Technical tips Session 5

Similar documents
PROCEDURE FOR USE NICKEL NTA Magnetic Agarose Beads (5%)

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit

Ni-NTA Agarose. User Manual. 320 Harbor Way South San Francisco, CA Phone: 1 (888) MCLAB-88 Fax: 1 (650)

Kinetics Review. Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets)

Lecture Four. Molecular Approaches I: Nucleic Acids

Purification of (recombinant) proteins. Pekka Lappalainen, Institute of Biotechnology, University of Helsinki

supplementary information

Supplemental Data. LMO4 Controls the Balance between Excitatory. and Inhibitory Spinal V2 Interneurons

Lecture 8: Affinity Chromatography-III

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...

2054, Chap. 14, page 1

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.

Lecture 25 (11/15/17)

INSTRUCTIONS The resins are adapted to work mainly in native conditions like denaturing.

IMMUNOPRECIPITATION TROUBLESHOOTING TIPS

Nickel-NTA Agarose Suspension

AFFINITY HIS-TAG PURIFICATION

SUMOstar Gene Fusion Technology

RNA Isolation and Technology Applications. Nadine Nassif Senior Research Scientist Promega Corporation

Multiple choice questions (numbers in brackets indicate the number of correct answers)

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist

CHAPTER 9 DNA Technologies

Gene Expression Technology

Newsletter Issue 7 One-STrEP Analysis of Protein:Protein-Interactions

AFFINITY HIS-TAG PURIFICATION

AFFINITY HIS-TAG PURIFICATION

Supplemental Information. PARP1 Represses PAP and Inhibits Polyadenylation during Heat Shock

Protein Purification Products. Complete Solutions for All of Your Protein Purification Applications

Genetic Engineering & Recombinant DNA

ExiProgen Protein Synthesis RNA/DNA Prep System Introducing the world's first automated protein synthesis and RNA/DNA purification system!

PureSpin DNA Clean Up Kit

Plasmid Midiprep Plus Purification Kit. Cat. # : DP01MD-P10/ DP01MD-P50 Size : 10/50 Reactions Store at RT For research use only

IMMUNOPRECIPITATION (IP)

Technical Review. Real time PCR

ReliaPrep FFPE gdna Miniprep System

Synthetic Biology for

2.5. Equipment and materials supplied by user PCR based template preparation Influence of temperature on in vitro EGFP synthesis 11

NPTEL VIDEO COURSE PROTEOMICS PROF. SANJEEVA SRIVASTAVA

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)

qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning

Myers Lab ChIP-seq Protocol v Modified January 10, 2014

Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami

ExiProgen Protein Synthesis RNA/DNA Prep System

Stabilization of a virus-like particle and its application as a nanoreactor at physiological conditions

2 Gene Technologies in Our Lives

Why adapter ligation? Ligases. Oligonucleotide ligases. Definition of ligase

Note: for laboratory research use only. RNA High-purity Total RNA Rapid Extraction Kit (Spin-column) Signalway Biotechnology

Site-directed Mutagenesis

Session 3 Cloning Overview & Polymerase Chain Reaction

Amplicon Sequencing Template Preparation

Figure 1: E. Coli lysate transfer using liquid handling automation

MagSi Beads. Magnetic Silica Beads for Life Science and Biotechnology study

Genetics Lecture 21 Recombinant DNA

TaKaRa MiniBEST Viral RNA/DNA Extraction Kit Ver.5.0

GenUP Virus DNA/RNA Kit

Chapter 20: Biotechnology

HiPer RT-PCR Teaching Kit

Applications for Eppendorf Thermomixer comfort* 1, Thermomixer compact* 2 and ThermoStat plus TM. Purification of DNA, RNA and proteins

Polymerase Chain Reaction (PCR)

Roche Molecular Biochemicals Technical Note No. LC 10/2000

MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit

T7-Based RNA Amplification Protocol (in progress)


RNA Purification Kits

TECHNICAL BULLETIN. SeqPlex DNA Amplification Kit for use with high throughput sequencing technologies. Catalog Number SEQX Storage Temperature 20 C

TECHNICAL BULLETIN. GenElute mrna Miniprep Kit. Catalog MRN 10 MRN 70

High Throughput Sequencing Technologies. UCD Genome Center Bioinformatics Core Monday 15 June 2015

3 Designing Primers for Site-Directed Mutagenesis

Enzymatic assembly of DNA molecules up to several hundred kilobases

Human Cell-Free Protein Expression Maxi System

Rotation Report Sample Version 2. Due Date: August 9, Analysis of the Guanine Nucleotide Exchange Activity of the S. cerevisiae Ats1 Protein

Sensitivity vs Specificity

Lecture 18. PCR Technology. Growing PCR Industry

2. The Principles of Dynabeads

Figure 1. Schematic of Ats1p expression plasmid.

Instruction Manual Version DNA Elution Module. Cat. No. C (mc-magme-002)

Average Yields* Yeast DNA Yeast RNA Time to Complete 10 Purifications * Yield will vary depending on the type of sample processed

XactEdit Cas9 Nuclease with NLS User Manual

RNA Clean-Up and Concentration Kit Product # 23600, 43200

MagListo 5M Nucleic Acid Extraction Kit MagListo Magnetic Separation Rack

DNA Technology. B. Using Bacteria to Clone Genes: Overview:

Electrophoresis. Ready-to-Run Buffers and Solutions

E.Z.N.A. Yeast Plasmid Mini Kit. D preps D preps

Manipulating DNA. Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates.

g,a--~.e. -f6v U)~ r Signature Engineering ofmaltose-binding Protein to Employ a Poly Arginine Tag and Improve Protein Purification Bildt1 ~.

Plant/Fungi Total RNA Purification Kit Product # 25800, 31350, 25850

RNA Extraction Basic Practical Knowledge. Kis Enikő OKK-OSSKI PCR training course June 13-17, 2016

Chapter 17. PCR the polymerase chain reaction and its many uses. Prepared by Woojoo Choi

GeneMATRIX Gram Plus & Yeast Genomic DNA Purification Kit

Green Fluorescent Protein (GFP) Purification. Hydrophobic Interaction Chromatography

Introduction to Protein Purification

The Two-Hybrid System

ProtoScript. First Strand cdna Synthesis Kit DNA AMPLIFICATION & PCR. Instruction Manual. NEB #E6300S/L 30/150 reactions Version 2.

AP Biology Gene Expression/Biotechnology REVIEW

Purification of DNA from living cells

3.1.4 DNA Microarray Technology

Guide-it Indel Identification Kit User Manual

Transcription:

Technical tips Session 5 Chromatine Immunoprecipitation (ChIP): This is a powerful in vivo method to quantitate interaction of proteins associated with specific regions of the genome. It involves the immunoprecipitation of protein/dna complexes that have been stabilized via cross-linking. Intact cells are fixed using formaldehyde, which cross-links and therefore preserves protein/dna interactions. DNA is then sonicated into small uniform fragments and the DNA/protein complexes are immunoprecipitated using an antibody directed against the DNA-binding protein of interest. Following immunoprecipitation, cross-linking is reversed, proteins are removed by Proteinase K treatment and the DNA is rapidly cleaned up using DNA purification columns. The DNA is then screened to determine which genes/sequences were bound by the protein of interest. The screening can be done using generalized hybridization (Southern blot; it s a very similar technique to that for northern blot -see tech tips for session 3- but it detects DNA instead of RNA) or a more targeted PCR-based approach (you can use specific oligos to amplify a sequence of interest; if that sequence is present in the ChIP sample you will have a PCR product). GST/glutathion and His-tag/Niquel-NTA pull-down assays: This method is used when you want to check whether two proteins interact. One of the proteins ( bait protein) is tagged with GST ("Glutathione S Transferase"), so it has a high affinity for glutathione. In order to tag it with GST you clone its cdna into a plasmid that will generate a fusion of the protein to GST.

The expression is usually carried out in E. coli. To isolate the bait protein from a cell lysate after expressing it, you incubate the lysate with glutathione cross-linked to agarose ("GST-beads"). This will bind up your protein. You can elute it with excess glutathione and use the purified bait protein in an in vitro binding assay (what is called GST-pull down) to detect protein-protein interactions. This time the bait protein will be put in the presence of another cell lysate (this one now coming from cells of the original organism to which both proteins -the bait and the prey proteinactually belong). Only proteins interacting with the GST-labeled protein ( prey proteins) will be precipitated when you add again GST-beads and pellet them to separate them from the extract. All samples are then analyzed by SDS-PAGE followed by Western blot (you check the presence of the prey protein in the pull-down with specific antibodies for it and/or because it has a different tag, such as HA, -myc, etc). A sample of the total lysate containing the prey protein is sometimes utilized as a positive control (demonstrating that this prey protein is actually present in the extract). Others add the purified bait protein as positive control. This is usually called input or total. A negative control results from the exposure of the lysate to GST-beads alone (without bait protein) and the experiment really works if you don t see the prey protein pulled down by the beads alone. Finally, you should see the prey protein pulled-down from the lysate by the GST-beads in the presence of the GST-labeled protein or bait (that is indicative that both proteins interact and that s why one can pull down the other). A variant of this method uses nickel beads (Ni 2+ -NTA) when the bait protein is tagged with 6X Histidine instead of GST. The rest is essentially the same as above. Ni 2+ -NTA beads are agarose beads that contain strongly magnetic particles and have metal-chelating nitriloacetic acid (NTA). The beads are precharged with nickel. This way they bind with high specificity, to 6Xhistagged proteins. The beads can be separated by using a magnet apparatus. The application of a magnetic field will cause the beads to be held on the sides of the wells/tubes while buffers are exchanged to wash or elute the 6xHis-tagged proteins.

General pull-down technique Different types of magnet apparatus α-amanitin: alpha-amanitin is the major toxin of the extremely poisonous toadstools, Amanita phalloides (death cap), A. verna (destroying angel), A. virosa, A. ocreata, A. tenuifolia and other Amanita species (beware of some mushrooms!). Its primary action is to inhibit RNA polymerase II (in turn interfering with mrna synthesis). This results in the arrest of protein synthesis and cellular necrosis ultimately leading to severe acute hepatitis (among other symptoms).

Cisplatin: Cisplatin is believed to kill cancer cells by binding to DNA and interfering with its repair mechanism, eventually leading to cell death. The first step in the process (after the cisplatin molecule penetrates the cell membrane intact) is for a molecule of water to replace one of the chloride ions. The resulting structure can then bind to a single nitrogen on a DNA nucleotide. Then, the second chloride is replaced by another H 2 O and the platinum binds to a second nucleotide. Binding studies of cisplatin with DNA have indicated a preference for nitrogen 7 on two adjacent guanines on the same strand. It also binds to adenine and across strands to a lesser extent. The cisplatin-dna complex attracts the attention of HMG (high mobility group)-1 and other DNA repair proteins which become irreversibly bound. The resulting distortion to the shape of the DNA prevents effective repair. (The trans isomer of cisplatin is unable to form 1,2 intrastrand links and lacks antineoplastic activity.) Other antineoplastic agents, such as etoposide, contribute to the platinum- DNA-protein complex and thus synergistically reinforce the activity of cisplatin.

UREA-PAGE for nucleic acids separation: This is a method to separate molecules of single-stranded nucleic acids such as DNA (ssdna) according to their size. Urea at high concentration is used to denature doublestranded DNA (dsdna). The nucleic acids are separated in a polyacrylamide gel but in this case no SDS is added to the samples because the phosphodiester backbone has a negative charge which is proportional exactly to the length of the molecule. Polycrylamide is much better than agarose to both visualize and separate very small fragments of DNA (<100 nucleotides). Sequencing gels are always polyacrylamide gels.