DNA Profiling (DNA fingerprinting)
Background Information: Restriction Enzymes
Restriction Enzymes Evolved by bacteria to protect against viral DNA infection. Also called Endonucleases. They cleave DNA Strands. 3,000+ known.
There are 2 types of Restriction Enzymes: Nonspecific: cut at random. Specific: cut only when they encounter a certain sequence of bases.
Restriction enzymes recognize and cut DNA only at a particular sequence of nucleotides. For example, the bacterium Hemophilus aegypticus produces an enzyme named HaeIII that cuts DNA wherever it encounters the following sequence: 5 GGCC 3' 3 CCGG 5'
5 GGCC 3' 3 CCGG 5' The cut is made between the adjacent G and C. This particular sequence occurs at 11 places in the circular DNA molecule of the virus φx174. Thus treatment of this DNA with this enzyme produces 11 fragments, each with a precise length and nucleotide sequence.
1/18/2006
HaeIII and AluI cut straight across the double helix producing "blunt" ends.
However, many restriction enzymes cut in an offset fashion. The ends of the cut have an overhanging piece of single-stranded DNA. These are called "sticky ends" because they are able to form base pairs with any DNA molecule that contains the complementary sticky end.
Restriction Enzyme Example TaqI T CGA AGC T Cuts between T and C Leaves sticky end CG
Pst1 Restriction Sequence: CTGCA G Sticky End: ACGT
Sticky End of EcoR1 Restriction Sequence: G AATTC Sticky End: AATT
Sticky or Blunt Ends?
Mixed together, molecules with complimentary sticky ends can join together by the base pairing between their sticky ends. DNA ligase can form covalent bonds along the backbone of each strand. The result is a molecule of recombinant DNA (rdna).
VNTR - Variable Number Tandem Repeats A Tandem repeat is the repeated end-to-end duplication of a core DNA sequence at a defined locus. Because of their variation between individuals, these DNA segments are useful for identifying individuals for such purposes as linking a suspect to a crime scene. Hence, a "tandem repeat" is DNA consisting of short, repeated base pair sequences linked together. (example: gatagatagatagatagata is a tandem repeat consisting of five repeats of tandem "GATA"). Because the number of repeats is different from person to person, they are called Variable Number Tandem Repeats.
1/18/2006 VNTR Inheritance
Restriction Fragment Length Polymorphism (RFLP) An RFLP is a sequence of DNA that has a restriction site on each end with a "target" sequence in between. A target sequence is any segment of DNA that binds to a probe by forming complementary base pairs. A probe is a sequence of single-stranded DNA that has been tagged with radioactivity or an enzyme so that the probe can be detected.
Linear DNA Restriction Digest EcoR1 XXXXGAATTCXXXXGAATTCXXXXXXXX XXXXG AATTCXXXXGAATTCXXXXXXXX 1 cut = 2 fragments of DNA
Linear DNA Restriction Digest EcoR1 EcoR1 XXXXGAATTCXXXXGAATTCXXXXXXXX XXXXG AATTCXXXXG AATTCXXXXXXXX 2 cuts = 3 fragments of DNA
Circular DNA Restriction Digest EcoR1 EcoR1
Circular DNA Restriction Digest 2 cuts = 2 fragments of DNA
Restriction Enzymes Cuts/Fragments Rule: Linear DNA: Number of cuts + 1 = Number of Fragments Circular DNA: Number of Cuts = Number of Fragments
What is DNA Profiling? A technique used by scientists to distinguish between individuals of the same species using only samples of their DNA.
The process of DNA fingerprinting was invented by Alec Jeffreys at the University of Leicester in 1985. Who Invented it? He was knighted for the discovery in 1994.
Stages of DNA Profiling Stage 1: Cells are broken down to release DNA. If only a small amount of DNA is available it can be amplified using the polymerase chain reaction (PCR).
Stages of DNA Profiling Step 2: The DNA is cut into fragments using restriction enzymes. Each restriction enzyme cuts DNA at a specific base sequence.
The sections of DNA that are cut out are called restriction fragments. This process yields thousands of restriction fragments of all different sizes because the base sequences being cut may be far apart (long fragment) or close together (short fragment).
Stages of DNA Profiling Stage 3: Fragments are separated on the basis of size using a process called gel electrophoresis. DNA fragments are injected into wells and an electric current is applied along the gel.
Stages of DNA Profiling DNA is negatively charged so it is attracted to the positive end of the gel. The shorter DNA fragments move faster than the longer fragments. DNA is separated on basis of size.
Stages of DNA Profiling A radioactive material is added which combines with the DNA fragments to produce a fluorescent image. A photographic copy of the DNA bands is obtained.
Stage 4: Stages of DNA Profiling The pattern of fragment distribution is then analyzed.
Go to Simulation
What is the function of a DNA It is used to determine the size of all fragments of DNA in the profile, by comparing them to fragments of known size. Marker?
Usefulness of DNA Profiling The DNA profile of each individual is highly specific. The chances of two people having exactly the same DNA profile is 30,000 million to 1 (except for identical twins). 30,000 million = 30,000,000,000,000
Biological materials used for DNA profiling Blood Hair Saliva Semen Body tissue cells DNA samples have been obtained from vaginal cells transferred to the outside of a condom during sexual intercourse.
DNA Profiling can solve crimes Forensic science is the use of scientific knowledge in legal situations. The pattern of the DNA profile found at a crime scene is compared with those of the victim and the suspects. If the profile matches a suspect it provides strong evidence that the suspect was present at the crime scene (Note:it does not prove they committed the crime). If the profile doesn t match the suspect then that suspect may be eliminated from the investigation.
Example A violent murder occurred. The forensics team retrieved a blood sample from the crime scene. They prepared DNA profiles of the blood sample, the victim and a suspect as shown on the next slide:
Was the suspect at the crime scene? Suspects Profile Blood sample from crime scene Victims profile
DNA Profiling can Solve Medical Problems DNA profiles can be used to determine whether a particular person is the parent of a child. A child s paternity (father) and maternity(mother) can be determined. This information can be used in Paternity suits Inheritance cases Immigration cases
Example: A Paternity Test By comparing the DNA profile of a mother and her child it is possible to identify DNA fragments in the child which are absent in the mother and must therefore have been inherited from the biological father. See the profile on the next slide:
Is this man the father of the child? Mother Child Man
Transiluminators: A device that is used to visualize DNA by exposing the phosphorescent stains used to U.V. light. How do you protect yourself from the U.V. rays? The plastic hood on the illuminator is coated with a U.V. blocking plastic. Lab glasses also come with U.V. shield layers.
In 2002 Elizabeth Hurley used DNA profiling to prove that Steve Bing was the father of her child, Damien. Famous cases
Famous Cases Colin Pitchfork was the first criminal caught based on DNA fingerprinting evidence. He was arrested in 1986 for the rape and murder of two girls and was sentenced in 1988.
Famous Cases O.J. Simpson was cleared of a double murder charge in 1994 which relied heavily on DNA evidence. This case highlighted lab difficulties.