High Throughput Sequencing Technologies. J Fass UCD Genome Center Bioinformatics Core Monday June 16, 2014

Similar documents
High Throughput Sequencing Technologies. UCD Genome Center Bioinformatics Core Monday 15 June 2015

Next Generation Sequencing. Jeroen Van Houdt - Leuven 13/10/2017

Research school methods seminar Genomics and Transcriptomics

Next Generation Sequencing Lecture Saarbrücken, 19. March Sequencing Platforms

Third Generation Sequencing

Human genome sequence

DNA-Sequencing. Technologies & Devices. Matthias Platzer. Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI)

DNA-Sequencing. Technologies & Devices. Matthias Platzer. Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI)

Introduction to Next Generation Sequencing (NGS)

Genome Sequencing. I: Methods. MMG 835, SPRING 2016 Eukaryotic Molecular Genetics. George I. Mias

Ultrasequencing: Methods and Applications of the New Generation Sequencing Platforms

Sequencing techniques and applications

Next-Generation Sequencing. Technologies

Next Gen Sequencing. Expansion of sequencing technology. Contents

Welcome to the NGS webinar series

Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es

Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es

Gene Expression Technology

Sequencing Theory. Brett E. Pickett, Ph.D. J. Craig Venter Institute

RIPTIDE HIGH THROUGHPUT RAPID LIBRARY PREP (HT-RLP)

CSC Assignment1SequencingReview- 1109_Su N_NEXT_GENERATION_SEQUENCING.docx By Anonymous. Similarity Index

NEXT-GENERATION SEQUENCING AND BIOINFORMATICS

INTRODUCCIÓ A LES TECNOLOGIES DE 'NEXT GENERATION SEQUENCING'

Introductie en Toepassingen van Next-Generation Sequencing in de Klinische Virologie. Sander van Boheemen Medical Microbiology

BIOINFORMATICS 1 SEQUENCING TECHNOLOGY. DNA story. DNA story. Sequencing: infancy. Sequencing: beginnings 26/10/16. bioinformatic challenges

Next Generation Sequencing Technologies

HiSeqTM 2000 Sequencing System

Opportunities offered by new sequencing technologies

DNA-Sequenzierung. Technologien & Geräte

Outline. General principles of clonal sequencing Analysis principles Applications CNV analysis Genome architecture

Lecture 8: Sequencing and SNP. Sept 15, 2006

MHC Region. MHC expression: Class I: All nucleated cells and platelets Class II: Antigen presenting cells

Bioanalytical chemistry. 6. DNA sequencing

Additional Activity: Sanger Dideoxy Sequencing: A Simulation Activity

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Thema Gentechnologie. Erwin R. Schmidt Institut für Molekulargenetik Vorlesung #

Lecture Four. Molecular Approaches I: Nucleic Acids

NEXT GENERATION SEQUENCING: A REVOLUTION IN GENE SEQUENCING

Ecole de Bioinforma(que AVIESAN Roscoff 2014 GALAXY INITIATION. A. Lermine U900 Ins(tut Curie, INSERM, Mines ParisTech

Next Generation Sequencing. Dylan Young Biomedical Engineering

NPTEL VIDEO COURSE PROTEOMICS PROF. SANJEEVA SRIVASTAVA

Genome Sequencing Technologies. Jutta Marzillier, Ph.D. Lehigh University Department of Biological Sciences Iacocca Hall

Targeted Sequencing Using Droplet-Based Microfluidics. Keith Brown Director, Sales

Introduction to Bioinformatics and Gene Expression Technologies

Genetic Fingerprinting

FGCZ NEWSLETTER FALL Next Generation Sequencing at the Functional Genomics Center Zurich

Next Generation Sequencing: An Overview

Computational Biology I LSM5191

Introductory Next Gen Workshop

1.1 Post Run QC Analysis

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist

HiPer Real-Time PCR Teaching Kit

Introduction Bioo Scientific

Next Generation Sequencing Technologies. Some slides are modified from Robi Mitra s lecture notes

Mate-pair library data improves genome assembly

Biochemistry 412. New Strategies, Technologies, & Applications For DNA Sequencing. 12 February 2008

Methods, Models & Techniques. High-throughput DNA sequencing concepts and limitations

Procedure & Checklist - Preparing SMRTbell Libraries using PacBio Barcoded Universal Primers for Multiplex SMRT Sequencing

Comparative genomics on gene and single nucleotide level

Please purchase PDFcamp Printer on to remove this watermark. DNA microarray

Enzymatic assembly of DNA molecules up to several hundred kilobases

DNA Technology. Asilomar Singer, Zinder, Brenner, Berg

Targeted Sequencing in the NBS Laboratory

Announcements. Coffee! Evalua,on. Dr. Yoshiki Sasai, R.I.P.

SAMPLE LITERATURE Please refer to included weblink for correct version.

SANGER SEQUENCING WHITE PAPER

Preparing Samples for Digital Gene Expression-Tag Profiling with DpnII

Sequencing the Human Genome

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)

Preparing Samples for Digital Gene Expression-Tag Profiling with NlaIII

Illumina (Solexa) Throughput: 4 Tbp in one run (5 days) Cheapest sequencing technology. Mismatch errors dominate. Cost: ~$1000 per human genme

Published in: Next Generation Sequencing - Advances, Applications and Challenges DOI: /61964

A window into third-generation sequencing

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Session 3 Cloning Overview & Polymerase Chain Reaction

Pyrosequencing. Alix Groom

KAPA HiFi Real-Time PCR Library Amplification Kit

1. A brief overview of sequencing biochemistry

qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time

Multiplex Assay Design

Introduction to Bioinformatics

Lab methods: Exome / Genome. Ewart de Bruijn

User Manual. NGS Library qpcr Quantification Kit (Illumina compatible)

SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA

BST227 Introduction to Statistical Genetics. Lecture 8: Variant calling from high-throughput sequencing data

XactEdit Cas9 Nuclease with NLS User Manual

Recombinant DNA Technology

Sanger Sequencing: Troubleshooting Guide

601 CTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTT GACAGGTGTGTTAGACGGGAAAGCTTTCTAGGGTTGCTTTTCTCTCTGGTGTACCAGGAA >>>>>>>>>>>>>>>>>>

Amplicon Sequencing Template Preparation

2054, Chap. 14, page 1

Technical Review. Real time PCR

DNA Arrays Affymetrix GeneChip System

MICRO$EC: Cost Effective, Whole-Genome Sequencing

FORENSIC GENETICS. DNA in the cell FORENSIC GENETICS PERSONAL IDENTIFICATION KINSHIP ANALYSIS FORENSIC GENETICS. Sources of biological evidence

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -

Bioinformatics Advice on Experimental Design

P HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS

Polymerase Chain Reaction (PCR) and Its Applications

Transcription:

High Throughput Sequencing Technologies J Fass UCD Genome Center Bioinformatics Core Monday June 16, 2014

Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo

Sequencing Explosion 2011 PacBio 2012 2013... Oxford Nanopore? adapted from Mardis 2011 Nature 470:198

Current Sequencing Technologies Sanger (Roche) 454 Illumina SOLiD PacBio Ion Torrent Complete Genomics? (Illumina) Moleculo Oxford Nanopore

Sanger Sequencing ddntp's (with fluorescent labels) incorporated (along with unlabeled dntp's) in amplification step, resulting in some molecules terminated at every position Gel / capillary electrophoresis orders molecules by length Fluorescent label (color) indicates terminal base identity at each position Read colors, in order, to derive sequence http://www.jgi.doe. gov/sequencing/education/how/how _10.html 2011 2012 http://users.rcn.com/jkimball.ma. ultranet/biologypages/d/dnasequencing.html

Current Sequencing Technologies Roche 454 GS FLX Titanium Illumina HiSeq 2000 / 2500 Illumina MiSeq

Current Sequencing Technologies PacBio RS Ion Torrent (Life Technologies) Ion Proton Ion Torrent (Life Technologies) Ion PGM

Current Sequencing Technologies Oxford Nanopore MinION Oxford Nanopore GridION

Illumina Illumina HiSeq 2000 / 2500 Illumina MiSeq

Illumina 8 "Lanes" Surface of flow cell is coated with a lawn of oligo pairs...

Illumina Millions of single molecules hybridize to the lawn of adapters dsdna extended by polymerases Cluster Generation: Hybridize Fragments & Extend Adapter Sequence (contains primer)

Cluster Generation: Illumina Denature Double-stranded DNA Original strand dsdna is denatured Original template fragment washed away Newly synthesized strand is covalently bound to flow cell New strand discard

Illumina Cluster Generation: Covalently-Bound, Randomly Dispersed Single Molecules Resulting covalentlybound DNA fragments are bound to the flow cell surface in a random pattern

Illumina Cluster Generation: Bridge Amplification Single-strand flops over to hybridize to adjacent adapter, forming a bridge dsdna synthesized from primer in hybridized adapter

Illumina Cluster Generation: Bridge Amplification dsdna bridge now formed each strand covalently bound to different adapter

Illumina Cluster Generation: Bridge Amplification dsdna bridge is denatured

Illumina Cluster Generation: Bridge Amplification Single strands flop over to hybridize to adjacent adapters, forming bridges dsdna synthesized by polymerases

Illumina Cluster Generation: Bridge Amplification Bridge amplification cycles repeated many times

Illumina Cluster Generation dsdna bridges denatured Strands in one of the orientations cleaved and washed away

Illumina Cluster Generation resulting cluster has ssdna in only one orientation

Illumina Cluster Generation Free 3'-ends blocked to prevent unwanted priming

Sequencing By Synthesis Illumina Sequencing primer Sequencing primer is hybridized to adapter sequence, starting Sequencing By Synthesis

Sequencing By Synthesis Illumina Cycle four FlNTP's + polymerases Image incorporated Fl-NTP's Cleave terminator and dye X 36-150 (HiSeq), 250 (MiSeq)...

Illumina Sequencing By Synthesis

Illumina Sequencing By Synthesis

Illumina Paired-end sequencing Bridge amplification to generate strands with opposite orientation

Illumina Paired-end sequencing dsdna bridges denatured Strands in already sequenced orientation cleaved and washed away

Illumina Paired-end sequencing strands with uniform orientation, opposite that in first read

Illumina Paired-end sequencing Free 3'-ends blocked to prevent unwanted priming

Paired-end sequencing Illumina Sequencing primer Sequencing primer is hybridized to other adapter sequence, starting second read's Sequencing By Synthesis

Illumina HiSeq 2000 stats: Dual surface imaging Fast scanning and imaging Two flow cells (in sequence) Initially: 200 Gbp per run Currently: 600 Gbp per run Run time 7-8 days (100bp PE) 1-2 day rapid mode 25 Gbp / day 2 billion paired-end reads (150200 million clusters per lane) < $5k per human genome < $100 per transcriptome

454 Roche 454 GS FLX Titanium see http://en.wikipedia.org/wiki/jonathan_m._rothberg

454 1) Adapter-ligated ssdna library 2) Clonal amplification on 28 micron beads... emulsion PCR 3) Beads deposited on PicoTiterPlate wells 4) Sequencing by synthesis

454 Wells imaged to track fluorescence over time (coordinated with flow of different tagged nucleotides). Nucleotide flow over time is called "flowspace."

454 Nucleotides are not "terminated," so homopolymer runs add bases all at the same time. Number of bases is inferred from fluorescence signal amplitude.

Ion Torrent Ion Torrent (Life Technologies) Ion Proton Ion Torrent (Life Technologies) Ion PGM see http://en.wikipedia.org/wiki/jonathan_m._rothberg

Ion Torrent Ion Torrent uses a high-density array of micro-machined wells to perform this simple chemical reaction in a massively parallel way. Each well holds a different DNA template. Beneath the wells is an ionsensitive layer and beneath that a proprietary Ion sensor.

Ion Torrent

Ion Torrent Nucleotide addition results in H+-ion release. Current / ph signal is detected by solid-state sensor ("world's smallest solid-state ph meter"). Nucleotide being "flowed" at the time determines base-call. Like 454, homopolymer run length is inferred from signal amplitude.

PacBio

PacBio RS (Real-time Sequencer) Polymerase / DNA complex adhered to bottom of imaging well (Zero Mode Waveguide)... evanescent wave illuminates tiny volume around polymerase.

PacBio RS (Real-time Sequencer) Fluorescently-tagged nucleotides are only seen (for an appreciable amount of time) when associated with polymerase. Persistent time in the excitation volume can be recognized as a "pulse."

PacBio RS (Real-time Sequencer) Science, 02 January 2009/10.1126/science.1162986

PacBio SMRTbell Construct

PacBio Sequencing

PacBio Sequencing

PacBio Sequencing polymerase SMRT bell template sequenced strand

PacBio Sequencing

PacBio detection of modified bases Movie trace pulse timing can reveal nucleotide modification, e.g. N6-methyladenosine

PacBio accuracy

Oxford Nanopore Oxford Nanopore MinION Oxford Nanopore GridION

Oxford Nanopore

Oxford Nanopore

Oxford Nanopore

... Oxford Nanopore? Sequencing Explosion PacBio RS II 2013 adapted from Shokralla 2012 Molecular Ecology 21:1794

Tech Comparison Ryan Kim, ~Dec. 2012

Tech Comparison Non-technology considerations error modes related to application single-molecule preferred? novel isoforms... software evolving haplotype determination (phasing) base modification local expertise (!) library prep secondary analysis Availability / turnaround time