Protein Synthesis
|
|
- Rodney McGee
- 6 years ago
- Views:
Transcription
1 HEBISD Student Expectations: Identify that RNA Is a nucleic acid with a single strand of nucleotides Contains the 5-carbon sugar ribose Contains the nitrogen bases A, G, C and U instead of T. The U is uracil and it is complementary to adenine whenever RNA base-pairs with another nucleic acid Explain that the purpose of transcription is to transfer the instructions for making a protein from a gene to an RNA molecule Using models of DNA and RNA, explain the process of transcription RNA polymerase, an enzyme that adds and links complementary RNA nucleotides, binds to a gene s promotera specific sequence of DNA that acts as a start signal RNA polymerase unwinds and separates the two strands of the double helix of DNA, exposing the nucleotides on each strand RNA polymerase adds and links complementary RNA nucleotides as it reads the gene. RNA polymerase moves along the nucleotides of the DNA following the base-pair rules for DNA replication, except that uracil, rather than thymine, pairs with adenine. Transcription proceeds until RNA polymerase reaches a stop signal in the DNA When the RNA nucleotides are added, they are linked together with covalent bonds As RNA polymerase moves down the strand, a single strand of RNA grows and the two strands of DNA close up forming hydrogen bonds between complementary bases, reforming the double helix Explain that the purpose of translation is to read the instructions on the RNA molecule and put together the amino acids that make up the protein Identify codons as a series of three-nucleotide sequences on mrna that corresponds to an amino acid Identify transfer RNA (trna) as single strands of RNA that carry a specific amino acid on one end and an anticodon, a three-nucleotide sequence that is complementary to an mrna codon Identify ribosomal RNA (rrna) as RNA molecules that are part of the structure of ribosomes Using models of DNA and RNA, explain the process of translation translation begins when mrna leaves the nucleus, enters the cytoplasm, and attaches to a ribosome At the beginning of each protein is the universal start codon, AUG, which tells the ribosome to start translating trna carries a specific amino acid to the ribosome and its anticodon matches up to the codon on mrna As the trna line up, the amino acids they carry, bond together to form a protein polymer and the trna is released There are three stop codons (UAA, UAG, and UGA) which when reached, tell the ribosome to stop translating the protein Terminology Ribonucleic acid (RNA) RNA polymerase Anticodon repressor Read a codon chart and determine which amino acids corresponds with the three letter code Recognize that these nitrogen bases and all of their combinations are the genetic code (codons) and are common to all organisms. Recognize that only a fraction of the genes in a cell are expressed at any given time. An expressed gene is a gene that is transcribed into RNA Understand that gene expression is a regulated process in which genes can be turned on (expressed) or off (not expressed). Identify and illustrate DNA mutations Uracil Messenger RNA ribosomal DNA Point mutation Transcription Codon Operator Gene rearrangement Translation Genetic code Operon Frame-shift mutation Gene expression Transfer RNA Lac operon Intron Gene alterations Insertion mutation Deletion mutation Exon Polypeptides 1 Protein Synthesis - Simmons CRE 11/14
2 HEBISD Gene rearrangement-an entire gene is moved to a new location Transposition Chromosomal rearrangement-occurs during meiosis Gene alterations Point mutation - a single nucleotide changes Insertion mutation-a sizeable length of DNA is inserted into a gene Deletion mutation-segments of a gene are lost; often during meiosis Frame-shift mutation- a mutation that causes a gene to be read in the wrong three-nucleotide sequence Evaluate the significance of these mutations Mutations affect the translation of the codons because the order of the nucleotides has been change. This causes the gene to not function normally and could lead to genetic disorders Depending on how a mutation is translated, it can result in no change in the resulting protein, an insignificant change or one that may be crucial for life. Because several different codons result in the same amino acid, some mutations do not result in a different protein being produced. As a result some mutations are silent, as they are not expressed. In some instances, the mutation may result in proteins that enhance an organism s ability to survive and reproduce. More often, a mutation is detrimental to the organism. Mutations which involve a deletion or insertion often have disastrous effects. By changing one letter in the sequence, the series of codons will be changed resulting in the translation of very different proteins. Mutations result in the diversity of genes in the world, which makes natural selection and evolution possible. Unit Summaries: pgs RNA and Protein Synthesis In order for a gene to work, the genetic instructions in the DNA molecule must be decoded. The first step is to copy the DNA sequence into RNA. RNA makes it possible for a single gene in a DNA molecule to make hundreds of copies. RNA has a structure like DNA, except for three differences. The sugar in RNA is ribose instead of Deoxyribose. RNA is single-stranded. RNA has uracil in place of thymine. There are three kinds of RNA molecules work together to make proteins: 1. Messenger RNA has the instructions to put together amino acids to make a protein. Proteins are put together on ribosomes. 2. Ribosomes are made up of proteins and ribosomal RNA. 3. Transfer RNA carries each amino acid to the ribosome according to the coded message in messenger RNA. RNA is copied from DNA in a process called transcription. The enzyme RNA polymerase binds to DNA and separates the two strands. Then RNA polymerase builds a strand of RNA using one strand of DNA as the template. The sequence of DNA that signals RNA polymerase where to bind and start making RNA is called the promoter. The instructions for making proteins are found in the order of the four nitrogenous bases. This code is read three letters, or nucleotides, at a time. Each codon, or group of three nucleotides, specifies a certain amino acid that makes up a protein. In the genetic code, some amino acids are specified by more than one codon. One codon is a start signal for translation. Three codons signal the end of a protein. Translation is the process in which the genetic code in RNA is used to make proteins. Translation takes place on ribosomes. Before translation can begin, messenger RNA is transcribed from DNA. Then the messenger RNA moves into the cytoplasm and attaches to a ribosome. As each codon of the messenger RNA moves through the ribosome, the proper amino acid is brought into the ribosome by transfer RNA. The ribosome joins together each amino 2 Protein Synthesis - Simmons CRE 11/14
3 HEBISD acid. In this way, the protein chain grows. When the ribosome reaches a stop codon, it falls away from the protein chain and the messenger RNA molecule. Transcription has ended Mutations Mutations are changes in the sequence of DNA. Gene mutations are changes in a single gene. Chromosomal mutations cause changes in whole chromosomes. Gene mutations that occur at a single point in the DNA sequence are called point mutations. When a point mutation causes one base to replace another, only one amino acid is affected. If a nucleotide is added or taken away, it causes a frame-shift mutation. All the groupings of three nucleotides, or codons, are changed. This can cause the gene to produce a completely different protein. In a chromosomal mutation, there is a change in the number or the structure of chromosomes. There are four kinds of chromosomal mutations: deletions, duplications, inversions, and translocations Gene Regulation Genes can be turned on and off when proteins are needed. In prokaryotes, some genes are turned on and off by a section of a chromosome called an operon. An operon is a group of genes that work together. Two sequences of DNA in the operon that control when genes are turned on and off are the operator and the promoter. When the cell needs a certain protein, RNA polymerase attaches to the promoter and produces a messenger RNA that is translated into the needed protein. When the cell no longer needs the protein, it makes another special protein called the repressor. The repressor attaches to the operator, blocking the promoter so that RNA polymerase cannot attach to it. This turns the genes of the operon off. In eukaryotes, there are several ways of turning genes on and off. One system uses a protein that binds directly to DNA. This either starts or increases the transcription of certain genes. DNA Review DNA contains genes: sequences of nucleotide bases (Adenine, Guanine, Cytosine, & Thymine) that codes for specific traits These Genes code for polypeptides (chains of amino acids known as proteins) Proteins are used to build cells and do much of the work inside cells Genes and Proteins: Proteins are made of amino acids linked together by peptide bonds 20 different amino acids exist Amino Acids: Amino acid chains are called polypeptides How does Protein Synthesis Start? DNA 3 Protein Synthesis - Simmons CRE 11/14
4 HEBISD DNA is found inside the nucleus Proteins, however, are made in the cytosol of cells by organelles called ribosomes Ribosomes may be free in the cytosol or attached to the surface of rough ER DNA s code must be copied and taken to the cytosol In the cytosol, this code must be read so amino acids can be assembled to make polypeptides (proteins) This process is called Protein Synthesis RNA Ribonucleic Acid Roles of DNA & RNA DNA is the master plan, while DNA has a sugar - Deoxyribose DNA has thymine (T) DNA is double-stranded Three Types of RNA: RNA is the blueprint for the Master Plan RNA has a sugar - Ribose RNA contains the base uracil (U) RNA molecule is single-stranded Messenger RNA (mrna): copies DNA s code & carries the genetic information to the ribosomes Ribosomal RNA (rrna): along with protein, makes up the ribosomes 4 Protein Synthesis - Simmons CRE 11/14
5 HEBISD Transfer RNA (trna): transfers amino acids to the ribosomes where proteins are synthesized Messenger RNA (mrna) in Detail: Long Straight chain of Nucleotides Made in the Nucleus Copies DNA & leaves through nuclear pores Contains the Nitrogen Bases A, G, C, U ( no T ) Carries the information for a specific protein Made up of 500 to 1000 nucleotides long Sequence of 3 bases called codon AUG methionine or start codon UAA, UAG, or UGA stop codons The Genetic Code: A codon designates an amino acid An amino acid may have more than one codon There are 20 amino acids, but 64 possible codons Some codons tell the ribosome to stop translating Use the code by reading from the inside toward the outside ring Example: AUG codes for Methionine Several Amino Acids have multiple codons Ribosomal RNA (rrna) in Detail: rrna is a single strand 100 to 3000 nucleotides long Globular in shape Made inside the nucleus of a cell Associates with proteins to form ribosomes Site of Protein Synthesis 5 Protein Synthesis - Simmons CRE 11/14
6 HEBISD Transfer RNA (trna) in Detail: Clover-leaf shape Single stranded molecule with attachment site at one end for an amino acid Opposite end has three nucleotide bases called the anticodon The Pathway to Protein Synthesis Transcription The process of copying the sequence of one strand of DNA, the template strand mrna copies the template strand Requires the enzyme RNA Polymerase During transcription, RNA polymerase binds to DNA and separates the DNA strands RNA Polymerase then uses one strand of DNA as a template to assemble nucleotides into RNA Promoters are regions on DNA that show where RNA Polymerase must bind to begin the Transcription of RNA Called the TATA box The termination signal are specific base sequences act as signals to stop Only one of the two DNA strands is transcribed. This strand is called the template strand, because it provides the template for ordering the sequence of nucleotides in an RNA transcript. The other strand is called the coding strand. The DNA template strand is read 3' 5' direction by RNA polymerase and the new RNA strand is synthesized in the 5' 3' direction. 6 Protein Synthesis - Simmons CRE 11/14
7 HEBISD New mrna Processing: After the DNA is transcribed into RNA, editing must be done to the nucleotide chain to make the RNA functional Introns, non-functional segments of DNA are snipped out of the chain Exons, segments of DNA that code for proteins, are then rejoined by the enzyme ligase A guanine triphosphate cap is added to the 5 end of the newly copied mrna A poly A tail is added to the 3 end of the RNA The newly processed mrna can then leave the nucleus mrna leaves the nucleus through its pores and goes to the ribosomes Translation Translation is the process of decoding the mrna into a polypeptide chain Ribosomes read mrna three bases or 1 codon at a time and construct the proteins Made of a large and small subunit Composed of rrna (40%) and proteins (60%) Have two sites for trna attachment: P site and A site Stage 1: Initiation mrna transcript start codon AUG attaches to the small ribosomal subunit Small subunit attaches to large ribosomal subunit 7 Protein Synthesis - Simmons CRE 11/14
8 HEBISD The Process: 8 Protein Synthesis - Simmons CRE 11/14
9 HEBISD The End Product The Protein: The end products of protein synthesis is a primary structure of a protein A sequence of amino acid bonded together by peptide bonds Summary of mrna to a Protein Central Dogma of Genetics: Within each cell the genetic information flows from DNA RNA Protein. This flow of information is unidirectional and irreversible. The information carried within the DNA dictates the end product (protein) that will be synthesized. This information is the genetic code. Conversion of DNA encoded information to RNA is called transcription. The information from a mrna is then translated to an amino acid sequence in the corresponding protein 9 Protein Synthesis - Simmons CRE 11/14
10 HEBISD Mutation: A gene mutation is a permanent change in the DNA sequence that makes up a gene. Mutations range in size from a single DNA building block (DNA base) to a large segment of a chromosome. Gene mutations occur in two ways: they can be inherited from a parent or acquired during a person s lifetime. Mutations that are passed from parent to child are called hereditary mutations or germ-line mutations (because they are present in the egg and sperm cells, which are also called germ cells). This type of mutation is present throughout a person s life in virtually every cell in the body. Mutations that occur only in an egg or sperm cell, or those that occur just after fertilization, are called new (de novo) mutations. De novo mutations may explain genetic disorders in which an affected child has a mutation in every cell, but has no family history of the disorder. Acquired (or somatic) mutations occur in the DNA of individual cells at some time during a person s life. These changes can be caused by environmental factors such as ultraviolet radiation from the sun, or can occur if a mistake is made as DNA copies itself during cell division. Acquired mutations in somatic cells (cells other than sperm and egg cells) cannot be passed on to the next generation. Mutations may also occur in a single cell within an early embryo. As all the cells divide during growth and development, the individual will have some cells with the mutation and some cells without the genetic change. This situation is called mosaicism. Some genetic changes are very rare; others are common in the population. Genetic changes that occur in more than 1 percent of the population are called polymorphisms. They are common enough to be considered a normal variation in the DNA. Polymorphisms are responsible for many of the normal differences between people such as eye color, hair color, and blood type. Although many polymorphisms have no negative effects on a person s health, some of these variations may influence the risk of developing certain disorders. Types of Mutations: Substitution (Missense) mutation This type of mutation is a change in one DNA base pair that results in the substitution of one amino acid for another in the protein made by a gene. Termination (Nonsense) mutation A nonsense mutation is also a change in one DNA base pair. Instead of substituting one amino acid for another, however, the altered DNA sequence prematurely signals the cell to stop building a protein. This type of mutation results in a shortened protein that may function improperly or not at all. 10 Protein Synthesis - Simmons CRE 11/14
11 HEBISD Insertion An insertion changes the number of DNA bases in a gene by adding a piece of DNA. As a result, the protein made by the gene may not function properly. Deletion A deletion changes the number of DNA bases by removing a piece of DNA. Small deletions may remove one or a few base pairs within a gene, while larger deletions can remove an entire gene or several neighboring genes. The deleted DNA may alter the function of the resulting protein(s). Duplication A duplication consists of a piece of DNA that is abnormally copied one or more times. This type of mutation may alter the function of the resulting protein. Frame-shift mutation This type of mutation occurs when the addition or loss of DNA bases changes a gene s reading frame. A reading frame consists of groups of 3 bases that each code for one amino acid. A frame-shift mutation shifts the grouping of these bases and changes the code for amino acids. The resulting protein is usually nonfunctional. Insertions, deletions, and duplications can all be frame-shift mutations. 11 Protein Synthesis - Simmons CRE 11/14
12 HEBISD Concept Review: 6. The DNA molecule is in the shape of a(n) The mrna Molecule is in the shape of a(n) a. Single strand b. Alpha helix c. Beta pleated sheet d. Double helix 1. In the above item A refers to the 2. In the above item B refers to the 3. In the above item C refers to the 4. The sugar molecule represented consists of Carbons. 5. The above nucleotide is a purine or pyrimidine? 8. The Backbone of the DNA molecule is made of which components of the nucleotide from the above diagram? a. A & B b. B & C c. A & C d. B only 9. The component which binds complimentarily according to base pairing rules is item. a. A b. B c. C d. None of the above 10. According to base pairing rules with DNA "A" bonds only to a. A b. C c. T d. U e. G 11. The "Central Dogma" of genetics states the usual order of events in protein synthesis proceeds along which of the following sequence? Matching: Directions: Match the enzyme with the correct function of that enzyme 12. DNA Helicase: 13. RNA polymerase: 14. Primase: 15. DNA polymerase: 12 Protein Synthesis - Simmons CRE 11/14
13 HEBISD 16. Ligase: A. Binds RNA primer to lagging strand of DNA B. "Unzips" DNA strand C. Adds deoxyribo-nucleotides along a DNA strand D. Adds ribo-nucleotides along an RNA strand E. Links DNA fragments on lagging strand 17. The above diagram refers to a molecule of 18. Item labeled A refers to 19. Item labeled B refers to 20. Given the above DNA strand. If replication was proceeding from bottom to top, which strand would be the "lagging" Strand? Why? 21. Large ribosomal subunit 22. Ribosome 23. mrna strand 24. Polypeptide 25. Small subunit 13 Protein Synthesis - Simmons CRE 11/14
14 HEBISD 26. The ribosomes are made in which cellular structure in the eukaryotic cell. 27. The DNA strand from which mrna is transcribed is known as the RNA molecules differ from DNA in the following ways except 29. The three base pair sequence found on an mrna strand is called the DNA replication occurs in which direction? 31. A mutation which results in the changing of all the codons following the error is called a mutation. Using the Following Diagram, complete the questions below: DNA Sequence: TACCCCATTTAACATACCACT 32. Complimentary DNA strand? 33. mrna Strand? 34. Polypeptide Sequence? 14 Protein Synthesis - Simmons CRE 11/14
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
More informationRNA, & PROTEIN SYNTHESIS. 7 th Grade, Week 4, Day 1 Monday, July 15, 2013
RNA, & PROTEIN SYNTHESIS 7 th Grade, Week 4, Day 1 Monday, July 15, 2013 The Central Dogma RNA vs. DNA Ribonucleic Acid RNA is required for translation of genetic information stored in DNA into protein
More informationBundle 5 Test Review
Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic
More informationHello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6.
Cell Biology: RNA and Protein synthesis In all living cells, DNA molecules are the storehouses of information Hello! Outline u 1. Key concepts u 2. Central Dogma u 3. RNA Types u 4. RNA (Ribonucleic Acid)
More informationFrom DNA to Protein: Genotype to Phenotype
12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each
More informationDNA is the MASTER PLAN. RNA is the BLUEPRINT of the Master Plan
Sec. 12-3 RNA and Protein Synthesis Roles of DNA and RNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 1 RNA uses the information from DNA to make proteins Differs from DNA: 1. Ribose
More informationPROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
More informationFrom Gene to Protein
8.2 Structure of DNA From Gene to Protein deoxyribonucleic acid - (DNA) - the ultimate source of all information in a cell This information is used by the cell to produce the protein molecules which are
More informationFrom DNA to Protein: Genotype to Phenotype
12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each
More informationDNA Structure DNA Nucleotide 3 Parts: 1. Phosphate Group 2. Sugar 3. Nitrogen Base
DNA,, RNA,, AND PROTEIN SYNTHESIS DNA Deoxyribonucleic Acid Enables cells to have different forms and perform different functions Primary functions of DNA: Store and transmit genetic information that tells
More informationDNA, RNA, and PROTEIN SYNTHESIS
DNA, RNA, and PROTEIN SYNTHESIS 1 DNA DNA contains genes, sequences of nucleotide bases The genes code for polypeptides (proteins) Proteins are used to build cells and do much of the work inside cells
More informationNucleic acids and protein synthesis
THE FUNCTIONS OF DNA Nucleic acids and protein synthesis The full name of DNA is deoxyribonucleic acid. Every nucleotide has the same sugar molecule and phosphate group, but each nucleotide contains one
More informationTo truly understand genetics, biologists first had to discover the chemical nature of genes
To truly understand genetics, biologists first had to discover the chemical nature of genes Identifying the structure that carries genetic information makes it possible to understand how genes control
More informationProtein Synthesis ~Biology AP~
Protein Synthesis ~Biology AP~ A Meridian Study Guide by David Guan, Jennifer Zheng [Edited by Lei Gong] Introduction: - DNA and RNA are essential for life because they code for enzymes, which regulate
More informationBiology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 Essential Question What is transcription and translation and how do they take place? 3 of 39 12 3 RNA and Protein Synthesis Genes are coded
More informationBiology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 12 3 RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by
More informationLesson 8. DNA: The Molecule of Heredity. Gene Expression and Regulation. Introduction to Life Processes - SCI 102 1
Lesson 8 DNA: The Molecule of Heredity Gene Expression and Regulation Introduction to Life Processes - SCI 102 1 Genes and DNA Hereditary information is found in discrete units called genes Genes are segments
More informationChapter 12: Molecular Biology of the Gene
Biology Textbook Notes Chapter 12: Molecular Biology of the Gene p. 214-219 The Genetic Material (12.1) - Genetic Material must: 1. Be able to store information that pertains to the development, structure,
More informationPROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
More informationAdv Biology: DNA and RNA Study Guide
Adv Biology: DNA and RNA Study Guide Chapter 12 Vocabulary -Notes What experiments led up to the discovery of DNA being the hereditary material? o The discovery that DNA is the genetic code involved many
More informationNucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide
Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These
More informationDNA - DEOXYRIBONUCLEIC ACID
DNA - DEOXYRIBONUCLEIC ACID blueprint of life (has the instructions for making an organism) established by James Watson and Francis Crick codes for your genes shape of a double helix made of repeating
More informationHow can something so small cause problems so large?
How can something so small cause problems so large? Objectives Identify the structural components of DNA and relate to its function Create and ask questions about a model of DNA DNA is made of genes. Gene
More informationChapter 13. From DNA to Protein
Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to
More information6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA
6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA DNA mrna Protein DNA is found in the nucleus, but making a protein occurs at the ribosome
More informationBIOL 1030 Introduction to Biology: Organismal Biology. Fall 2009 Sections B & D. Steve Thompson:
BIOL 1030 Introduction to Biology: Organismal Biology. Fall 2009 Sections B & D Steve Thompson: stthompson@valdosta.edu http://www.bioinfo4u.net 1 DNA transcription and regulation We ve seen how the principles
More informationDNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test
DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery
More informationDNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?
2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine
More informationNUCLEIC ACID METABOLISM. Omidiwura, B.R.O
NUCLEIC ACID METABOLISM Omidiwura, B.R.O Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid
More informationFermentation. Lesson Overview. Lesson Overview 13.1 RNA
13.1 RNA THINK ABOUT IT DNA is the genetic material of cells. The sequence of nucleotide bases in the strands of DNA carries some sort of code. In order for that code to work, the cell must be able to
More informationNUCLEIC ACIDS AND PROTEIN SYNTHESIS
NUCLEIC ACIDS AND PROTEIN SYNTHESIS DNA Cell Nucleus Chromosomes is a coiled double helix carrying hereditary information of the cell Contains the instructions for making from 20 different amino acids
More informationII. DNA Deoxyribonucleic Acid Located in the nucleus of the cell Codes for your genes Frank Griffith- discovered DNA in 1928
HEREDITY = passing on of characteristics from parents to offspring I. DNA, Chromosomes, Chromatin, and Genes DNA = blueprint of life (has the instructions for making an organism) Chromatin= uncoiled DNA
More informationWhat happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!
What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as
More informationMolecular Genetics. The flow of genetic information from DNA. DNA Replication. Two kinds of nucleic acids in cells: DNA and RNA.
Molecular Genetics DNA Replication Two kinds of nucleic acids in cells: DNA and RNA. DNA function 1: DNA transmits genetic information from parents to offspring. DNA function 2: DNA controls the functions
More informationUnit 5 DNA, RNA, and Protein Synthesis
1 Biology Unit 5 DNA, RNA, and Protein Synthesis 5:1 History of DNA Discovery Fredrick Griffith-conducted one of the first experiment s in 1928 to suggest that bacteria are capable of transferring genetic
More informationDNA & RNA. Chapter Twelve and Thirteen Biology One
DNA & RNA Chapter Twelve and Thirteen Biology One I. DNA Structure A. DNA monomers = nucleotides *1. sugar bonded to PO4 & one of four possible nitrogen bases 2. bases = Adenine, Guanine, Cytosine, Thymine
More informationA. Incorrect! This feature does help with it suitability as genetic material.
College Biology - Problem Drill 08: Gene Structures and Functions No. 1 of 10 1. Which of the statements below is NOT true in explaining why DNA is a suitable genetic material? #01 (A) Its double helix
More informationHow to Use This Presentation
How to Use This Presentation To View the presentation as a slideshow with effects select View on the menu bar and click on Slide Show. To advance through the presentation, click the right-arrow key or
More informationGene Expression Transcription/Translation Protein Synthesis
Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino
More informationProtein Synthesis Honors Biology
Protein Synthesis What do we know? Metabolism is controlled by enzymes enzymes are proteins DNA contains the genetic information to build proteins. DNA is only in the nucleus. Ribosomes are not. How then
More informationI. Gene Expression Figure 1: Central Dogma of Molecular Biology
I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases
More informationReplication Transcription Translation
Replication Transcription Translation A Gene is a Segment of DNA When a gene is expressed, DNA is transcribed to produce RNA and RNA is then translated to produce proteins. Genotype and Phenotype Genotype
More informationBIOLOGY 111. CHAPTER 6: DNA: The Molecule of Life
BIOLOGY 111 CHAPTER 6: DNA: The Molecule of Life Chromosomes and Inheritance Learning Outcomes 6.1 Describe the structure of the DNA molecule and how this structure allows for the storage of information,
More informationChapter 12-3 RNA & Protein Synthesis Notes From DNA to Protein (DNA RNA Protein)
Chapter 12-3 RNA & Protein Synthesis Notes From DNA to Protein (DNA RNA Protein) I. Review A. Cells copy their DNA (in S phase of Interphase)-Why? Prepare for Cell Division (Mitosis & Cytokinesis) Genes
More informationComparing RNA and DNA
RNA The Role of RNA Genes contain coded DNA instructions that tell cells how to build proteins. 1 st step in decoding these genetic instructions = copy part of the base sequence from DNA into RNA. 2 nd
More informationRNA & PROTEIN SYNTHESIS
RNA & PROTEIN SYNTHESIS DNA & RNA Genes are coded DNA instructions that control the production of proteins within the cell. The first step in decoding these genetic messages is to copy part of the nucleotide
More informationCHapter 14. From DNA to Protein
CHapter 14 From DNA to Protein How? DNA to RNA to Protein to Trait Types of RNA 1. Messenger RNA: carries protein code or transcript 2. Ribosomal RNA: part of ribosomes 3. Transfer RNA: delivers amino
More informationDNA REPLICATION. DNA structure. Semiconservative replication. DNA structure. Origin of replication. Replication bubbles and forks.
DNA REPLICATION 5 4 Phosphate 3 DNA structure Nitrogenous base 1 Deoxyribose 2 Nucleotide DNA strand = DNA polynucleotide 2004 Biology Olympiad Preparation Program 2 2004 Biology Olympiad Preparation Program
More informationVideos. Lesson Overview. Fermentation
Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast
More informationProtein Synthesis. DNA to RNA to Protein
Protein Synthesis DNA to RNA to Protein From Genes to Proteins Processing the information contained in DNA into proteins involves a sequence of events known as gene expression and results in protein synthesis.
More informationSemester 2: Unit 1: Molecular Genetics
Semester 2: Unit 1: Molecular Genetics Information Overload : Cells store information in DNA. Information is used to build molecules needed for cell growth. As cell size increases, the demands on that
More informationLesson Overview. Fermentation 13.1 RNA
13.1 RNA The Role of RNA Genes contain coded DNA instructions that tell cells how to build proteins. The first step in decoding these genetic instructions is to copy part of the base sequence from DNA
More informationDo you think DNA is important? T.V shows Movies Biotech Films News Cloning Genetic Engineering
DNA Introduction Do you think DNA is important? T.V shows Movies Biotech Films News Cloning Genetic Engineering At the most basic level DNA is a set of instructions for protein construction. Structural
More informationChapter 8: DNA and RNA
Chapter 8: DNA and RNA Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 1 8-1 DNA and the Importance of Proteins Proteins play
More informationReview? - What are the four macromolecules?
Review? - What are the four macromolecules? Lipids Carbohydrates Protein Nucleic Acids What is the monomer of nucleic acids and what do nucleic acids make up? Nucleotides; DNA and RNA 12-1 DNA DNA Stands
More informationRapid Learning Center Presents. Teach Yourself High School Biology in 24 Hours. and Functions
Rapid Learning Center Chemistry :: Biology :: Physics :: Math Rapid Learning Center Presents Teach Yourself High School Biology in 24 Hours Gene e Structures and Functions High School Biology Rapid Learning
More informationThe Structure of RNA. The Central Dogma
12-3 12-3 RNA and Protein Synthesis The Structure of RNA The Central Dogma Phenotype A gene is a SEQUENCE of DNA that codes for a protein (or functional RNA). Phenotype is the individual s observable trait
More informationCh 10 Molecular Biology of the Gene
Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read
More informationCELL BIOLOGY: DNA. Generalized nucleotide structure: NUCLEOTIDES: Each nucleotide monomer is made up of three linked molecules:
BIOLOGY 12 CELL BIOLOGY: DNA NAME: IMPORTANT FACTS: Nucleic acids are organic compounds found in all living cells and viruses. Two classes of nucleic acids: 1. DNA = ; found in the nucleus only. 2. RNA
More informationGene Expression: Transcription, Translation, RNAs and the Genetic Code
Lecture 28-29 Gene Expression: Transcription, Translation, RNAs and the Genetic Code Central dogma of molecular biology During transcription, the information in a DNA sequence (a gene) is copied into a
More informationDNA Replication and Protein Synthesis
DNA Replication and Protein Synthesis DNA is Deoxyribonucleic Acid. It holds all of our genetic information which is passed down through sexual reproduction DNA has three main functions: 1. DNA Controls
More informationHonors Biology Reading Guide Chapter 10 v Fredrick Griffith Ø When he killed bacteria and then mixed the bacteria remains with living harmless
Honors Biology Reading Guide Chapter 10 v Fredrick Griffith Ø When he killed bacteria and then mixed the bacteria remains with living harmless bacteria some living bacteria cells converted to disease causing
More informationSection 14.1 Structure of ribonucleic acid
Section 14.1 Structure of ribonucleic acid The genetic code Sections of DNA are transcribed onto a single stranded molecule called RNA There are two types of RNA One type copies the genetic code and transfers
More informationDNA Function: Information Transmission
DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living
More informationChapter 8 From DNA to Proteins. Chapter 8 From DNA to Proteins
KEY CONCEPT Section 1 DNA was identified as the genetic material through a series of experiments. Griffith finds a transforming principle. Griffith experimented with the bacteria that cause pneumonia.
More informationLecture for Wednesday. Dr. Prince BIOL 1408
Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that
More informationChapter 14: From DNA to Protein
Chapter 14: From DNA to Protein Steps from DNA to Proteins Same two steps produce all proteins: 1) DNA is transcribed to form RNA Occurs in the nucleus RNA moves into cytoplasm 2) RNA is translated in
More information3. The following sequence is destined to be translated into a protein: However, a mutation occurs that results in the molecule being altered to:
1. Please identify the molecule below: 5 -ACTCGATTACGATACGA-3ʼ a) DNA b) mrna c) trna d) rrna e) It cannot be determined 2. If a complimentary strand of RNA were made to the molecule in question 1, what
More informationChapter 8. Microbial Genetics. Lectures prepared by Christine L. Case. Copyright 2010 Pearson Education, Inc.
Chapter 8 Microbial Genetics Lectures prepared by Christine L. Case Structure and Function of Genetic Material Learning Objectives 8-1 Define genetics, genome, chromosome, gene, genetic code, genotype,
More informationtranslation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links
The actual process of assembling the proteins on the ribosome is called? translation The building blocks of proteins are? Complementary base pairing links Define and name the Purines amino acids nitrogen
More informationFrom Gene to Protein transcription, messenger RNA (mrna) translation, RNA processing triplet code, template strand, codons,
From Gene to Protein I. Transcription and translation are the two main processes linking gene to protein. A. RNA is chemically similar to DNA, except that it contains ribose as its sugar and substitutes
More informationNotes: (Our Friend) DNA. DNA Structure DNA is composed of 2 chains of repeating. A nucleotide = + +
Notes: (Our Friend) DNA Some DNA Basics DNA stands for DNA functions to & genetic info. This information tells an organism s cells what to make and when to make them. Proteins form cell structures and
More informationDNA and RNA. Chapter 12
DNA and RNA Chapter 12 Warm Up Exercise Test Corrections Make sure to indicate your new answer and provide an explanation for why this is the correct answer. Do this with a red pen in the margins of your
More informationBIOB111 - Tutorial activity for Session 13
BIOB111 - Tutorial activity for Session 13 General topics for week 7 Session 13: Types of nucleic acids, DNA replication Useful links: 1. Visit this website and use its menu to locate information and practice
More informationDNA. Essential Question: How does the structure of the DNA molecule allow it to carry information?
DNA Essential Question: How does the structure of the DNA molecule allow it to carry information? Fun Website to Explore! http://learn.genetics.utah.edu/content/molecules/ DNA History Griffith Experimented
More informationLecture Overview. Overview of the Genetic Information. Marieb s Human Anatomy and Physiology. Chapter 3 DNA & RNA Protein Synthesis Lecture 6
Marieb s Human Anatomy and Physiology Marieb Hoehn Chapter 3 DNA & RNA Protein Synthesis Lecture 6 Lecture Overview The Genetic Information Structure of DNA/RNA DNA Replication Overview of protein synthesis
More informationThe Structure of Proteins The Structure of Proteins. How Proteins are Made: Genetic Transcription, Translation, and Regulation
How Proteins are Made: Genetic, Translation, and Regulation PLAY The Structure of Proteins 14.1 The Structure of Proteins Proteins - polymer amino acids - monomers Linked together with peptide bonds A
More informationCH 17 :From Gene to Protein
CH 17 :From Gene to Protein Defining a gene gene gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there
More informationVideos. Bozeman Transcription and Translation: Drawing transcription and translation:
Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast RNA and DNA. 29b) I can explain
More informationBio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?
Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology
More informationDNA Structure and Replication, and Virus Structure and Replication Test Review
DNA Structure and Replication, and Virus Structure and Replication Test Review What does DNA stand for? Deoxyribonucleic Acid DNA is what type of macromolecule? DNA is a nucleic acid The building blocks
More informationName: Class: Date: ID: A
Class: _ Date: _ CH 12 Review Multiple Choice Identify the choice that best completes the statement or answers the question. 1. How many codons are needed to specify three amino acids? a. 6 c. 3 b. 12
More informationSections 12.3, 13.1, 13.2
Sections 12.3, 13.1, 13.2 Background: Watson & Crick recognized that base pairing in the double helix allows DNA to be copied, or replicated Each strand in the double helix has all the information to remake
More informationName Date Class. The Central Dogma of Biology
Concept Mapping The Central Dogma of Biology Complete the events chain showing the events that occur as DNA codes for RNA, which guides the synthesis of proteins, the central dogma of biology. These terms
More informationBiology Ch. 17- Molecular Genetics 17.1 Isolating the Genetic Material
Biology 3201 - Ch. 17- Molecular Genetics 17.1 Isolating the Genetic Material Scientists who contributed to the development of our modern understanding of DNA and genomes: 1) Gregor Mendel early studies
More informationChapter 12. DNA TRANSCRIPTION and TRANSLATION
Chapter 12 DNA TRANSCRIPTION and TRANSLATION 12-3 RNA and Protein Synthesis WARM UP What are proteins? Where do they come from? From DNA to RNA to Protein DNA in our cells carry the instructions for making
More informationStudy Guide A. Answer Key
From DNA to Proteins Answer Key SECTION 1. IDENTIFYING DNA AS THE GENETIC MATERIAL 1. Mice lived 2. Mice died 3. Mice lived 4. Mice died 5. S 6. bacteria 7. DNA; DNA; DNA 8. protein 9. radioactive 10.
More informationReplication Review. 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells?
Replication Review 1. What is DNA Replication? 2. Where does DNA Replication take place in eukaryotic cells? 3. Where does DNA Replication take place in the cell cycle? 4. 4. What guides DNA Replication?
More informationGenes and How They Work. Chapter 15
Genes and How They Work Chapter 15 The Nature of Genes They proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes The central
More informationDNA RNA PROTEIN SYNTHESIS -NOTES-
DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there
More informationName 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication.
Name 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication. The difference between replication, transcription, and translation. How
More informationChapter 2. An Introduction to Genes and Genomes
PowerPoint Lectures for Introduction to Biotechnology, Second Edition William J.Thieman and Michael A.Palladino Chapter 2 An Introduction to Genes and Genomes Lectures by Lara Dowland Chapter Contents
More informationGenes are coded DNA instructions that control the production of proteins within a cell. The first step in decoding genetic messages is to copy a part
Genes are coded DNA instructions that control the production of proteins within a cell. The first step in decoding genetic messages is to copy a part of the nucleotide sequence of the DNA into RNA. RNA
More informationMarch 26, 2012 NUCLEIC ACIDS AND PROTEIN SYNTHESIS
NUCLEIC ACIDS AND PROTEIN SYNTHESIS MAIN MAIN TOPICS TOPICS TO TO BE BE COVERED COVERED THIS THIS UNIT: UNIT: I. I. EVIDENCE EVIDENCE OF OF DNA DNA AS AS THE THE GENETIC GENETIC CODE CODE II. II. DNA DNA
More informationNucleic Acid Structure:
Nucleic Acid Structure: Purine and Pyrimidine nucleotides can be combined to form nucleic acids: 1. Deoxyribonucliec acid (DNA) is composed of deoxyribonucleosides of! Adenine! Guanine! Cytosine! Thymine
More informationTranscription Eukaryotic Cells
Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes
More informationBIOL 1030 Introduction to Biology: Organismal Biology. Spring 2011 Section A. Steve Thompson:
BIOL 1030 Introduction to Biology: Organismal Biology. Spring 2011 Section A Steve Thompson: stthompson@valdosta.edu http://www.bioinfo4u.net 1 DNA transcription and gene regulation We ve seen how the
More informationDNA- THE MOLECULE OF LIFE
DNA- THE MOLECULE OF LIFE STRUCTURE OF DNA DNA (Deoxyribonucleic Acid): DNA is a long, stringy, twisted molecule made up of nucleotides that carries genetic information. DISCOVERIES Rosalind Franklin,
More informationIB BIO I Replication/Transcription/Translation Van Roekel/Madden. Name Date Period. D. It separates DNA strands. (Total 1 mark)
Name Date Period 1. What is the function of helicase? A. It forms bonds between DNA nucleotides. B. It adds new nucleotides to the DNA helix. C. It forms the DNA helix. D. It separates DNA strands. 2.
More informationChapter 11. Gene Expression and Regulation. Lectures by Gregory Ahearn. University of North Florida. Copyright 2009 Pearson Education, Inc..
Chapter 11 Gene Expression and Regulation Lectures by Gregory Ahearn University of North Florida Copyright 2009 Pearson Education, Inc.. 11.1 How Is The Information In DNA Used In A Cell? Most genes contain
More information