DNA
DNA Deoxyribo- Nucleic Acid Shape = Double Helix (twisted ladder) The purpose of each cell having DNA is to have directions for the cell to make proteins
Parts = nucleotide 1. Sugar (deoxyribose) 2. Phosphate 3. Nitrogen base a. Adenine (A) b. Guanine (G) c. Thymine (T) d. Cytosine (C)
Base Pairing A pairs with T C pairs with G The bases are said to be complements
DNA Replication Happens before cells divide Enzymes are used to open up the DNA helix (unwind and unzip) and then add new nucleotides to each template The result is two strands of DNA that are identical to each other
Artificial Replication = PCR Polymerase Chain Reaction (PCR) is used to make copies of a small sample of DNA... good for small amounts of DNA evidence Need: Sample of DNA Enzyme (Taq polymerase) Primer (small piece of DNA to start the reaction) Lots of nucleotides
Why bother with PCR?? This process has been automated so it can be done in a short period of time without human interaction minimizes chance of contamination Copying is exponential and takes about 3-4 minutes per cycle 1 2; 2 4; In one hour at 3 min/cycle you have finished 20 cycles and have 2 20 (1,048,576) strands of DNA!
PCR old vs new
PCR
Restriction Enzymes Enzymes that exist naturally in bacteria and have been isolated and used in DNA procedures In the bacteria the enzymes break apart DNA that might try to invade a bacterial cell. Each enzyme is specific to a particular DNA sequence
Restriction enzymes Scientists use RE to cut DNA at specific points, creating fragments that can then be manipulated Rejoined in GE Separated in DNA fingerprinting
example TCGA AGCT TCGA AGCT TC AG GA CT
ATTCGACGAATTCGGTACCTGACTATGGGAATTCGGTGTACCTCATGTGACTTCGATA TAAGCTGCTTAAGCCATGGACTGATACCCTTAAGCCACATGGAGTACACTGAAGCTAT ATTC (4 base pairs) TAAG GACGAATTCGGTACCTGACTATGGGAATTCGGTGTACCTCATGTGACTTC CTGCTTAAGCCATGGACTGATACCCTTAAGCCACATGGAGTACACTGAAG GATA (4 bpr) CTAT
How does this apply to forensic Restriction enzymes are used in DNA fingerprinting... It cuts the DNA sample into smaller pieces so comparisons can be made science??
Step-by-step description of DNA print analysis 1. A small sample of biological evidence is collected from a. Blood b. Hair (if skin tag is present) c. Saliva d. Semen e. Skin, bone, etc.
Step-by-step 2. The nucleus or mitochondria is extracted which part of the cell is used depends on the type of comparison relationship or identification a. Identification = nuclear b. Relationship = mitochondrial
Step-by-step 3. Chromosomes are isolated 4. Sections of DNA are created using restriction enzymes 5. The fragmented DNA is placed into a well of an electrophoresis gel then placed into the electrophoresis chamber
Step-by-step a. The DNA is placed at the negative end b. The DNA moves to the positive end since DNA has a negative charge c. The DNA is separated into pieces called bands on the basis of its size; the smaller pieces move farther from the wells
6. After the DNA fragments have been separated the DNA print is transferred to a nylon membrane; this is called Southern blotting
7. Radioactive or fluorescent probes are applied to the DNA print on the membrane a. A probe is a small, single strand piece of DNA that complements a specific segment b. The probe will stick to the membrane where it finds its complement; unattached probes will be washed off c. Using a probe focuses the DNA fingerprint 8. The DNA fingerprint is then analyzed looking at the band pattern where the probe is attached
DNA used to identify an individual 1. Variation (get a set of genes from dad and a second set from mom) 2. Mutations these may not always be a problem (won t affect life) but are in areas of the DNA that you don t use; junk DNA
DNA coding... About 5% codes for your traits 99% of the coding DNA (the 5%) is similar in all people; really not useful in identification The remaining 95% (not coding for traits) has a function not yet identified... Useful in identifying individuals because there is a great deal of variation
VNTR = Variable Number Tandem Repeat a sequence of DNA in the junk DNA that is repeated several time. The exact number of repeats varies from one person to the next You may have 14 of a VNTR Your sister may have 20 of the same VNTR Your uncle may have 50 of the same VNTR
STR = short tandem repeat A sequence of 3 8 base pairs Repeats a varying number of times in different individuals Can be combined with PCR to produce a DNA fingerprint from a small sample of DNA evidence There are 13 different STRs considered Multiplexing = PCR with STR primers
http://www.dnai.org/d/index.html
CODIS The database of DNA Used to determine the statistical significance of a DNA fingerprint match Apply the product rule multiply the probabilities of a series of individual events The smaller the value of probability, more discrimination exists between the two individuals
CODIS Based on the data from 13 STRs Not complete not a worldwide database; not ethnically diverse; DNA comes from... Convicted criminals Military personnel Random people
Product Rule 1 in 100 people have a gene for trait A 2 in 50 people have a gene for trait B 1 in 10 people have a gene for trait C 3 in 20 people have a gene for trait D What is the probability of a person having both traits A and B? 1/100 x 2/50... Of having all 4 traits? 1/100 x 2/50 x 1/10 x 3/20 = 1 out of 166,667
Mitochondrial DNA (mtdna) A loop of DNA that is found in each mitochondrion It codes for proteins / enzymes needed in mitochondria It is different than nuclear DNA in its sequence and inheritance Two highly variable regions HV1 and HV2 It is inherited from mom only (comes in the egg)
mtdna Examples Anastasia Argentinian grandmothers Will not necessarily prove identity, but will prove family relationship