 197 (2002). 3. M. Ikeda, M. Yi, K. Li, S. M. Lemon, J. Virol. 76, 2997 (2002). Supplementary figure legends Figure S1 Transfection with the 122-2 OMe oligomer does not affect total protein synthesis in replicon cells. Cells were pulse-labeled with 35 S-methionine 48 hours post transfection, and 35 S-methionine incorporation into total cellular protein was determined by filter binding. Results represent an average of triplicate experiments performed on four separate occasions, with standard deviations. Figure S2 Addition of synthetic mir-122 duplex to NNeo/C-5B replicon cells results in an increase in replicon RNA abundance. The indicated egfp sensor plasmids and wild-type (mir- 122wt) or mutant (mir-122p3) mir-122 duplexes were introduced into cells by transfection using lipofectamine 2000. Total RNA was extracted 48 hours later and replicon, egfp and actin RNA levels determined by Northern blotting. Quantitation of 5
the HCV-actin mrnas ratios from three independent Northern blot experiments and the standard deviations is shown. Supplementary tables Table S1 Conservation of the predicted mir-122 binding sites among HCV genotypes. The 5 NCR and 3 NCR sequences in HCV containing predicted mir-122 binding sites are shown for each genotype. The hexameric seed matches are indicated in bold type. The 5 and 3 adenosines that flank the seed sequence are highlighted in purple and green, respectively. The stop codon of the viral polyprotein gene is highlighted in pink. 6
Table S1 Genotype 5 UTR 3 UTR 1a 1b UGAUGGGGGCGACACUCCACC ------UGAAGGUUGGGGUAACACUCCG -AUUGGGGGCGACACUCCACC -----UGAACGGGGAGCUAAACACUCCA 2 -AAUAGGGGCGACACUCCGCC UAGAGCGGCACACACUAGGUACACUCCA 3 --UACGAGGCGACACUCCACC -----UGAGCUGGUAAGAUAACACUCCA 4 -UAUGAGAGCAACACUCCACC ---------UAGGCAGCUUAACACUCCG 5 -UAUUGGGGCGACACUCCACC -----UAGGCUGGGAGCUAAACACUCCA 6 --AAUGGGGCGACACUCCACC -UAGACAGGGAGCAUAAAUAACACUCCA