CHAPTER 11 DNA NOTES PT. 4: PROTEIN SYNTHESIS TRANSCRIPTION & TRANSLATION DNA and the Language of Life RECAP Synthesis= Making something Protein Synthesis= Making Proteins Three steps in Protein Synthesis 1. DNA Replication 2. RNA Transcription 3. Amino Acid (protein) translation 1
SO WHY IS THIS IMPORTANT?! The newly replicated (copied) strand of DNA goes to a new cell (during cell division) That cell needs to know WHAT its job is How does it do that!? DNA codes for information called genes Genes encode for a unique protein The protein performs a special function in the cell (Remember: Gene Expression!!) The shape of the protein determines the function of the protein. REMEMBER Proteins are important for Gene Expression Gene Expression: The process by which inheritable information from a gene, such as the DNA sequence is made into a functional gene product Like Proteins and RNA. 2
STEP ONE: DNA REPLICATION Replication = Copying DNA Replication: The existing strand of DNA COPIES itself to make an exact replica. This new strand will then go to new cells (during cell division) PROTEIN SYNTHESIS This process starts in the Nucleus Cells use the two-step process of transcription and translation to read each gene and produce the string of amino acids that make up a protein To make proteins: Transcribe DNA into mrna and then trna translates the mrna into a chain of amino acids Amino acid chain folds into a specific protein 3
STEP TWO: RNA TRANSCRIPTION Making RNA from DNA is called Transcription What is RNA? RiboNucleic Acid (Nucleic Acid) RNA contains the sugar Ribose. NOT deoxyribose RNA is a SINGLE STRAND (ribbon) that has 4 bases THE RNA BASES In RNA, the nitrogen bases are attached to a phosphate group & a sugar (ribose) The bases are: 1. Adenine 2. Uracil 3. Guanine 4. Cytosine How do the bases match up now? Adenine & Uracil Uracil & Adenine Guanine & Cytosine Cytosine & Guanine Uracil replaces thymine in RNA! 4
STEP TWO: RNA TRANSCRIPTION Strand of DNA: ACTACAGCATCGAGTACGCATC TGATGTCGTAGCTCATGCGTAG New free floating nitrogen bases match themselves to the bottom DNA strand to make a complimentary mrna molecule ACTACAGCATCGAGTACGCATC TGATGTCGTAGCTCATGCGTAG ACUACAGCAUCGAGUACGCAUC DNA Molecule mrna Molecule In the end you will have a single strand of mrna KEEP IN MIND IF there is a T in the DNA strand, it will pair with an A in the RNA Strand. IF there is an A in the DNA strand, it will pair with a U in the RNA Strand ACTACAGCATCGAGTACGCATC TGATGTCGTAGCTCATGCGTAG ACUACAGCAUCGAGUACGCAUC DNA Molecule mrna Molecule 5
TRANSCRIPTION TO TRANSLATION After transcription, then mrna is transported out of the cell s nucleus through nuclear pores to go to the site of translation The Rough Endoplasmic Reticulum Once transported to the rough endoplasmic reticulum it is fed into a ribosome STEP THREE: PROTEIN (AMINO ACID) TRANSLATION When the mrna is fed into the ribosome, amino acids can be made. How does this happen? 1. mrna strand is split into codons (3 RNA Bases) Example: ACU 2. Once the mrna is split into codons, your body matches them up to a code to form the amino acid There is a chart that has all 20 of the amino acid codes on it along with a start and stop. 6
THE CHART TO USE THE CHART Example: mrna Codon: ACU 1. Look on the left side of the chart to find the first base (A) 2. Look at the top of the chart to find the second base (C) 3. Look on the right side of the chart to find the third base (U) 7
THE CHART ABBREVIATING THE AMINO ACIDS Instead of writing out the entire name of each amino acid, you can abbreviate. The rule is: Use the first 3 letters of the amino acid as the abbreviation. Except when the amino acid ends in the word acid use the first two letters then a capital A 8
ONCE YOU HAVE THE AMINO ACID A trna (transfer RNA) molecule will fit into ONE mrna codon. This is called its ANTICODON. Anticodons and codons fit together like a puzzle piece. The amino acids attached to the trna are then joined together through peptide bonds. END OF TRANSLATION Once the protein chain has been made, the body codes stop Protein strand is cut and it goes off to do a job! (be hair or skin) So the ORDER of the of amino acids determine the protein & how we are put together 9
WHAT HAPPENS IF The amino acid order changes? The protein changes! And If the protein changes YOU CHANGE! 10