Supplementary Figure 1 EIciNAs were pulled down with an antibody to Pol II. (a) Western blot showing that pol II was efficiently pulled down with a pol II antibody in HeLa cell lysates. (b) The enrichment of 15 circnas in pol II CLIP was verified by qt-pc together with known pol II-associated U1 snna in HeLa cells. U7 snna was used as a negative control. CD1as is a circular NA and known microna sponge, which showed enrichment in Ago2 CLIP but not in pol II CLIP. (c)the same experiment as in b was performed with HEK293 cells, and the data also showed enrichment for circnas in pol II CLIP. (d) Pol II NA IP followed with DNase digestion treatment demonstrated that the association of circnas with pol II was abolished, indicating that pull down of EIciNAs by pol II is mediated by genomic DNA i.e., both pol II and EIciNAs might bind to chromatin for interaction. (e) T-PC gels show that CD1as is enriched but circeif3j and circpaip2 is not in Ago2 CLIP. (f) T-PC gels show that circcltc is expressed in HeLa cells but not in HEK293 cells although CLTC mna was expressed in both HeLa and HEK293 cells. T-PC primers (black arrows) for CLTC mna and circcltc are indicated beneath the gel. *, P value < 0.05, **, P value < 0.01. P values were determined with the two-tailed Student s t-test. All data were from triplicate experiments. Error bars represent the s.e.m.
Supplementary Figure 2 Verification of circnas with T-PC and FISH. (a) T-PC was performed with divergent primers corresponding to intron (primer set 1) or exon (primer set 2) sequences in circeif3j and circpaip2. PC products show that introns were retained in circeif3j and circpaip2. (b) T-PC was performed with divergent primers corresponding to the 5 exon and upstream intron closest to the 3 exon. PC products show that at least the upstream intron closest to the 3 exon was retained in all of the other 13 circnas. (c) Separate channels are shown for FISH images for circeif3j and circpaip2 in Fig. 1f. From these and subsequent FISH images, it is clear that circeif3j and circpaip2 are localized in the nucleus, but both also have some cellular heterogeneity in the nuclear distribution and perhaps copy number. (d) Separate channels are shown for the FISH images of EIF3J and PAIP2 mna in Fig. 1f. (e) Double FISH of the parental gene loci and a downstream intron of the indicated circna in the parental gene pre-mna. Essentially no FISH signal of the downstream intron was observed for the downstream intron. For EIF3J, only one (indicated with a white arrowhead) out of 38 cells imaged showed a positive FISH signal for the downstream intron (n=38 cells for EIF3J, and 30 cells for PAIP2). (f) FISH Images of circnas with or without sina knockdown of the indicated circna. (g) Dual FISH of circnas and mna of the parental genes after treatment with Nase. No FISH signal was detected for the mna. For all FISH images for circnas, junction probes were used unless specified. All FISH images were with HEK293 cells.
Supplementary Figure 3 Overexpression of circna and effects of EIciNA or mna knockdown. (a) Gel images show the size of the T-PC products with the divergent primers. Except for the vector control and the circ-exon constructs, the overexpressed circnas were also intron retaining examined with the primer set 1. The T-PC bands show the size of the PC product, and the band intensity does not represent relative expression levels. The junction in the circna produced by the circeif3j_1 kb plasmid was different from that of circeif3j, and this difference is shown in the gel image and sequence diagram below. (b) Knockdown of circeif3j or circpaip2 with the sina resulted in a decrease in the parental gene mna level in HEK293 cells. (c) ASO sequences for the knockdown of circeif3j and circpaip2. circeif3j ASO was used to target the intron contained in circeif3j, and a control ASO targeted intron 4 in the EIF3J gene; circpaip2 ASO targeted the junction of circpaip2, and a scrambled ASO was used as a control. Sequences in black indicated DNA, and sequences in green indicate NA. (d) Knockdown of circeif3j had no effect on the mna level of PAIP2 and CTDSPL2 (the 5 neighbouring gene of EIF3J); knockdown of circpaip2 had no effect on the mna level of EIF3J or MAT3 (the 5 neighbouring gene of PAIP2). (e) sina knockdown efficiency of circeif3j and circpaip2 for the experiments shown in Fig 3c. (f) Nuclear run-on experiments showed that mna knockdown had no effect on the transcription of the indicated genes. sina knockdown efficiency of EIF3J or PAIP2 mna is shown below the nuclear run-on data. All data were from triplicate experiments. Error bars represent the s.e.m. **, P value < 0.01. P values were determined with two-tailed Student s t-test.
Supplementary Figure 4 Effect of parental gene knockdown and circna overexpression. (a-c) Knockdown of EIF3J or PAIP2 mna with shna plasmids or sina had no effect on the level of circna. The diagrams below the bar figures show the positions of the shna- or sina-targeted sites in EIF3J or PAIP2. (d and e) Overexpression of circeif3j or circpaip2 with plasmids had no effect on the level of EIF3J or PAIP2 mna in HeLa (d) and HEK293 cells (e). All data were from triplicate experiments. Error bars represent the s.e.m. *, P value < 0.05, **, P value < 0.01. P values were determined with the two-tailed Student s t-test.
Supplementary Figure 5 EIciNA pulldown. (a) Biotin-labeled oligos (circeif3j oligo and circpaip2 oligo) complementary to the junction and intron sequences of the circnas were used for pulldown experiments. Oligos complementary to a downstream exon were used as control (cie-con and cip-con). circeif3j and circpaip2 could be pulled down by circna oligos as demonstrated by comparison with control oligos. The pulldown efficiency of the circnas and U7 snna (using biotin-labeled oligos complementary to U7) as percentage of input is shown in the right panel. PremNA of EIF3J and PAIP2 was not detected (N. D.) in the pulldown materials as examined with primer pairs corresponding to the last intron and exon of the gene. Semi-quantitative T-PC gels for circna (115 bp amplicon for circeif3j, and 166 bp circpaip2) and parental gene mna (97 bp amplicon for EIF3J mna, and 147 bp PAIP2) from the pulldown experiments are shown below. (b) Enrichment of U1, U2, U4, U5, and U6 snna in pol II CLIP was verified by qt-pc using HeLa cells. U7 snna and 5s rna were used as negative controls. (c) T-PC gel of U2 snna co-precipitated with circna. (d) Interactions between molecules were crosslinked, pol II was pre-cleared by immunoprecipitation (7.7% pol II remained), and pulldown of the circnas still yielded a significant amount of U1 snna compared with a pulldown without pol II pre-clearing. This result indicates that the interaction between U1 snna and circeif3j or circpaip2 does not necessarily require the presence of pol II. In contrast, it appears that most, if not all, U2 snna may interact with circna indirectly via association with pol II. (e and f) The pulldown experiments were carried out with Biotin-labeled oligos against the exonic sequences in the EIciNA (cieif3j-e oligo and cipaip2-e oligo); Oligos complementary to downstream exons in the mna were used as control (cie-con-e and cip-con- E). Similar results were obtained as compared to data with exon-intron oligos, although the pulldown efficiency of cieif3j-e oligo and cipaip2-e oligo was lower. N.D. (not detected, CT>35). All data were from triplicate experiments. Error bars represent the s.e.m. **, P value < 0.01. P values were determined with a two-tailed Student s t-test.
Supplementary Figure 6 ChIP of circna. (a) PC gels show that CHIP of the indicated circnas could pull down the promoters of corresponding parent genes (up panel) but not the promoters of the corresponding neighbouring genes (lower panel). peif3j (B), the B site shown in Fig. 3d was examined; ppaip2 (D), the D site shown in Fig. 3d was examined. Promoter sites for CTDSPL2 and MAT3 are shown in the diagram below the gel images. (b) Generally, gene bodies corresponding to parent genes could not be pulled down with CHIP. One site for each gene body (D site for EIF3J; G site for PAIP2) showed some enrichment although to lesser degree compared with the enrichment found at the promoter (Fig. 5d). D for EIF3J and G for PAIP2 are sites in the large introns just upstream of the circna sequences. Sites examined in the gene body are shown below the bar figures. Error bars represent the s.e.m. * P value < 0.05, P values were determined with a two-tailed Student s t-test. (c) ChIP results using the U1A, U1C, U2AF35, or U2AF65 antibodies for the promoter of the neighbouring genes (CTDSPL2 for EIF3J and MAT3 for PAIP2) are shown as a comparison for Fig. 3f. These results indicate that U1 snnp (U1A & U1C) binds to promoters of genes such as EIF3J and PAIP2 but not to the promoters of CTDSPL2 and MAT3. All data were from triplicate experiments.
Supplementary Figure 7 FISH images of circna, U1 snna and parental gene loci. (a) Additional representative Dual FISH images of circna and U1 snna. The Y/G ratio (Y refers to the yellow area, which is the colocalisation signal of circna and U1 snna; G refers to the green area and U1 snna signal) and the Y/ ratio ( refers to the red area and the circna signal) were calculated for each cell, and the data shown in Fig. 3g are the average ± standard deviation. n=80 cells for each circna. (b) epresentative FISH images for circna (red)/ U1 snna(green) /parent genomic loci (purple). The parental genomic loci are indicated with white arrowheads. For each circna, the upper panels provide examples in which the parental genomic loci are not localised to the circna (red)/ U1 snna(green) enriched region. The lower panels demonstrate examples in which parental genomic loci are localised to circna (red)/ U1 snna (green) enriched regions (same situation as shown in Fig. 4f). In ~65.4% (for EIF3J) and ~51.3% of cells (for PAIP2), the two parent gene loci are localised to regions concentrated with EIciNA and U1 snna (n=52 cells for EIF3J, 39 cells for PAIP2). FISH images capture the NA locations and genomic loci at a particular moment, and we speculate that the localisation of the genomic loci and/or NA in the nucleus may be dynamic. FISH signals for circna were detected with a junction probe.
Supplementary Figure 8 ChIP assay results. (a) Flow chart of the experimental setup for pol II, U1A, and U1C ChIP after sina knockdown. (b) Semiquantitative PC corresponding to the real-time PC results shown in Fig. 6e. (c) Association between pol II (pol II ChIP) and the gene body decreased upon sina-mediated knockdown of circna. eal-time PC results are shown, and the sites examined within the gene body are the same as those shown in Supplementary Figure. 6b. All data are from triplicate experiments. Error bars represent the s.e.m. *, P value < 0.05, and **, P value < 0.01. P values were determined with a two-tailed Student s t-test. (d) sina-mediated knockdown of circeif3j had no effect on the association between pol II and the PAIP2 gene body or vice versa. (e) Binding of pol II to parental gene promoters was not altered by knockdown of parental mna. The sites examined within the gene promoter are the same as those shown in Fig. 5d.
Supplementary Table 1. 15 circular NAs with top reads # name chromosome start end distance of splice site reads (Pol II/IgG) DNA coding strand 1 circeif3j chr15 44843073 44843720 647 2/0 + 2 circpaip2 chr5 138699447 138700432 985 2/0 + 3 circsc1 chr3 157839891 157841780 1889 3/0 + 4 circfundc1 chrx 44383247 44386611 3364 2/0-5 circmie1 chr1 67423741 67428843 5102 2/0 + 6 circss1 chr6 7303782 7310262 6480 2/0-7 circwd60 chr7 158662545 158669382 6837 2/0 + 8 circbm33 chr7 155465560 155473602 8042 6/0 + 9 circman1a2-1 chr1 117944807 117957453 12646 3/0 + 10 circman1a2-2 chr1 117944807 117963271 18464 5/1 + 11 circnap1l4 chr11 2972488 3000467 27979 2/0-12 circbptf chr17 65941524 65972074 30550 2/0 + 13 circman1a2-3 chr1 117944807 117984947 40140 2/0 + 14 circcltc chr17 57721636 57763169 41533 2/0 + 15 circcdk11b chr1 1586822 1650894 64072 16/2 -
Supplementary Table 2. circnas from Pol II CLIP Pol II CLIP seq # chrom start end n_reads strand n_uniq best_q ual_a best_q ual_b spliced_at _begin distance_o f_splicesit e 1 chr1 1586822 1650894 16-15 40 6 0 64072 2 chr7 155465560 1.55E+08 6 + 6 40 40 1 8042 3 chr1 117944807 1.18E+08 5 + 5 40 40 4 18464 4 chr3 157839891 1.58E+08 3 + 3 40 40 38 1889 5 chr1 117944807 1.18E+08 3 + 2 40 40 4 12646 6 chr7 158662545 1.59E+08 2 + 2 40 5 10 6837 7 chr1 67423741 67428843 2 + 2 5 40 81 5102 8 chr15 44843073 44843720 2 + 2 40 5 324 647 9 chrx 44383247 44386611 2-2 40 40 0 3364 10 chr6 7303782 7310262 2-2 40 40 121 6480 11 chr17 57721636 57763169 2 + 2 40 40 5 41533 12 chr5 138699447 1.39E+08 2 + 2 40 6 25 985 13 chr1 117944807 1.18E+08 2 + 2 40 40 4 40140 14 chr11 2972488 3000467 2-2 1 40 9 27979 15 chr17 65941524 65972074 2 + 2 40 40 1 30550 16 chr10 103557736 1.04E+08 1-1 40 3 0 15627 17 chr7 11021998 11030474 1 + 1 40 40 100 8476 18 chr9 103082546 1.03E+08 1-1 40 40 0 20105 19 chr1 117944807 1.18E+08 1 + 1 40 6 4 64242 20 chr14 56114742 56115588 1 + 1 40 4 4 846 21 chr21 45106684 45108121 1 + 1 5 40 49 1437 22 chr1 226333940 2.26E+08 1-1 4 40 1 374 23 chr9 116811370 1.17E+08 1-1 36 40 0 89 24 chr16 1774557 1779579 1 + 1 40 40 0 5022 25 chr10 74468040 74475660 1 + 1 40 40 0 7620 26 chr3 119720892 1.2E+08 1-1 40 40 0 91548 27 chr12 116534473 1.17E+08 1-1 4 40 0 14844 28 chr19 10274001 10288043 1-1 40 40 121 14042 29 chr17 73315365 73315931 1-1 40 5 0 566 30 chr11 85707868 85733512 1-1 40 40 0 25644 31 chr9 138741982 1.39E+08 1-1 4 40 0 16400 32 chr19 17212469 17213367 1 + 1 40 40 0 898 33 chrx 48972079 48974164 1-1 40 40 0 2085 34 chr12 30814074 30819185 1-1 5 40 0 5111 35 chr16 80718434 80719026 1-1 0 40 0 592
36 chr7 155465560 1.55E+08 1 + 1 40 4 1 422 37 chr7 91924202 91991587 1 + 1 40 5 25 67385 38 chr9 35060490 35060869 1-1 40 5 1 379 39 chr11 117109316 1.17E+08 1 + 1 2 40 0 1260 40 chr13 73409380 73505405 1 + 1 0 40 0 96025 41 chr19 810550 810620 1 + 1 40 40 0 70 42 chr17 38318005 38319154 1 + 1 40 5 5 1149 43 chr19 54646664 54653493 1 + 1 40 5 4 6829 44 chr8 126061247 1.26E+08 1-1 5 40 0 8661 45 chr2 202010100 2.02E+08 1 + 1 40 5 0 4458 46 chrun 117851 153184 1-1 0 35 1 35333 47 chrun 117855 154737 1-1 0 40 4 36882 48 chr2 48049356 48050499 1-1 3 40 0 1143 49 chr3 145838898 1.46E+08 1-1 5 40 0 3118 50 chr7 148716083 1.49E+08 1-1 4 40 144 2156 51 chr22 36745045 36745257 1-1 40 6 0 212 52 chr6 76527240 76532544 1 + 1 40 40 1 5304 53 chr16 396147 397106 1-1 5 40 1 959 54 chrun 117866 118020 1-1 0 40 1 154 55 chrun 117861 154728 1 + 1 0 40 1 36867 56 chr12 79986390 79990438 1-1 40 5 0 4048 57 chr5 134113263 1.34E+08 1 + 1 40 4 64 4513 58 chr8 61653817 61707686 1 + 1 40 40 0 53869 59 chr19 30476129 30477324 1 + 1 6 35 0 1195 60 chrun 117855 159004 1-1 0 36 4 41149 61 chr1 90180254 90180353 1-1 5 40 1 99 62 chr1 1586822 1650892 1-1 40 5 0 64070 63 chr4 52729602 52744020 1 + 1 3 40 0 14418 64 chr16 74491771 74493687 1-1 5 40 0 1916 65 chr4 184129105 1.84E+08 1 + 1 40 5 0 1073 66 chr4 178274461 1.78E+08 1 + 1 5 40 0 421 67 chr11 77336007 77336863 1-1 4 40 10 856 68 chr5 179665331 1.8E+08 1-1 40 4 0 2824 69 chr1 117944807 1.18E+08 1 + 1 40 40 4 3460 70 chr1 62910408 62911100 1 + 1 0 40 49 692 71 chr8 117737147 1.18E+08 1-1 40 3 0 1264 72 chr2 97877405 97879184 1 + 1 0 40 0 1779 73 chr10 13212921 13214765 1 + 1 6 40 16 1844 74 chr8 62550505 62566219 1-1 40 40 401 15714 75 chr5 139818045 1.4E+08 1 + 1 40 4 9 26316 76 chr5 70828134 70838092 1 + 1 40 5 0 9958 77 chr14 24679553 24681035 1-1 40 40 0 1482 78 chr1 173409601 1.73E+08 1-1 4 40 0 1635 79 chr6 56915571 56955692 1 + 1 0 40 0 40121
80 chr5 37036480 37064080 1 + 1 6 40 0 27600 81 chr21 38747352 38792686 1 + 1 5 40 0 45334 82 chr4 2659529 2692697 1 + 1 40 5 1 33168 83 chr2 211458195 2.11E+08 1 + 1 40 5 1 261 84 chr19 39959778 39960038 1 + 1 40 5 0 260 85 chr6 57183234 57190843 1 + 1 40 3 0 7609 86 chr11 65267224 65267394 1 + 1 40 3 1 170 87 chr17 953289 1003975 1-1 5 40 1 50686 88 chr12 80187642 80215970 1-1 5 40 0 28328 89 chr18 2700536 2729407 1 + 1 40 40 0 28871 90 chr5 61733100 61789951 1 + 1 40 40 0 56851 91 chr10 38120159 38146176 1-1 40 40 0 26017 92 chr7 2252846 2259091 1-1 40 5 0 6245 93 chr11 33163212 33182915 1-1 5 40 0 19703 94 chr4 139993019 1.4E+08 1-1 40 6 1 1702 95 chr10 14961736 15057470 1-1 0 40 0 95734 96 chr10 225933 226068 1 + 1 40 3 0 135 97 chr5 179714531 1.8E+08 1-1 40 40 1 143 98 chr8 128129121 1.28E+08 1-1 4 40 0 32796 99 chr3 65978419 65978515 1 + 1 4 40 0 96 100 chr11 14852243 14891176 1 + 1 3 40 1 38933 101 chr12 132588541 1.33E+08 1 + 1 40 40 0 22051 102 chr5 179007947 1.79E+08 1 + 1 3 40 1 8701 116 chr15 91029261 91035943 1 + 1 40 40 1 6682 115 chr17 1383820 1384179 1-1 40 40 0 359 114 chr17 26913161 26918841 1 + 1 40 5 0 5680 112 chr19 19603114 19618462 1 + 1 40 40 0 15348 113 chr12 464323 472263 1-1 4 40 0 7940 103 chr7 5754683 5765069 1-1 4 40 9 10386 104 chr4 38933071 38937411 1 + 1 40 4 16 4340 105 chr8 124349864 1.24E+08 1-1 5 40 1 1822 106 chr17 57808781 57832216 1 + 1 36 3 0 23435 107 chr11 12785725 12785981 1 + 1 5 40 10 256 108 chr6 14131750 14136140 1 + 1 5 40 1 4390 109 chr4 187627716 1.88E+08 1-1 40 35 0 3283 110 chr4 68370922 68376588 1-1 40 4 1 5666 111 chr7 36366189 36366527 1-1 40 40 0 338 All reads have only one breakpoints. chrun means chrun_gl000220.
Supplementary Table 3. circnas from IgG control IgG CLIP seq # chro m start end n_read s strand n_uniq best_ qual_ A best_ qual_ B spliced_ at_begin distance_ of_splicesi te 1 chr5 1.4E+08 1.37E+08 1-1 5 40 0 3059 2 chr6 1.4E+08 1.36E+08 1-1 40 40 0 216 3 chr2 7.2E+07 71617769 1 + 1 40 6 0 80 4 chr19 4.2E+07 41778023 1-1 5 40 0 7418 5 chr3 1E+08 1E+08 1-1 40 40 0 106 6 chr2 5.8E+07 58316858 1 + 1 3 40 0 5635 7 chr5 1.7E+08 1.68E+08 1-1 6 40 1 96 8 chr17 4.9E+07 49075978 1-1 40 40 4 8168 9 chr10 1E+08 1.02E+08 1-1 40 40 0 1981 10 chr3 4.1E+07 40557750 1 + 1 40 40 1 224 11 chr13 1.1E+08 1.07E+08 1-1 40 40 0 2610 12 chr1 1.2E+08 1.18E+08 1 + 1 40 40 4 18464 13 chr12 1E+08 1.05E+08 1 + 1 40 40 25 2335 14 chr2 1.1E+08 1.09E+08 1 + 1 5 35 0 16157 15 chr3 1.3E+08 1.29E+08 1 + 1 40 35 0 18112 16 chrx 1.8E+07 17752599 1 + 1 4 37 1 5818 17 chr13 9.6E+07 96377506 1 + 1 5 40 0 2011 18 chr4 4E+07 39757359 1 + 1 5 40 0 18320 19 chr20 1.8E+07 18123563 1 + 1 6 40 1 712 20 chr6 1.5E+08 1.5E+08 1-1 40 5 0 4198 21 chrun 117861 118097 1 + 1 40 40 2 236 22 chr2 2.9E+07 29170027 1 + 1 40 5 0 45175 23 chr18 1.9E+07 19371518 1 + 1 3 40 0 25786 24 chr6 4.3E+07 43006123 1-1 40 40 0 59 25 chr8 1.4E+08 1.36E+08 1-1 40 5 0 10220 26 chr1 1586822 1650894 2-2 40 5 0 64072 All reads have only one breakpoints. chrun means chrun_gl000220.
Supplementary Table 4. Oligos used in the study Oligo name Sequence (5' - 3') Purpose Amplicon circeif3j_div-f circeif3j_div- AAAAGAGAAAGAACGGCAACA CCTGGTTTTACTTCTGCTTCC Divergent primers for eal-time PC and T-PC detection of circeif3j in cdna or genomic DNA(gDNA) 115 bp circpaip2_div-f circpaip2_div- AGCTCGAGATCTCCCACAAA ACTGCTGCGACTTGGATCTT Divergent primers for eal-time PC and T-PC detection of circpaip2 in cdna or genomic DNA(gDNA) 166 bp circfundc1_div- TGATTTCAGGTGCTGCTTTG F circfundc1_div- AGCATTTTGCCATCTGAAGC hsa-circna2_div- TGTGGGAAGCAAGGAGGAACTT F GA hsa-circna2_div- TCTTGAAGTGAGCTGTGTCAGG CA Divergent primers for eal-time PC and T-PC detection of circfundc1 in cdna or genomic DNA(gDNA) Divergent primers for eal-time PC and T-PC detection of hsacircna2 in cdna or genomic DNA(gDNA) 180 bp 130 bp β-actin_div-f β-actin_div- AAAGGCGAGGCTCTGTGCT GGGCTTACCTGTACACTGACTTG A Divergent primers for T-PC detection of circular β-actin in cdna or genomic DNA(gDNA) circeif3j_con-f circeif3j_con- AGCTGGGAAAGGTTTGGTCT TCTTGCCTTTTCTTCTGTTGC convergent primers for T-PC detection of circeif3j in cdna or gdna 187 bp circpaip2_con-f circpaip2_con- TCCTTAGCATGGAAGCAGAAA CCTCTTCCAGCATTTCTTGG convergent primers for T-PC detection of circpaip2 in cdna or gdna 199 bp circfundc1_con- CCCGGTCACATTTTCTGCTA F circfundc1_con- GCAGCACCTGAAATCAACAA hsa-circna2_con- CAGTAGTGGTAATAGCCAAAGG F AGA hsa-circna2_con- CAATCAGTCTTTTTCATCCTGTT TT convergent primers for T-PC detection of circfundc1 in cdna or gdna convergent primers for T-PC detection of hsa-circna2 in cdna or gdna 125 bp 170 bp β-actin_con-f β-actin_con- TTGTTACAGGAAGTCCCTTGCC) ATGCTATCACCTCCCCTGTGTG convergent primers for T-PC and real-time PC detection of β-actin in cdna or gdna 101 bp circsc1-f circsc1- TATGGCTCCAGAAGGAAACG GGACCGTCTACGGTGTTTCT circsc1 175 bp
circmie1-f circmie1- GATTATGGTGGGCTCCATGT TTCCTCTTCTTCCTCTTCCTCA circmie1 173 bp circss1-f circss1- TTGTGCCACTGCTAACAAGC GGAAGAAGATGTGTCTGGTGAA circss1 100 bp circwd60-f circwd60- GAAAGATGAAGACTCTGAAAGA GG CTGAGGTCATCTGCTTTCCA circwd60 108 bp circbm33-f circbm33- CCACGAAGCTGAGTTGACAG GCCAGATAGCAAATCTTCTCCA circbm33 167 bp circman1a2-1-f circman1a2-1- ATGGGCAAAGATGGATTGAA TGCTCGAATTTCCTCTCTTGA circman1a2-1 152 bp circman1a2-2-f circman1a2-2- GGAGGCCTACTTGCAGCATA GCTTCTTCCAAGGCCTTCTC circman1a2-2 109 bp circman1a2-3-f circman1a2-3- GCAATTGGCTGAGAAACTCC GCTTCTTCCAAGGCCTTCTC circman1a2-3 144 bp circnap1l4-f circnap1l4- TCCACGGAATCTGAAGGAAC GGAGAAGACGAGGATGATGC circnap1l4 108 bp circbptf-f circbptf- TCCAAGTGACTCCCCATTTT CTTCTGCTGGACCCACACTT circbptf 192 bp circcltc-f circcltc- TGCCCTATTTCATCCAGGTC GGGCCTGCTCTCCTACTTTT and circcltc 150 bp circcdk11b-f circcdk11b- TGGTTTGATGGCCAAAGAAT CCGCATGGAGATCACAATAA circcdk11b 100 bp CD1as-F CD1as- AACTACCCAGTCTTCCATCA AGACTTGAAGTCGCTGGAAG CD1as 168 bp
U1-F U1- CTCGCTTCGGCAGCACATAT ACACGCAAATTCGTGAAGCG U1 NA 164 bp U2-F U2- CTCGGCCTTTTGGCTAAGAT TATTCCATCTCCCTGCTCCA U2 NA 116bp U4-F U4- TGGCAGTATCGTAGCCAATG CTGTCAAAAATTGCCAGTGC U4 NA 117bp U5-F U5- TGGTTTCTCTTCAGATCGCATA CAAAGCAAGGCCTCAAAAA U5 NA 102bp U6-F U6- ACTCTTACCTCGGCAGGGGAG GGAAAGCGCGAACGCAGTCC U6 NA 92 bp U7-F U7- CAGTGTTACAGCTCTTTTAG AGGGGCTTTCCGGTAAAAAG U7 NA 63bp 5s rna-f 5s rna- CCTACAGCACCCGGTATTC CTACGGCCATACCACCCTG 5s rna 121bp 7SK-F TGATCGCCAGGGTTGATT 7SK- GGGATGGTCGTCCTCTTC eal-time PC for 7SK NA GAPDH-F GAPDH- CCACTCCTCCACCTTTGAC ACCCTGTTGCTGTAGCCA eal-time PC for GAPDH mna EIF3J-F EIF3J- TTGGAAGTCTTAGTTCGAGATGT G TTCACTGCAAAGCACAGTCA EIF3J mna 97bp PAIP2-F PAIP2- AGCTCGAGATCTCCCACAAA TTCACCCCAGGAACAAACTC PAIP2 mna 147bp pre-eif3j-f pre-eif3j- CCAGATAAGATGCCCATAGCA TTTAATCCCCCTCCAGGAAC eal-time PC for EIF3J pre-mna
pre-paip2-f pre-paip2- GGAAGATGTTTTTGCATGAGG TCCTTTGCATTTGGATTCAG eal-time PC for PAIP2 premna CLTC-F CLTC- AAGCTCATCTTTGGGCAGAA ACGGTTTCACCAGTGGTAGC T-PC for CLTC mna 291bp CTDSPL2-F CTDSPL2- GAATGAAACCGGCTTGTTGT TCTCCTGCTCTTGGTGTTGA eal-time PC for CTDSPL2 mna MAT3-F MAT3- CCATGGACTCTTACCGAAGG GACGACTGTGACTTGCTCCA eal-time PC for MAT3 mna promoter-eif3j-a- F promoter-eif3j-a- promoter-eif3j-b- F promoter-eif3j-b- promoter-eif3j-c- F promoter-eif3j-c- promoter-eif3j-d- F promoter-eif3j-d- TGCTTTTTGTGGCAGTCATC GAGGCCAGCACATTGATTTT AAGGGAAAAGCCTCGAAGAC GACCCCAGAGGGAGTCGT ACAGTGACCAGAGGGACAGC GGAAACGTAAGTGCCAGGAA CAGCACCACGAACTCCAGTA GTAAGAAGTGGGCGGGGAAC eal-time PC for promoter of EIF3J gene promoter of EIF3J gene promoter of EIF3J gene eal-time PC for promoter of EIF3J gene 169bp 134bp promoter-eif3j-e-f GTCAGCCACGGTCCCATC promoter-eif3j-e- AGCGTGTGTGAGAGGGAGAG promoter-paip2-a- F CAGGAAGGAAGCATGGGTAA promoter-paip2-a- CTGGATGCAAACGCAAAATA promoter-paip2-b- F GTGCCTGCACATGTCTGAGT promoter-paip2-b- ACCCATACACACCCCAAGAA promoter-paip2-c- F GTCAGGGTGCTCTTCAGTCC promoter-paip2-c- TTCTCTCTGGAAGGCAGGAA eal-time PC for the first exon of EIF3J gene eal-time PC for promoter of PAIP2 gene eal-time PC for promoter of PAIP2 gene eal-time PC for promoter of PAIP2 gene
promoter-paip2-d- F AGCTCTCTATCCGGGTCCTC promoter-paip2-d- GCAGGCGTAAAGTGGGTAGA promoter-paip2-e- F AGCTGACAGCCTTTGACGTT promoter-paip2-e- CAAACACAACCTACGCCAGA promoter of PAIP2 gene eal-time PC for the first exon of PAIP2 gene 165bp pctdspl2_a-f pctdspl2_a- TCAGCCTCTCTTGCCATCTT GTGTTGCAGGGGAAGAGTGT eal-time PC for promoter of CTDSPL2 gene pctdspl2_b-f pctdspl2_b- ACAAAAATTAGCCGGTCGTG ATACTGCCTTCCCCAAAGGT eal-time PC for promoter of CTDSPL2 gene pctdspl2_c-f pctdspl2_c- AGGCTTGGTTTTCCGATACC CCTATGTTGGCGGTGATTCT promoter of CTDSPL2 gene 157bp pctdspl2_d-f pctdspl2_d- ATGAGCTGGAAAGGGAACCT TAGGTGGAGCTGAGGGGATA eal-time PC for promoter of CTDSPL2 gene pctdspl2_e-f pctdspl2_e- CTACGGAGGCCCCTAATGTA CCGTGAAGAGCGTTGAAGTT eal-time PC for the first exon of CTDSPL2 gene pmat3_a-f pmat3_a- CTGCATAGCTCCCTGTCCTC TTTCGCTTTCTTTCCTTCCA eal-time PC for promoter of MAT3 gene pmat3_b-f pmat3_b- CGGATGTGGGCATTGATTAT CATAGGCTCTGGTTGGGAAA eal-time PC for promoter of MAT3 gene pmat3_c-f pmat3_c- TTGTAGGCCTTCCACTCTGG GTCAGGCAGAGTCCTTGGTC promoter of MAT3 gene 132bp pmat3_d-f pmat3_d- TGCAGAGGTCAGCAGTAGGA TCCCACGCATATCCTTTTTC eal-time PC for promoter of MAT3 gene pmat3_e-f pmat3_e- TGGCTCCACTAGGACACACA GCAGAGGTGAACCTGCTTCT eal-time PC for the first exon of MAT3 gene
EIF3J-A'-F EIF3J-A'- ACGAGGACGAGGACGTCAAG AAGCGGAGGGGAAGAGAG EIF3J gene EIF3J-B'-F EIF3J-B'- ATGTGTGGGCCGAAGACT CGATGCTGTCACCTTTCGT EIF3J gene EIF3J-C'-F EIF3J-C'- TCCTCAGCCTCCTAAAATGC AGCCTTGTCTGCAACTCCTC EIF3J gene EIF3J-D'-F EIF3J-D'- CTCAGCCTCCCAAGTAGCTG AGGCAGATCACGAGGTCAAG EIF3J gene EIF3J-E'-F EIF3J-E'- CCATGCCCACCTAATTTTTG CCTTCATGGATCCCACTCTC EIF3J gene EIF3J-F'-F EIF3J-F'- CAGAACGCTCACAAAATGGA GGCAGGGCTTAGATCATTCA EIF3J gene EIF3J-G'-F EIF3J-G'- AGACCATCCTGGCTAACACG GCCTCCTGAGTTCACACCAT EIF3J gene EIF3J-H'-F EIF3J-H'- GCGAGGGCTACAGGTGAATA TGGTGGTGGCATGTATCTGT EIF3J gene EIF3J-I'-F EIF3J-I'- ACTGGGGGTGTGTTAATGGA AACACACCATTGCTCAACCA EIF3J gene EIF3J-J'-F EIF3J-J'- AAGTGGAAAACAAGACCATCAT C TCTTAGCCCTTGTCTGCCTTA EIF3J gene PAIP2-A'-F PAIP2-A'- TTTCACCCTCTTTTGGTCAGA TCAACCAAATTGCTGTGCTAA PAIP2 gene PAIP2-B'-F PAIP2-B'- ACCTCTGCCCCCTTGTAATC ACTTGCTCTGCCCATTTCAC PAIP2 gene
PAIP2-C'-F PAIP2-C'- TCTCCCTCTGATGCTCAGGT CCCCGTCTCTAAAAATGCAA PAIP2 gene PAIP2-D'-F PAIP2-D'- GGGAGGCAGAGGTTACAGTG CCACCACACCTGGCTAACTT PAIP2 gene PAIP2-E'-F PAIP2-E'- CCTGGGCAACAAGAATGAAA GGCCCTAATTTGCTTGAATG PAIP2 gene PAIP2-F'-F PAIP2-F'- CTCCCTTGGGGACAGTTTCT TGTTGGGATTACAGGCGTAAG PAIP2 gene PAIP2-G'-F PAIP2-G'- ACGTGGTGAAACCCTGTCTC TGCCTCCTGGTTCAAGAGAT PAIP2 gene PAIP2-H'-F PAIP2-H'- CCAGGCTTAACTGCTTACGG AAGGCAGTGGTTTCCACATC PAIP2 gene PAIP2-I'-F PAIP2-I'- TGGTGTCGTTGCACTCTAGC GACCCAGCCAGTTCTCACTC PAIP2 gene PAIP2-J'-F PAIP2-J'- GAGTGGTGCTTTTCCTTGCT GGCAGCTTAACCTACCCAAA PAIP2 gene circeif3j_intron-f CAAGTGTCCTTCCATTCCCA circeif3j_intron- GAGCGTTCTGTCATTTGTCT primer set 1 for circeif3j Full length PC 620bp circeif3j_exon4_ DivF circeif3j_exon4_ Div AACGGCAACAGAAGAAAAGG TTTTTCTTTTCTGAAATTTTTACC T primer set 2 for circeif3j Full length PC 622bp circpaip2-intron-f AGAGCTCTCAGATGGTTCCA circpaip2-intron- TCCTGATTCAGACATCTCTA primer set 1 for circpaip2 Full length PC 956bp circpaip2_exon3_ DivF circpaip2_exon3_ Div GACCAAATCCAAGACCAGTTT CGAGCTGGAATAAACCATTCA primer set 2 for circpaip2 Full length PC 968bp
circsc1_intron- F circsc1_intron- circfundc1_intro n-f circfundc1_intro n- circmie1_intron- F circmie1_intron- GCTTCCAGGAAACAGTGAGA ACGAGGCTGAAGATCTCTGG CCCGGTCACATTTTCTGCTA GCCAGAGTCTCTAGGGCAAG TTATGGTGGGCTCCATGTTT ACAGGGGATTTCCAATTTTT divergent primers corresponding to the 5 exon and the upstream intron closest to the 3 exon of circsc1 divergent primers corresponding to the 5 exon and the upstream intron closest to the 3 exon of circfundc1 divergent primers corresponding to the 5 exon and the upstream intron closest to the 3 exon of circmie1 426bp 330bp 399bp circss1_intron-f circss1_intron- TTGTGCCACTGCTAACAAGC TGAGTCGGAGTCTTGCATTG divergent primers corresponding to the 5 exon and the upstream intron closest to the 3 exon of circss1 437bp circwd60_intron- TCTTGAGTTGGAGGCATGTG F circwd60_intron- CTGAGGTCATCTGCTTTCCAG circbm33_intron- GGGCTATATGCATTGCCAGT F circbm33_intron- GCCAGATAGCAAATCTTCTCCA circman1a2- TACACTGAATGTGAAGGGAATC 1_Intron-F TT circman1a2- AATAGGGACTGGTGGCAGTG 1_Intron- circman1a2- AATGGCTTGTTGGTTTCAGG 2_Intron-F circman1a2- AATAGGGACTGGTGGCAGTG 2_Intron- circnap1l4_intron CCCTCAATCCACAAAACAAAA -F circnap1l4_intron GGAGAAGACGAGGATGATGC - circbptf_intron-f TAACCTCCAGGGTGAACCAG circbptf_intron- CTTCTGCTGGACCCACACTT divergent primers corresponding to the 5 exon and the upstream intron closest to the 3 exon of circwd60 divergent primers corresponding to the 5 exon and the upstream intron closest to the 3 exon of circbm33 divergent primers corresponding to the 5 exon and the upstream intron closest to the 3 exon of circman1a2-1 divergent primers corresponding to the 5 exon and the upstream intron closest to the 3 exon of circman1a2-2 divergent primers corresponding to the 5 exon and the upstream intron closest to the 3 exon of circnap1l4 divergent primers corresponding to the 5 exon and the upstream intron closest to the 3 exon of circbptf 284bp 618bp 400bp 403bp 406bp 429bp circman1a2-3_intron-f circman1a2-3_intron- TCTCTGATTGCCAAATGCTG AATAGGGACTGGTGGCAGTG divergent primers corresponding to the 5 exon and the upstream intron closest to the 3 exon of circman1a2-3 442bp circcltc_intron-f CCCCTTGCAAAACCAGATT circcltc_intron- GGGCCTGCTCTCCTACTTTT divergent primers corresponding to the 5 exon and the upstream intron closest to the 3 exon of circcltc 437bp
circcdk11b_intro n-f circcdk11b_intro n- Bio-ciE-con Bio-circEIF3J-1 Bio-circEIF3J-2 Bio-circEIF3J-3 Bio-circEIF3J-4 Bio-ciE-con-E-1 Bio-ciE-con-E-2 Bio-ciE-con-E-3 Bio-ciE-con-E-4 Bio-ciE-con-E-5 Bio-circEIF3J-E-1 Bio-circEIF3J-E-2 Bio-circEIF3J-E-3 Bio-circEIF3J-E-4 Bio-circEIF3J-E-5 Bio-ciP-con Bio-circPAIP2-1 Bio-circPAIP2-2 Bio-circPAIP2-3 Bio-circPAIP2-4 Bio-ciP-con-E-1 Bio-ciP-con-E-2 Bio-ciP-con-E-3 GCTCTCTCTGGTTTTCGGTCT divergent primers corresponding to the 5 exon and the upstream intron CCGCATGGAGATCACAATAA closest to the 3 exon of circcdk11b TTCATGGTGGCTTTTAATCCCCC TCCAGGA As control of circeif3j pull-down GTCATCCCAGTTATCCCTCTTTT 5'-biotin-labeled oligonucleotide for TAATTTC circeif3j pull-down CTTCTGCTTCCTCTTTTTTTTCAT 5'-biotin-labeled oligonucleotide for CATCAT circeif3j pull-down TTTCTTCTTGCCTTTTCTTCTGTT 5'-biotin-labeled oligonucleotide for GCCGTT circeif3j pull-down CTTCTCTGCTATTTTTTTCTTTTC 5'-biotin-labeled oligonucleotide for TGAAAT circeif3j pull-down TTCATGGTGGCTTTTAATCCCCC TCCAGGA As control of circeif3j pull-down CCTTTGCTAATTCGAGGTCTGAC As control of circeif3j pull-down TCTTCCT CTGGTGTTAGCACTTTAGGTTCT TCGGGTT As control of circeif3j pull-down CACATCTCGAACTAAGACTTCC AAAAAACT As control of circeif3j pull-down GTCATCTCTTGAAGATGGGTTCA As control of circeif3j pull-down TAGCATC GTCATCCCAGTTATCCCTCTTTT 5'-biotin-labeled oligonucleotide for TAATTTC circeif3j pull-down GGTTTTACTTCTGCTTCCTCTTTT 5'-biotin-labeled oligonucleotide for TTTTCA circeif3j pull-down TTTTTCATCATCATCGTCATCCC 5'-biotin-labeled oligonucleotide for AGTTATC circeif3j pull-down CTTGCCTTTTCTTCTGTTGCCGT 5'-biotin-labeled oligonucleotide for TCTTTCT circeif3j pull-down CTTTTATCTTCTCTGCTATTTTTT 5'-biotin-labeled oligonucleotide for TCTTTT circeif3j pull-down CTTCACCCCAGGAACAAACTCC TTTGCATT As control of circpaip2 pull-down GTTGTCGTTTTTAACCACAAGAT 5'-biotin-labeled oligonucleotide for CTTCCAG circpaip2 pull-down CCATCCACATGTACTCTGCAAAT 5'-biotin-labeled oligonucleotide for GGATTGT circpaip2 pull-down CTTGGGCTAGTACTGCTGCGACT 5'-biotin-labeled oligonucleotide for TGGATCT circpaip2 pull-down TGGTCCATAGTTTGTGGGAGATC 5'-biotin-labeled oligonucleotide for TCGAGCT circpaip2 pull-down CTTCACCCCAGGAACAAACTCC TTTGCATT As control of circpaip2 pull-down CAGCTGGATTATGGGTTGGTATT As control of circpaip2 pull-down GGTCATA GGCTGGACTGGCACTCATCTGCT As control of circpaip2 pull-down GACTAAC 456bp
Bio-ciP-con-E-4 Bio-ciP-con-E-5 Bio-circPAIP2-E-1 Bio-circPAIP2-E-2 Bio-circPAIP2-E-3 Bio-circPAIP2-E-4 Bio-circPAIP2-E-5 Bio-U7-probe1 Bio-U7-probe2 Bio-U7-probe3 circeif3j_exon-f circeif3j_exon- circeif3j_flanking -F circeif3j_flanking - circeif3j_1kb-f1 circeif3j_1kb-1 circeif3j_1kb-f2 circeif3j_1kb-2 circpaip2_exon-f circpaip2_exon- circpaip2_flankin g-f circpaip2_flankin g- circpaip2_1kb-f1 circpaip2_1kb-1 CATCAAGCCATGGGGCCAATTC TATTTTCA As control of circpaip2 pull-down GAAATTGTGCTACATCCACCAA AAGAGGGC As control of circpaip2 pull-down GTTGTCGTTTTTAACCACAAGAT 5'-biotin-labeled oligonucleotide for CTTCCAG circpaip2 pull-down CACATCTTCATTGATGATGCTTG 5'-biotin-labeled oligonucleotide for GGCTAGT circpaip2 pull-down TGCTGCGACTTGGATCTTTCATG 5'-biotin-labeled oligonucleotide for GCTGATG circpaip2 pull-down GTCATTAAACTGGTCTTGGATTT 5'-biotin-labeled oligonucleotide for GGTCCAT circpaip2 pull-down CTCTTCCAGCATTTCTTGGAAAC 5'-biotin-labeled oligonucleotide for AGCGTTC circpaip2 pull-down AGGGGCTTTCCGGTAAAAAGCC 5'-biotin-labeled oligonucleotide for AGAAAGCC U7 snna pull-down TACTAGACAAATTCTAAAAGAG 5'-biotin-labeled oligonucleotide for CTGTAACA U7 snna pull-down CGGTAAAAAGCCAGAAAGCCTA 5'-biotin-labeled oligonucleotide for CTAGACAA U7 snna pull-down GGGGTACCAAGGATAACTGGGA plasmid construction for TGACGATG circeif3j_exon and circeif3j_exon/intron TTCTTCTTGC GGGGTACCTTGTAGTGAGCCTA GATCATGCCATTG plasmid construction for CGGGATCCATAGCACATGGCAC circeif3j_flanking AGAAATGAACAA CCCAAGCTTGTGAGCTGAGATC GTGACATTGCAC plasmid construction for GGGGTACCACCCTCTTTTTAATT circeif3j_1kb TCTTCTTGC CGGGATCCGTGAGCTGAGATCG TGACATTGCAC plasmid construction for GGGGTACCCTTGCATGTTTGCTT circeif3j_1kb TTCTATGTGA GGGGTACCTCAGGTTAAAAACG plasmid construction for ACAACCAAC circpaip2_exon and circpaip2_exon/intron CCAGAGAAG TCAAGCTTTGCTGGGATTACAG GCATGA plasmid construction for GTGGATCCTCACAGGCATGTGC circpaip2_flanking TACCAT GGGGTACCTTCACCATGTTAGG CTGGTCTC plasmid construction for GGGGGCCCACCACAAGATCTTC circpaip2_1kb CAGAGAAG
circpaip2_1kb-f2 circpaip2_1kb-2 circeif3j(exon probe)-f circeif3j(exon probe)- circeif3j(intron probe)-f circeif3j(intron probe)- circpaip2(exon probe)-f circpaip2(exon probe)- circpaip2(intron probe)-f circpaip2(intron probe)- EIF3J_genomic loci-f1 EIF3J_genomic loci-1 EIF3J_genomic loci-f2 EIF3J_genomic loci-2 EIF3J_genomic loci-f3 EIF3J_genomic loci-3 PAIP2_genomic loci-f1 PAIP2_genomic loci-1 PAIP2_genomic loci-f2 PAIP2_genomic loci-2 PAIP2_genomic loci-f3 PAIP2_genomic loci-3 U1 NA_FISH-F U1 NA_FISH- CGGGATCCTTCACCATGTTAGGC TGGTCTC plasmid construction for GGGGGCCCGAACAACAGCACAG circpaip2_1kb TTAATTTAC AGGTAAAAATTTCAGAAAAG TAATACGACTCACTATAGGGCC TCTTTTTAATTTCTTC CTTGCTGTAT TTCTGTATGA TAATACGACTCACTATAGGGCC CTAAGATCCAAATATCTC GAGGAGTTATGGGAAGAAGA TAATACGACTCACTATAGGGCA AGATCTTCCAGAGAAGAG GGCTGCTGATTACTACCAGG TAATACGACTCACTATAGGGGA CTGCTCAATGGAACCATC CACTGCACCTGGCCTATTTA CATGTGCTACCACGAACTGG TTGCCACTCAGCTTCAAATG TATCGGCAAGACCCAGTCTC ACTGGGGGTGTGTTAATGGA AAGGCAGGCAGGTAACTTGA ATGACAGGAAGGAAGCATGG AACTGTGTGACCATGGCAAG CGACACCACACCTGGCTAC ACACTTCTTCCCTCCCCAAT GCAGAGTCTCACGACATGGA ACTGGGCCCATACTCAAGTG TAATACGACTCACTATAGGGCA GGGGAAAGCGCGAACGCA ATACTTACCTGGCAGGGGAG For Northern blot probe of both EIF3J mna and circeif3j For Northern blot probe of circeif3j only for Northern blot probe of both PAIP2 mna and circpaip2 for Northern blot probe of circpaip2 only For EIF3J loci DNA FISH probe For EIF3J loci DNA FISH probe For EIF3J loci DNA FISH probe For PAIP2 loci DNA FISH probe For PAIP2 loci DNA FISH probe For PAIP2 loci DNA FISH probe For U1 NA FISH probe
EIF3J_downstream intron_fish-f GTTCATTCTAGTCAGCAGTA EIF3J_downstream intron_fish- TAATACGACTCACTATAGGGGC TTGAATTCGGGAGGCAGA PAIP2_downstream ACCAGCCTGGCCAACGTGGT intron_fish-f PAIP2_downstream TAATACGACTCACTATAGGGCC intron_fish- TCCGCCTCCCAGATTCAA EIF3J mna_fish-f CAGATAAACTGCGGCTAAAG EIF3J mna_fish- CTTGAAGATGGGTTCATAGC PAIP2 mna_fish-f GGAGTTTGTTCCTGGGGTGA PAIP2 mna_fish- TAACACAGTGACAAGAGAGC circeif3j_junction probe_fish-f AAAAGAGAAAGAACGGCAACA circeif3j_junction probe_fish- CCTGGTTTTACTTCTGCTTCC circpaip2_junction probe_fish-f AGCTCGAGATCTCCCACAAA circpaip2_junction probe_fish-f ACTGCTGCGACTTGGATCTT circeif3j_intron probe_fish-f CTTGCTGTATTTCTGTATGA circeif3j_intron TAATACGACTCACTATAGGGCC probe_fish- CTAAGATCCAAATATCTC circpaip2_intron probe_fish-f GGCTGCTGATTACTACCAGG circpaip2_intron TAATACGACTCACTATAGGGGA probe_fish- CTGCTCAATGGAACCATC CTPSPL2_genomic loci-f1 CTTAATCGACCCAGTACTAA CTPSPL2_genomic loci-1 TGTCTGGCTTAGATATATGC CTPSPL2_genomic loci-f2 AGGTAGTTGACTGTGTGGTA CTPSPL2_genomic loci-2 CCAAGCTGGTCTTGAACTCC CTPSPL2_genomic loci-f3 ATGCCTGTAATCCCAGCTAC CTPSPL2_genomic loci-3 CCTGGTCAATATGGTGAAAC CTPSPL2_genomic loci-f4 ATCAGGTTGTTGCTGATGTT CTPSPL2_genomic loci-4 TCTAATTATCACGGAAATGC For EIF3J downstream intron (intron4) FISH probe For PAIP2 downstream intron (intron3) FISH probe For EIF3J mna FISH probe For PAIP2 mna FISH probe For of circeif3j NA probe against junction region For of circpaip2 NA probe against junction region circpaip2 NA probe against junction region For of circeif3j NA probe against intron region For of circpaip2 NA probe against intron region For CTPSPL2 loci DNA FISH probe For CTPSPL2 loci DNA FISH probe For CTPSPL2 loci DNA FISH probe For CTPSPL2 loci DNA FISH probe
PATL2_genomic loci-f1 PATL2_genomic loci-1 PATL2_genomic loci-f2 PATL2_genomic loci-2 PATL2_genomic loci-f3 PATL2_genomic loci-3 PATL2_genomic loci-f4 PATL2_genomic loci-4 MAT3_genomic loci-f1 MAT3_genomic loci-1 MAT3_genomic loci-f2 MAT3_genomic loci-2 MAT3_genomic loci-f3 MAT3_genomic loci-3 MAT3_genomic loci-f4 MAT3_genomic loci-4 POB1_genomic loci-f1 POB1_genomic loci-1 POB1_genomic loci-f2 POB1_genomic loci-2 GACACAGAGAAAAGTGGCTG AGTCAGTAAGGATGACATGG CCTTCCAGAGGCTGGCAATG TAGTAGTCTCAGTTCCATCA GTGCCATGTGGCTGACTTTG GCCAGGTGGCAACAGCGTTA ATTGCTGCTGATGTGAGTCT CCCAAGCCATTCAACCTAAG CTGGGTCTGTTTTACTCGTC AAGACATGAGCCACCACATC GAGCCCAGGAGTTGGAGACC CCTTGGCATCTGCCAACATG GCAATGGTGCCAGGTGCAAG CTTGTCTCTACTAAAGCCTG CTGGCCTGGAATGCTAATCT GCCTGAGTGAGACCTTGTCA TGCTCCTCACTCTACTGAAG GCTTGAAGGGCTTCGCCGTG CCAGCATCTTCCTTCAGTCA CTAAGAGCAGACTCGACAGC For PATL2 loci DNA FISH probe For PATL2 loci DNA FISH probe For PATL2 loci DNA FISH probe For PATL2 loci DNA FISH probe For MAT3 loci DNA FISH probe For MAT3 loci DNA FISH probe For MAT3 loci DNA FISH probe For MAT3 loci DNA FISH probe For POB1 loci DNA FISH probe For POB1 loci DNA FISH probe scramble sina UUCUCCGAACGUGUCACGU scramble sina control circeif3j sina UCAUCCCAGUUAUCCCUCU circeif3j sina circeif3j sinacontrol UCAUCCCAGUUAUCGGCUC circeif3j sina with 5nt mismatch circpaip2 sina-1 UUUAACCACAAGAUCUUCC circpaip2 sina circpaip2 sina1- control AAAUUGCACAAGAUCUUCC circpaip2 sina with 6nt mismatch
circpaip2 sina-2 UGUCGUUUUUAACCACAAG circpaip2 sina circpaip2 sina2- control UGUCGUUUUUAACGUGUUC circpaip2 sina with 6nt mismatch EIF3J sina AAGCACAGUCAGUGAAUUG EIF3J mna sina PAIP2 sina AAAUAUGCUUAACAGUUGG PAIP2 mna sina scramble ASO UUGCACTGTGCAAGCCUCUU scramble ASO control circeif3j ASO circeif3j ASO control circpaip2 ASO U1 AMO U2 AMO scramble AMO circeif3j AMO circeif3j control AMO AAGACATACTCACGAACAAU ASO targeted to the intron contained in the circeif3j CUACACAATGAGAGTGUAGA circeif3j control ASO targeted to intron4 of EIF3J gene CGUUUTTAACCACAAGAUCU ASO targeted to the junction of circpaip2 GGTATCTCCCCTGCCAGGTAAGT To block U1's binding to 5 splice AT sites in Exon/Intron TGATAAGAACAGATACTACACT To block U2's binding to 3' splice TGA sites in Exon/Intron CCTCTTACCTCAGTTACAATTTA control AMO for U1 AMO and U2 TA AMO CGCCCCAGTGGCTCACCTGGTTT TA AAAGTGGGAATGGAAGGACACT TGG To block U1's binding to 5 splice sites in Exon/Intron of circeif3j circeif3j control AMO targeted to intron of circeif3j circpaip2 AMO GTACAAAAAACTAACTTGTCTG TTG To block U1's binding to 5 splice sites in Exon/Intron of circpaip2 circpaip2 control AMO TTCCGTAAGCAGTTAAGCCTGGT AG circpaip2 control AMO targeted to intron of circpaip2