Please purchase PDFcamp Printer on to remove this watermark. DNA microarray
|
|
- Kristina Simmons
- 6 years ago
- Views:
Transcription
1 DNA microarray Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. A DNA microarray is a multiplex technology used in molecular biology. It consists of an arrayed series of thousands of microscopic spots of DNA oligonucleotides, called features, each containing picomoles (10-12 moles) of a specific DNA sequence, known as probes (or reporters). These can be a short section of a gene or other DNA element that are used to hybridize a cdna or crna sample (called target) under high-stringency conditions. Probe-target hybridization is usually detected and quantified by detection of fluorophore-, silver-, or chemiluminescence-labeled targets to determine relative abundance of nucleic acid sequences in the target. Since an array can contain tens of thousands of probes, a microarray experiment can accomplish many genetic tests in parallel. Therefore arrays have dramatically accelerated many types of investigation. In standard microarrays, the probes are attached via surface engineering to a solid surface by a covalent bond to a chemical matrix (via epoxy-silane, aminosilane, lysine, polyacrylamide or others). The solid surface can be glass or a silicon chip, in which case they are colloquially known as an Affy chip when an Affymetrix chip is used. Other microarray platforms, such as Illumina, use microscopic beads, instead of the large solid support. DNA arrays are different from other types of microarray only in that they either measure DNA or use DNA as part of its detection system.
2 DNA microarrays can be used to measure changes in expression levels, to detect single nucleotide polymorphisms (SNPs), or to genotype or resequence mutant genomes (see uses and types section). Microarrays also differ in fabrication, workings, accuracy, efficiency, and cost (see fabrication section). Additional factors for microarray experiments are the experimental design and the methods of analyzing the data (see Bioinformatics section). History Microarray technology evolved from Southern blotting, where fragmented DNA is attached to a substrate and then probed with a known gene or fragment. Nucleic Acids Res Apr 11;20(7): Oligonucleotide hybridizations on glass supports: a novel linker for oligonucleotide synthesis and hybridization properties of oligonucleotides synthesised in situ. Maskos U, Southern EM. The first reported use of this approach was the analysis of 378 arrayed lysed bacterial colonies each harboring a different sequence which were assayed in multiple replicas for expression of the genes in multiple normal and tumor tissue (Augenlicht and Kobrin, Cancer Research, 42, , 1982). This was expanded to analysis of more than 4000 human sequences with computer driven scanning and image processing for quantitative analysis of the sequences in human colonic tumors and normal tissue (Augenlicht et al., Cancer Research, 47, , 1987) and then to comparison of colonic tissues at different genetic risk (Augenlicht et al., Proceedings National Academy of Sciences, USA, 88, , 1991). The use of a collection of distinct DNAs in arrays for expression profiling was also described in 1987, and the arrayed DNAs were used to identify genes whose expression is modulated by interferon. [1] These early gene arrays were made by spotting cdnas onto filter paper with a pin-spotting device. The use of miniaturized microarrays for gene expression profiling was first reported in 1995, [2] and a completeeukaryotic genome (Saccharomyces cerevisiae) on a microarray was published in 1997.
3 Principle hybridization of the target to the probe Main article: Nucleic acid hybridization For more details on this topic, see DNA microarray experiment. The core principle behind microarrays is hybridization between two DNA strands, the property of complementary nucleic acid sequences to specifically pair with each other by forming hydrogen bonds between complementary nucleotide base pairs. A high number of complementary base pairs in a nucleotide sequence means tighter noncovalent bonding between the two strands. After washing off of non-specific bonding sequences, only strongly paired strands will remain hybridized. So fluorescently labeled target sequences that bind to a probe sequence generate a signal that depends on the strength of the hybridization determined by the number of paired bases, the hybridization conditions (such as temperature), and washing after hybridization. Total strength of the signal, from a spot (feature), depends upon the amount of target sample binding to the probes present on that spot. Microarrays use relative quantization in which the intensity of a feature is compared to the intensity of the same feature under a different condition, and the identity of the feature is known by its position. An alternative to microarrays is serial analysis of gene expression, where the transcriptome is sequenced allowing an absolute measurement. The step required in a microarray experiment.
4 DNA microarray experiment steps involved in a microarray experiment (some steps omitted)
5 This is an example of a DNA microarray experiment, detailing a particular case to better explain DNA microarray experiments, while enumerating possible alternatives. 1. The two samples to be compared (pairwise comparison) are grown/acquired. In this example treated sample (case) and untreated sample (control). 2. The nucleic acid of interest is purified: this can be all RNA for expression profiling, DNA for comparative hybridization, or DNA/RNA bound to a particular protein which is immunoprecipitated (ChIP-on-chip) for epigenetic or regulation studies. In this example total RNA is isolated (total as it is nuclear and cytoplasmic) by Guanidinium thiocyanate-phenol-chloroform extraction(e.g. Trizol) which isolates most RNA (whereas column methods have a cut off of 200 nucleotides) and if done correctly has a better purity. 3. The purified RNA is analysed for quality (by capillary electrophoresis) and quantity (by using a nanodrop spectrometer): if enough material (>1µg) is present the experiment can continue. 4. The labelled product is generated via reverse transcription and sometimes with an optional PCR amplification. The RNA is reverse transcribed with either polyt primers which amplify only mrna or random primers which amplify all RNA which is mostly rrna, mirna microarray ligate an oligonucleotide to the purified small RNA (isolated with a fractionator) and then RT and amplified. The label is added either in the RT step or in an additional step after amplification if present.the sense that is labelled depends on the microarray, which means that if the label is added with the RT mix, the cdnais on the template strand while the probe is on the sense strand (unless they are negative controls). The label is typically fluorescent; only one machine uses radiolabels. The labelling can be direct (not used) or indirect which requires a coupling stage. The coupling stage can occur before hybridization (two-channel arrays) using aminoallyl-utp and NHS amino-reactive dyes (likecyanine dyes) or after (single-channel arrays) using biotin and labelled streptavin. The modified nucleotides (typically a 1 aautp: 4 TTP mix) are added enzymatically at a lower rate compared to normal nucleotides, typically resulting in 1 every 60 bases (measured with a
6 spectrophotometer). The aadna is then purified with a column (using solution containing phosphate buffer as Tris contains amine groups). The aminoallyl group is an amine group on a long linker attached to the nucleobase, which reacts with a reactive dye. A dye flip is a type of replicate done to remove any dye effects in two-channel dyes, in one slide one same is labeled with Cy3 the other with Cy5, this is reversed in a different slide. In this example, in the presence of aminoallyl-utp added in the RT mix. 5. The labeled samples are then mixed with a propriety hybridization solution which may contain SDS, SSC, dextran sulfate, a blocking agent (such as COT1 DNA, salmon sperm DNA, calf thymus DNA, PolyA or PolyT), Denhardt's solution and formamine. 6. This mix is denatured and added to a pin hole in a microarray, which can be a gene chip (holes in the back) or a glass microarray which is bound by a cover, called a mixer, containing two pinholes and sealed with the slide at the perimeter. 7. The holes are sealed and the microarray hybridized, either in a hyb oven, where the microarray is mixed by rotation, or in a mixer, where the microarray is mixed by alternating pressure at the pinholes. 8. After an overnight hybridization, all nonspecific binding is washed off (SDS and SSC). 9. The microarray is dried and scanned in a special machine where a laser excites the dye and a detector measures its emission. 10. The image is gridded with a template and the intensities of the features (several pixels make a feature) are quantified. 11. The raw data is normalized, the simplest way is to subtract the background intensity and then divide the intensities making either the total intensity of the features on each channel equal or the intensities of a reference gene and then the t-value for all the intensities is calculated. More sophisticated methods include z-ratio, loess and lowess regression and RMA (robust multichip analysis) for Affymetrix chips (single-channel, silicon chip, in situ synthesised short oligonucleotides).
Gene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More informationIntroduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
More informationDNA Arrays Affymetrix GeneChip System
DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC
More information3.1.4 DNA Microarray Technology
3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns
More informationRecent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)
Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on
More informationNon-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit
Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen
More informationTechnical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
More informationMethods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -
Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The
More informationLecture #1. Introduction to microarray technology
Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationUsing Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application
Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application Gene Expression Author Michelle M. Chen Agilent Technologies, Inc. 3500 Deer Creek Road, MS 25U-7 Palo Alto,
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationDNA Microarray Data Oligonucleotide Arrays
DNA Microarray Data Oligonucleotide Arrays Sandrine Dudoit, Robert Gentleman, Rafael Irizarry, and Yee Hwa Yang Bioconductor Short Course 2003 Copyright 2002, all rights reserved Biological question Experimental
More informationSIMS2003. Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School. Introduction to Microarray Technology.
SIMS2003 Instructors:Rus Yukhananov, Alex Loguinov BWH, Harvard Medical School Introduction to Microarray Technology. Lecture 1 I. EXPERIMENTAL DETAILS II. ARRAY CONSTRUCTION III. IMAGE ANALYSIS Lecture
More informationAmino-allyl Dye Coupling Protocol
Amino-allyl Dye Coupling Protocol Joseph DeRisi, June 2001 Typically, fluorescently labeled cdna is generated by incorporation of dyeconjugated nucleotide analogs during the reverse transcription process.
More informationThe Polymerase Chain Reaction. Chapter 6: Background
The Polymerase Chain Reaction Chapter 6: Background Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off the road and outlined a way to conduct DNA replication in a tube Worked for
More informationMicroarray. Slide Selection Chart... J2. Epoxide-coated Slides... J3. GAPS II-coated Slides... J5. Corning Cover Glass... J6
Slide Selection Chart... J2 Epoxide-coated Slides... J3 UltraGAPS -coated Slides... J4 GAPS II-coated Slides... J5 Corning Cover Glass... J6 384-well Printing Plates... J6 Slide Mailers/Storage Boxes...
More informationReverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami
Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami hanialhadrami@kau.edu.sa www.hanialhadrami.kau.edu.sa Overview Several techniques are available to detect and analyse RNA. Examples of these techniques
More informationINTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist
INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing
More informationIntroduction to Bioinformatics. Fabian Hoti 6.10.
Introduction to Bioinformatics Fabian Hoti 6.10. Analysis of Microarray Data Introduction Different types of microarrays Experiment Design Data Normalization Feature selection/extraction Clustering Introduction
More informationTypical probes. Slides per pack Aminosilane. Long oligo- Slide AStar None D surface. nucleotides
Aminosilane coating Nexterion Slide A+ and Slide AStar Overview Type of coating Immobilization method Typical probes Ordering information Nexterion product Barcode option Item number Slides per pack Aminosilane
More information2054, Chap. 14, page 1
2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification
More informationBiotechnology and Genomics in Public Health. Sharon S. Krag, PhD Johns Hopkins University
This work is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike License. Your use of this material constitutes acceptance of that license and the conditions of use of materials on this
More informationProduct Name : Simple mirna Detection Kit
Product Name : Simple mirna Detection Kit Code No. : DS700 This product is for research use only Kit Contents This kit provides sufficient reagents to perform 20 reactions for detecting microrna. Components
More informationChapter 17. PCR the polymerase chain reaction and its many uses. Prepared by Woojoo Choi
Chapter 17. PCR the polymerase chain reaction and its many uses Prepared by Woojoo Choi Polymerase chain reaction 1) Polymerase chain reaction (PCR): artificial amplification of a DNA sequence by repeated
More informationNPTEL VIDEO COURSE PROTEOMICS PROF. SANJEEVA SRIVASTAVA
LECTURE-03 GENOMICS AND TRANSCRIPTOMICS: WHY PROTEOMICS? TRANSCRIPT Welcome to the proteomics course. Today, we will talk about Genomics and Transcriptomics and then we will talk about why to study proteomics?
More informationChapter 15 Gene Technologies and Human Applications
Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect
More informationTHE INSTITUTE FOR GENOMIC RESEARCH Standard Operating Procedure SOP #: M004 REVISION LEVEL:.3 EFFECTIVE DATE: 9/16/03
Standard Operating Procedure PAGE: 1 of 8 SOP #: M004 REVISION LEVEL:.3 EFFECTIVE DATE: 9/16/03 AUTHOR: Jeremy Hasseman PRIMARY REVIEWERS: Renee Gaspard, Bryan Frank 1. PURPOSE This protocol describes
More informationWhat is a microarray
DNA Microarrays What is a microarray A surface on which sequences from thousands of different genes are covalently attached to fixed locations (probes). Glass slides Silicon chips Utilize the selective
More informationRNA Isolation and Technology Applications. Nadine Nassif Senior Research Scientist Promega Corporation
RNA Isolation and Technology Applications Nadine Nassif Senior Research Scientist Promega Corporation verview Brief overview of basic RNA/DNA chemistry. verview of total and poly(a+) RNA isolation. Discuss
More informationP HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS
PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics
More informationRoche Molecular Biochemicals Technical Note No. LC 10/2000
Roche Molecular Biochemicals Technical Note No. LC 10/2000 LightCycler Overview of LightCycler Quantification Methods 1. General Introduction Introduction Content Definitions This Technical Note will introduce
More informationComputational Biology I LSM5191
Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA
More informationLATE-PCR. Linear-After-The-Exponential
LATE-PCR Linear-After-The-Exponential A Patented Invention of the Laboratory of Human Genetics and Reproductive Biology Lab. Director: Lawrence J. Wangh, Ph.D. Department of Biology, Brandeis University,
More informationGenetics Lecture 21 Recombinant DNA
Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of
More informationOne Step SYBR PrimeScript RT-PCR Kit II (Perfect Real Time)
Cat. # RR086A For Research Use One Step SYBR PrimeScript RT-PCR Kit II Product Manual Table of Contents I. Description...3 II. III. IV. Principle...3 Components...5 Storage...6 V. Features...6 VI. VII.
More informationIntroduction to Fluorescent In Situ Hybridization (FISH)
Robert Driscoll, M.F.S. Heather Cunningham, M.S. Introduction to Fluorescent In Situ Hybridization (FISH) Fluorescent In Situ Hybridization (FISH) FISH is a cytogenetic technique used to detect the presence
More informationMicroarray Gene Expression Analysis at CNIO
Microarray Gene Expression Analysis at CNIO Orlando Domínguez Genomics Unit Biotechnology Program, CNIO 8 May 2013 Workflow, from samples to Gene Expression data Experimental design user/gu/ubio Samples
More informationAmerican Society of Cytopathology Core Curriculum in Molecular Biology
American Society of Cytopathology Core Curriculum in Molecular Biology American Society of Cytopathology Core Curriculum in Molecular Biology Chapter 3 Molecular Techniques Alternatives to PCR, Part I
More informationPureSpin DNA Clean Up Kit
PureSpin DNA Clean Up Kit Micro Columns INSTRUCTION MANUAL KIT COMPONENTS For Research Use Only PureSpin DNA Clean Up Kit, Micro Columns w/out Caps (Kit Size) OD2080 (50 Preps.) OD2080-2 (200 Preps.) Storage
More informationExpression Array System
Integrated Science for Gene Expression Applied Biosystems Expression Array System Expression Array System SEE MORE GENES The most complete, most sensitive system for whole genome expression analysis. The
More informationRecombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.
PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?
More informationChapter 20: Biotechnology
Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter
More informationClass Information. Introduction to Genome Biology and Microarray Technology. Biostatistics Rafael A. Irizarry. Lecture 1
This work is licensed under a Creative Commons ttribution-noncommercial-sharelike License. Your use of this material constitutes acceptance of that license and the conditions of use of materials on this
More informationMBios 478: Mass Spectrometry Applications [Dr. Wyrick] Slide #1. Lecture 25: Mass Spectrometry Applications
MBios 478: Mass Spectrometry Applications [Dr. Wyrick] Slide #1 Lecture 25: Mass Spectrometry Applications Measuring Protein Abundance o ICAT o DIGE Identifying Post-Translational Modifications Protein-protein
More informationMMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit
MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit Cat. No. MM070150 Available exclusively thru Lucigen. lucigen.com/epibio www.lucigen.com MA265E MMLV Reverse Transcriptase 1st-Strand cdna Synthesis
More informationAmerican Society of Cytopathology Core Curriculum in Molecular Biology
American Society of Cytopathology Core Curriculum in Molecular Biology American Society of Cytopathology Core Curriculum in Molecular Biology Chapter 3 Molecular Techniques Separation and Detection, Part
More informationBioinformatics III Structural Bioinformatics and Genome Analysis. PART II: Genome Analysis. Chapter 7. DNA Microarrays
Bioinformatics III Structural Bioinformatics and Genome Analysis PART II: Genome Analysis Chapter 7. DNA Microarrays 7.1 Motivation 7.2 DNA Microarray History and current states 7.3 DNA Microarray Techniques
More informationHumboldt Universität zu Berlin. Grundlagen der Bioinformatik SS Microarrays. Lecture
Humboldt Universität zu Berlin Microarrays Grundlagen der Bioinformatik SS 2017 Lecture 6 09.06.2017 Agenda 1.mRNA: Genomic background 2.Overview: Microarray 3.Data-analysis: Quality control & normalization
More informationRecombinant DNA Technology
History of recombinant DNA technology Recombinant DNA Technology (DNA cloning) Majid Mojarrad Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by two scientists
More informationCHAPTER 9 DNA Technologies
CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes
More informationHiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
More informationDNA CHIPS- Technology and Utility
DNA CHIPS- Technology and Utility Yanal Alkuddsi Ph.D Student Dept. of Genetics and Plant Breeding University of Agricultural Sciences Dharwad, Karnataka, India, 580005 1.INTRODUCTION CONTENT 2.MICROARRAYS:
More informationOutline. Analysis of Microarray Data. Most important design question. General experimental issues
Outline Analysis of Microarray Data Lecture 1: Experimental Design and Data Normalization Introduction to microarrays Experimental design Data normalization Other data transformation Exercises George Bell,
More informationFeature Selection of Gene Expression Data for Cancer Classification: A Review
Available online at www.sciencedirect.com ScienceDirect Procedia Computer Science 50 (2015 ) 52 57 2nd International Symposium on Big Data and Cloud Computing (ISBCC 15) Feature Selection of Gene Expression
More informationRNA Clean-Up and Concentration Kit Product # 23600, 43200
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com RNA Clean-Up and Concentration Kit Product # 23600, 43200 Product
More informationGene Regulation Solutions. Microarrays and Next-Generation Sequencing
Gene Regulation Solutions Microarrays and Next-Generation Sequencing Gene Regulation Solutions The Microarrays Advantage Microarrays Lead the Industry in: Comprehensive Content SurePrint G3 Human Gene
More informationZool 3200: Cell Biology Exam 3 3/6/15
Name: Trask Zool 3200: Cell Biology Exam 3 3/6/15 Answer each of the following questions in the space provided; circle the correct answer or answers for each multiple choice question and circle either
More informationCHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning
Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can
More informationMicroarray Technique. Some background. M. Nath
Microarray Technique Some background M. Nath Outline Introduction Spotting Array Technique GeneChip Technique Data analysis Applications Conclusion Now Blind Guess? Functional Pathway Microarray Technique
More informationSOLiD Total RNA-Seq Kit SOLiD RNA Barcoding Kit
SOLiD Total RNA-Seq Kit SOLiD RNA Barcoding Kit Agenda SOLiD Total RNAseq Kit Overview Kit Configurations Barcoding Kit Introduction New Small RNA and WT Workflow Small RNA Workflow Step-by-step Workflow
More informationDNA Microarray Experiments: Biological and Technological Aspects
DNA Microarray Experiments: Biological and Technological Aspects Danh V. Nguyen 1, A. Bulak Arpat 2, Naisyin Wang 1, and Raymond J. Carroll 1 1 Department of Statistics, Texas A&M University, College Station,
More informationReverTra Ace qpcr RT Master Mix
Instruction manual ReverTra Ace qpcr RT Master Mix 1203 F1173K ReverTra Ace qpcr RT Master Mix FSQ-201 200 reactions Store at -20 C Contents [1] Introduction [2] Components [3] Protocol 1. RNA template
More informationNext Gen Sequencing. Expansion of sequencing technology. Contents
Next Gen Sequencing Contents 1 Expansion of sequencing technology 2 The Next Generation of Sequencing: High-Throughput Technologies 3 High Throughput Sequencing Applied to Genome Sequencing (TEDed CC BY-NC-ND
More informationSpotted DNA Array Design. Todd Lowe Bio 210 Jan 13 & 15, 2003
Spotted DNA Array Design Todd Lowe Bio 210 Jan 13 & 15, 2003 Making Your Own Array For Affymetrix-style GeneChips, most labs will use commercially available arrays, so no array design considerations Spotted
More informationEECS730: Introduction to Bioinformatics
EECS730: Introduction to Bioinformatics Lecture 14: Microarray Some slides were adapted from Dr. Luke Huan (University of Kansas), Dr. Shaojie Zhang (University of Central Florida), and Dr. Dong Xu and
More informationSensitivity vs Specificity
Viral Detection Animal Inoculation Culturing the Virus Definitive Length of time Serology Detecting antibodies to the infectious agent Detecting Viral Proteins Western Blot ELISA Detecting the Viral Genome
More informationPre-Lab: Molecular Biology
Pre-Lab: Molecular Biology Name 1. What are the three chemical parts of a nucleotide. Draw a simple sketch to show how the three parts are arranged. 2. What are the rules of base pairing? 3. In double
More informationReal-Time PCR Validations
Real-Time PCR Validations Relative gene expression Example experiment: I have 2 samples: untreated and treated. Question: What happens to the expression of gene X when I treat the cells? Answer: Expressed
More informationAnalysis of Microarray Data
Analysis of Microarray Data Lecture 1: Experimental Design and Data Normalization George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Introduction
More informationResearch school methods seminar Genomics and Transcriptomics
Research school methods seminar Genomics and Transcriptomics Stephan Klee 19.11.2014 2 3 4 5 Genetics, Genomics what are we talking about? Genetics and Genomics Study of genes Role of genes in inheritence
More informationUSB HotStart-IT. for increased specificity and consistent results. PCR, qpcr and qrt-pcr
USB HotStart-IT for increased specificity and consistent results PCR, qpcr and qrt-pcr USB PCR Reagents Choose USB HotStart-IT products for increased specificity and consistent results. Long and Accurate
More informationMicrobial Diversity and Assessment (III) Spring, 2007 Guangyi Wang, Ph.D. POST103B
Microbial Diversity and Assessment (III) Spring, 2007 Guangyi Wang, Ph.D. POST103B guangyi@hawaii.edu http://www.soest.hawaii.edu/marinefungi/ocn403webpage.htm Overview of Last Lecture Taxonomy (three
More informationREAL TIME PCR USING SYBR GREEN
REAL TIME PCR USING SYBR GREEN 1 THE PROBLEM NEED TO QUANTITATE DIFFERENCES IN mrna EXPRESSION SMALL AMOUNTS OF mrna LASER CAPTURE SMALL AMOUNTS OF TISSUE PRIMARY CELLS PRECIOUS REAGENTS 2 THE PROBLEM
More informationGlobin Block Modules for QuantSeq Instruction Manual
Globin Block Modules for QuantSeq Instruction Manual Catalog Numbers: 070 (RS-Globin Block, Homo sapiens, 96 rxn) 071 (RS-Globin Block, Sus scrofa, 96 rxn) 015 (QuantSeq 3 mrna-seq Library Prep Kit for
More informationqpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time
qpcr qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time Differs from endpoint PCR gel on last cycle Used to determines relative amount of template
More informationM Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour
Molecular Cloning Methods Mohammad Keramatipour MD, PhD keramatipour@tums.ac.ir Outline DNA recombinant technology DNA cloning co Cell based PCR PCR-based Some application of DNA cloning Genomic libraries
More informationContents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...
vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface
More informationKit Specifications 45 g. 45 g of RNA 8 L
RNA Clean-Up and Concentration Micro-Elute Kit Product # 61000 Product Insert Norgen s RNA Clean-Up and Concentration Micro-Elution Kit provides a rapid method for the purification, cleanup and concentration
More informationPROTOCOL. MessageAmp II-Bacteria Kit
PROTOCOL MessageAmp II-Bacteria Kit For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice. APPLIED
More informationTECHNICAL BULLETIN. SeqPlex DNA Amplification Kit for use with high throughput sequencing technologies. Catalog Number SEQX Storage Temperature 20 C
SeqPlex DNA Amplification Kit for use with high throughput sequencing technologies Catalog Number SEQX Storage Temperature 20 C TECHNICAL BULLETIN Product Description The SeqPlex DNA Amplification Kit
More informationDNA DNA Profiling 18. Discuss the stages involved in DNA profiling 19. Define the process of DNA profiling 20. Give two uses of DNA profiling
Name: 2.5 Genetics Objectives At the end of this sub section students should be able to: 2.5.1 Heredity and Variation 1. Discuss the diversity of organisms 2. Define the term species 3. Distinguish between
More informationLecture 8: Sequencing and SNP. Sept 15, 2006
Lecture 8: Sequencing and SNP Sept 15, 2006 Announcements Random questioning during literature discussion sessions starts next week for real! Schedule changes Moved QTL lecture up Removed landscape genetics
More informationMicroRNA profiling directly from low amounts of plasma or serum using the Multiplex Circulating mirna Assay with Firefly particle technology
Technical note MicroRNA profiling directly from low amounts of plasma or serum using the Multiplex Circulating mirna Assay with Firefly particle technology Abstract We introduce a new assay that enables
More informationGoals of pharmacogenomics
Goals of pharmacogenomics Use drugs better and use better drugs! People inherit/exhibit differences in drug: Absorption Metabolism and degradation of the drug Transport of drug to the target molecule Excretion
More informationAll your genetic analyses on a single instrument
GENOMELAB GEXP GENETIC ANALYSIS SYSTEM All your genetic analyses on a single instrument GENOMELAB GEXP GENETIC ANALYSIS SYSTEM All on a single instrument Perform your genetic assays on one instrument A
More informationFluorescent in-situ Hybridization
Fluorescent in-situ Hybridization Presented for: Presented by: Date: 2 Definition In situ hybridization is the method of localizing/ detecting specific nucleotide sequences in morphologically preserved
More informationFunctional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017
Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017 Agenda What is Functional Genomics? RNA Transcription/Gene Expression Measuring Gene
More informationRapid Learning Center Presents. Teach Yourself AP Biology in 24 Hours
Rapid Learning Center Chemistry :: Biology :: Physics :: Math Rapid Learning Center Presents Teach Yourself AP Biology in 24 Hours 1/35 *AP is a registered trademark of the College Board, which does not
More information3 Designing Primers for Site-Directed Mutagenesis
3 Designing Primers for Site-Directed Mutagenesis 3.1 Learning Objectives During the next two labs you will learn the basics of site-directed mutagenesis: you will design primers for the mutants you designed
More informationSynthetic Biology for
Synthetic Biology for Plasmids and DNA Digestion Plasmids Plasmids are small DNA molecules that are separate from chromosomal DNA They are most commonly found as double stranded, circular DNA Typical plasmids
More informationQIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd
QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd 1 Our current NGS & Bioinformatics Platform 2 Our NGS workflow and applications 3 QIAGEN s
More informationON-CHIP AMPLIFICATION OF GENOMIC DNA WITH SHORT TANDEM REPEAT AND SINGLE NUCLEOTIDE POLYMORPHISM ANALYSIS
ON-CHIP AMPLIFICATION OF GENOMIC DNA WITH SHORT TANDEM REPEAT AND SINGLE NUCLEOTIDE POLYMORPHISM ANALYSIS David Canter, Di Wu, Tamara Summers, Jeff Rogers, Karen Menge, Ray Radtkey, and Ron Sosnowski Nanogen,
More informationNature Methods: doi: /nmeth Supplementary Figure 1. Retention of RNA with LabelX.
Supplementary Figure 1 Retention of RNA with LabelX. (a) Epi-fluorescence image of single molecule FISH (smfish) against GAPDH on HeLa cells expanded without LabelX treatment. (b) Epi-fluorescence image
More informationPROTOCOL. Amino Allyl MessageAmp II arna Amplification Kit
PROTOCOL Amino Allyl MessageAmp II arna Amplification Kit For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without
More informationmeasuring gene expression December 5, 2017
measuring gene expression December 5, 2017 transcription a usually short-lived RNA copy of the DNA is created through transcription RNA is exported to the cytoplasm to encode proteins some types of RNA
More informationmmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual MyBioSource.com Catalog # MBS826230
mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual Catalog # MBS826230 For the detection and quantification of mirnas mmu-mir-200a-3p normalized by U6 snrna using Real-time RT-PCR
More informationAgilent s Mx3000P and Mx3005P
Agilent s Mx3000P and Mx3005P Realtime PCR just got better Dr. Ivan Bendezu Genomics Agent Andalucia Real-time PCR Chemistries SYBR Green SYBR Green: Dye attaches to the minor groove of double-stranded
More informationChapter 10 Analytical Biotechnology and the Human Genome
Chapter 10 Analytical Biotechnology and the Human Genome Chapter Outline Enzyme tests and biosensors DNA-based tests DNA analysis technologies Human genome and genome-based analytical methods 1 Enzyme-based
More information