Hammer blot-mediated RNA extraction: an inexpensive, labor-saving method to extract RNA for plant virus detection Md. Shamim Akhter et al. Online Supplementary Materials Supplementary methods Preparation of hammer blots (HBs) and RNA extraction Healthy and virus-inoculated plant leaves were harvested to prepare HBs, from which nucleic acids were extracted. The proposed procedure is as follows (see also supplementary Figure S1). 1. Petiole and midrib were excised, and the leaf tissue was taped on either side for single-sided blotting. Vinyl chloride tape made for electric insulation (Vinyl tape 74, 3M) worked well in our hands. 2. The taped leaf tissue was sandwiched between two layers of filter paper (Whatman 3MM) and placed into a plastic folder. Alternatively, the assembled leaf tissue and filter papers were wrapped with a wrapping film. 3. The leaf tissue was smashed using a hammer to release leaf sap, which could then be adsorbed to the filter paper. 4. The taped leaf tissue and the unblotted layer of filter paper were removed. The blotted filter paper was cut into pieces 4 cm 2, which were rolled into cylinders using toothpicks and transferred into a microfuge tube. 5. a. The rolled blots in the microfuge tubes were immersed in 0.7 ml of solution D (4 M guanidinium thiocyanate, 25 mm sodium citrate ph 7.0, 0.5% [w/v] N-lauroylsarcosine, 0.1 M 2-mercaptoethanol [Chomczynski and Sacchi 1987]) and kept at room temperature for 15 min with intermittent agitation to extract the nucleic acids. The solution was then transferred to a new microfuge tube, and an equal volume of chloroform added. Nucleic acids were precipitated with isopropyl alcohol, rinsed with 70% ethanol, and dissolved in TE buffer (10 mm Tris-HCl ph 8.0, 1 mm EDTA; Nippon Gene). During protocol optimization, we also tested the following two extraction methods: 5b. Rolled blots in microfuge tubes were immersed in 1 ml Sepasol-RNA I Super G (Nacalai Tesque) and kept at room temperature for 15 min with intermittent agitation.
The solution was then transferred to a new microfuge tube and an equal volume of chloroform added. After phase separation, the upper aqueous phase was extracted again with chloroform isoamyl alcohol (24:1), and the nucleic acid was processed as in part 5a. 5c. The rolled blots in microfuge tubes were immersed in 0.7 ml of proteinase K extraction solution (50 mm Tris-HCl ph 8.0, 5 mm EDTA, 0.15 M NaCl, 1% SDS, 1 mg/ml proteinase K). The solution was then transferred to a new microfuge tube, extracted with chloroform, and nucleic acid processed as in 5a. Construction of Apple latent spherical virus (ALSV) vector harboring Beet pseudoyellows virus (BPYV) p6 gene and infection of strawberry plants BPYV p6 gene encoded by ORF2 of BPYV RNA1 is specific to BPYV strawberry strain and was synthesized by Takara Bio (Ohtsu, Japan) according to the reported sequence (Tzanetakis and Martin 2004). The synthesized gene was introduced into pbical2 (Kawai et al. 2014). The recombinant ALSV-p6 was used to transform Agrobacterium tumefaciens GV3101. Transformants harboring RNA1 and RNA2 were grown at 28 C for 48 h on L-broth agar plates containing 50 µg/ml kanamycin, 20 µg/ml rifampicin, and 20 µg/ml gentamicin. These transformants were scraped off the agar plate and suspended in 1 ml infiltration buffer (10 mm K-MES, ph 5.5 containing 10 mm MgCl 2 ) containing 30 µg/ml acetosyringone. An equal volume of bacteria harboring RNA1 and RNA2 was mixed and used to inoculate the surface of strawberry leaves dusted with carborundum. RT-PCR amplification of cellular and viral RNAs The cdna was synthesized from the RNA using M-MuLV reverse transcriptase (New England BioLabs) using random hexamer primers. EF1α mrnas of Nicotiana sylvestris and strawberry (Fragaria ananassa cv. Hohkoh-wase), and PMMoV and recombinant ALSV genomic RNAs were detected by RT-PCR using primers described in the main text. EF1α mrnas of N. benthamiana and cucumber (Cucumis sativus L. cv. Hushinari) were detected by RT-PCR using primer sets NbEF1a-F and NbEF1a-R, and CucEF1a-36F andcucef1a-255r, respectively. Blend Taq DNA polymerase (Toyobo, Osaka, Japan) was used for all RT-PCRs. All primer sequences and PCR conditions are shown in supplementary Table S1.
Supplementary Table S1. PCR primers used in this study Primer name Sequence (5 3 ) PCR conditions ALSV-1355F GAAAATGCGAGGCACTCCTT 94 C, 2 min; 30 cycles of 94 C for ALSV-1643R CAAGAGTTCTCCCCCATAAG 20 s, 60 C for 20 s, and 72 C for 1 min; and 72 C for 3 min CucEF1a-36F GACATTGCCCTGTGGAAGTT CucEF1a-255R FaEF1a-F FaEF1a-R Nt-EF1A-F Nt-EF1A-R NbEF1a-F NbEF1a-R GCTTGACACCAAGGGTGAAA TGGATTTGAGGGTGACAACATGA GTATACATCCTGAAGTGGTAGACGGAGG AGACCACCAAGTACTACTGCACTG GGAAGAAACCTCCTTCACGA CTCCAAGGCTAGGTATGATG CTTCGTGGTTGCATCTCAAC 94 C, 2 min; 30 cycles of 94 C for 30 s, 56 C for 30 s, and 72 C for 1 min; and 72 C for 3 min PMF1 GTTATCGTACTCGCCACGGACG 94 C, 1 min; 25 cycles of 94 C for PMR1 GTTAGAATTGGGCAGAACTCGG 30 s, 60 C for 30 s, and 72 C for 1 min; and 72 C for 3 min
Supplementary Figure S1 a b c d e f g h i Fig. S1. Visual protocol for hammer-blot-mediated nucleic acid extraction. The petiole and midrib were removed, and the pieces of leaf blade were placed on filter paper (a), taped (b), covered with another sheet of filter paper to make a sandwich and inserted into a plastic folder (c). Leaf tissue was disrupted by a hammer to allow the crude sap to be adsorbed by the filter paper (d), plant debris was removed with tape (e and f), and the blot was cut into about 4-cm 2 pieces (g). The pieces of blot were rolled into cylinders using toothpicks (h) and inserted into a 1.5 ml microfuge tube (i). Thereafter, the extraction solution was added to immerse the blots and extract the nucleic acids.
Supplementary Figure S2 M 1 2 20000 bp 2000 bp 1000 bp 3 25s 18s 500 bp 100 bp Fig. S2. Agarose gel electrophoresis of nucleic acids extracted with proteinase K extraction solution. Total nucleic acids were extracted from hammer blots (HBs) of N. sylvestris leaf tissue using a proteinase K extraction solution described in Supplementary methods: Preparation of HBs and RNA extraction, part 5b. 25S and 18S indicate the position of ribosomal RNA. M, molecular mass standard Gene Ladder Wide 1 (Nippon Gene, Tokyo, Japan); some band sizes are on the left.
Supplementary Figure S3 a N. benthamiana (EF1 α) 1000 bp M 8 1 2 3 4 5 6 7 500 bp 100 bp b Cucumber (EF1 α) Cotyledons Mature leaves M 1 2 3 4 5 6 1000 bp 500 bp 100 bp Fig. S3. RT-PCR detection of EF1α mrnas of N. benthamiana (a) and cucumber (b). Total nucleic acids were extracted using the hammer blot (HB) method and subjected to RT-PCR detection of EF1α mrna. In N. benthamiana, nucleic acids were extracted from eight independent HBs. In cucumber, HBs were prepared with three cotyledons and three mature true leaves (Mature leaves). A partial cdna sequence of EF1α was amplified from each of the nucleic acid preparations. Arrowhead indicates the position of the amplified fragments: 371 bp from N. benthamiana (a) and 219 bp from cucumber (b). M, molecular mass standard Gene Ladder 100 (Nippon Gene, Tokyo, Japan); some band sizes are on the left.