ingenio electroporation kits & solution

Similar documents
TransIT-TKO Transfection Reagent

TransIT Transfection Reagent

TransIT -LT1 Transfection Reagent

TransIT -LT1 Transfection Reagent

TransIT -mrna Transfection Kit

Transfection Kit Protocol for MIR 2900, 2904, 2905, 2906

TransIT -293 Transfection Reagent

TransIT -Lenti Transfection Reagent

TransIT -Prostate Transfection Kit

TransIT -BrCa Transfection Reagent

TransIT -LT1 Transfection Reagent

TransIT -CHO Transfection Kit

TransIT -Keratinocyte Transfection Reagent

Transfection Reagent INTRODUCTION SPECIFICATIONS MATERIALS. For Research Use Only. Materials Supplied. Materials required, but not supplied

TransIT -293 Transfection Reagent

TransIT Transfection Reagent

TransIT-PRO Transfection Reagent Protocol for MIR 5740 and 5750

CHOgro Expression System

TransIT -Lenti Transfection Reagent

Nucleic Acid Transfection. Genomics. TransIT Transfection Tools. Technical tip D.103

Product: Arrest-In TM Transfection Reagent for RNAi

ab CFSE Fluorescent Cell Labeling Kit

TransIT -VirusGEN Transfection Reagent

CRISPR/Cas9 Genome Editing: Transfection Methods

User s Guide MegaTran 1.0 Transfection Reagent

NEW! CHOgro Expression System

TOOLS sirna and mirna. User guide

Alt-R CRISPR-Cas9 system:

Convoy TM Transfection Reagent

Xfect Protein Transfection Reagent

jetpei -FluoF in vitro DNA Transfection Protocol

amaxa Peptide Transfection Control 2-3 Product specifications 2 Storage and stability 3 Product use limitations 3 Intended use 3

flashbac Baculovirus Expression Systems flashbac, flashbac GOLD, flashbac ULTRA

sirna Transfection Reagent

YEARS TIO N Transfection Products

Nucleofector technology and transient protein production

Transfection. Transfection Technologies 282. Lipid Transfection Reagents 283. Electroporation Systems and Reagents 284

Transfection. Transfection Technologies 336. Lipid Transfection Reagents 337. Electroporation Systems and Reagents 338

ab Hypoxic Response Human Flow Cytometry Kit

LacZ beta Galactosidase Intracellular Detection Kit

in vivo-jetpei DNA & sirna delivery reagent

jetpei In vitro Transfection Protocol

Plasmid Midiprep Plus Purification Kit. Cat. # : DP01MD-P10/ DP01MD-P50 Size : 10/50 Reactions Store at RT For research use only

Amaxa Cell Line 96-well Nucleofector Kit SF

XactEdit Cas9 Nuclease with NLS User Manual

Amaxa Cell Line 96-well Nucleofector Kit SF

GeneCellin TM Transfection Reagent Protocol

TECHNICAL BULLETIN NUCLEI EZ PREP NUCLEI ISOLATION KIT. Product Number NUC-101 Store at 2-8 C

Amaxa 4D-Nucleofector Protocol for Undifferentiated Human Mesenchymal Stem Cells [MSC] For 4D-Nucleofector X Unit Transfection in suspension

Certified. TransIT Broad Spectrum Transfection Reagents. TransIT-X2. TransIT -LT1. TransIT TransIT -mrna

sirna Transfection Into Primary Neurons Using Fuse-It-siRNA

Amaxa Basic Neuron SCN Nucleofector Kit

Custom RNAi Services. GeneCust Europe. GeneCust Europe

Thermo Scientific Dharmacon SMARTvector 2.0 Lentiviral shrna Particles

ViaFect Transfection Reagent

P HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS

Avalanche -Omni Transfection Reagent

THE DELIVERY EXPERTS PROTOCOL

Transfection Reagents That Really Work

Tropix Chemiluminescent Kits and Reagents For Cell Biology Applications

Alt-R CRISPR-Cpf1 System:

NucleoCounter NC-3000

Confocal immunofluorescence microscopy

jetprime in vitro DNA & sirna transfection reagent PROTOCOL

THE DELIVERY EXPERTS. INTERFERin in vitro sirna transfection reagent PROTOCOL

pdsipher and pdsipher -GFP shrna Vector User s Guide

INTERFERin sirna transfection reagent

CalPhos Mammalian Transfection Kit User Manual

EdU Flow Cytometry Kit. User Manual

INTERFERin in vitro sirna/mirna transfection reagent PROTOCOL

Amaxa Nucleofector Technology. Do you have cells that are difficult-to-transfect?

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,

SureSilencing sirna Array Technology Overview

Nucleofector Technology in. Somatic Stem Cell Research. gene transfer begins here

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit

Transfection. How do you study and control gene expression? How do you detect mycoplasma contamination?

Leading the charge for all electroporation applications. phone toll free HARVARD APPARATUS

Mitochondrial DNA Isolation Kit

Total Histone H3 Acetylation Detection Fast Kit (Fluorometric)

ab CytoPainter ER Staining Kit Red Fluorescence

sirna delivery systems: lipoplexes vs. polyplexes

Cignal Reporter Assay Handbook

SANTA CRUZ BIOTECHNOLOGY, INC.

For Research Use Only Ver

AmpliScribe T 7 Aminoallyl-RNA Transcription Kit

E.Z.N.A. Water DNA Kit. D preps D preps D preps

MagListo 5M Nucleic Acid Extraction Kit MagListo Magnetic Separation Rack

High Pure PCR Template Preparation Kit for preparation of 100 nucleic acid samples Cat. No

Supporting Information

Pre-made Lentiviral Particles for Nuclear Permeant CRE Recombinase Expression

Comparison of Commercial Transfection Reagents: Cell line optimized transfection kits for in vitro cancer research.

Chariot. Simple, efficient protein delivery. (version 01/02) Catalog Nos & 30100

FectoPRO DNA transfection kit for Bioproduction PROTOCOL

Leading the charge. for all electroporation applications. phone toll free

DNA Extraction Kit INSTRUCTION MANUAL. Catalog # Revision B. For In Vitro Use Only

LDH-Cytox Assay Kit. A Colorimetric Cytotoxicity Measuring Kit. Cat. No LDH-Cytox Assay Kit can be used to measure cytotoxicity in vitro

sirna transfection optimization with the Agilent 2100 bioanalyzer Application Note A new method for effective gene silencing

TurboFect in vitro Transfection Reagent. Description. Storage. Reagents to be Supplied by the User. #R ml ( for in vitro transfections)

For identifying inhibitors and activators of mitochondrial biogenesis in adherent cultured cells.

ab BrdU Immunohistochemistry Kit

Transcription:

ingenio electroporation kits & solution

Electroporation x DEFINITION and OPTIMIZATION What is ELECTROPORATION? Electroporation is a physical method of nucleic acid transfer wherein the cells and nucleic acids are subjected to high voltage electric pulses. This process induces temporary pores in the cell membrane, enabling entry of nucleic acids into the cell. Electroporation is often used to deliver nucleic acids to cells resistant to chemical transfection. sirna or Duplex mirna Cells Electroporation Cuvette 2 1 Electropermeabilized cell membrane 3 Electroporation x Definition AND Optimization DNA Large RNA 2 3 1 2 3 1 Electroporation Cuvette 4 Nucleus Cytoplasm Figure 1. Electroporation of Eukaryotic Cells. 1. Cells and nucleic acid are combined in an electroporation cuvette. 2. High voltage electric shock permeabilizes the cell membrane. 3. Nucleic acids pass through temporary pores formed in the cell membrane (sirna, mirna or large RNA are generally active in cytoplasm). 4. DNA must localize to the nucleus where its gene expression cassette is transcribed. 5. Membrane integrity is restored (not shown). Optimize Electroporation Performance For All Instruments, Cells and Nucleic Acids 1. Nucleic acid purity. Use highly purified, sterile, and contaminant-free nucleic acid. Endotoxin-free nucleic acid (bacterial lipopolysaccharide-free) is recommended. Do not use nucleic acid that has been purified using ethanol precipitation. Residual salt from ethanol precipitation methods can negatively affect electroporation. Do not use nucleic acid that has been purified using minipreps. 2. Nucleic acid concentration. Use DNA stocks that range from 1 to 5 mg/ml. Use of stocks with higher concentrations may lead to non-uniform mixing with cells. Use of stocks with lower concentrations may dilute the electroporation mix. Use optimal amounts of nucleic acid for each cell type. 3. Divide cells regularly. Maintain cells such that they are actively growing. Divide the cell culture one day before electroporation as needed. This step may not be required for slow-growing or primary cells. 4. Cell passage number. Use of very low or very high passage cells may affect experimental results. Use cells of similar passage number for experimental reproducibility. 2 FOR PRODUCT INFORMATION % toll free 888.530.0801 % direct 608.441.2852 % www.mirusbio.com

Electroporation x products and applications 5. Post-electroporation incubation time. Determine the optimal incubation time post-electroporation for each cell type and electroporated construct. Test a range of incubation times. The optimal incubation time is generally 12 72 hours, but will vary depending on the goal of the experiment and the electroporated nucleic acid. 6. Titration of pulse conditions for cell types. General pulse conditions for most cells fall within a voltage range of 80 160 V for 0.2 cm or 200 300 V for 0.4 cm cuvettes and a capacitance range of 800 1,000 µf. It is important to try a variety of pulse types (Exponential Decay/Square Wave/Time Constant) within these ranges to optimize best conditions for each cell type. 7. Vary cell density and DNA concentration. When optimizing your electroporations, test different cell densities ranging from 2 10 6 to 1 10 7 cells/ml and test DNA concentrations ranging from 10 30 µg/ml. Transfection Products & Applications Application Product Page Nucleic acid electroporation to a wide range of cell types to express a specific gene or transcript Simultaneous visualization of electroporated plasmid and expression of transgene sirna labeling, electroporation, localization and knockdown Ingenio Electroporation Kits & Solution 4-5 Label IT Tracker Intracellular Nucleic Acid Localization Kits Label IT sirna Tracker Intracellular Nucleic Acid Localization Kits Electroporation efficiency assessment Label IT Delivery Controls 8-9 In situ analysis of ß-galactosidase expression in cells Beta-Galactosidase Staining Kit 11 Removal of endotoxin from DNA samples to improve electroporation performance MiraCLEAN Endotoxin Removal Kit 10 6 7 Electroporation xproducts and applications FOR PRODUCT INFORMATION % toll free 888.530.0801 % direct 608.441.2852 % www.mirusbio.com 3

Electroporation x Kits and Solution Ingenio Electroporation Products Electroporation x Kits and Solution x High Efficiency Electroporation of Hard to Transfect Cells Conduct research in biologically relevant cells x Compatible with All Electroporation Instruments Use your existing system including an amaxa Nucleofector ; no need to purchase additional specialized equipment x Save Money Replace your amaxa Nucleofector Kits with the Ingenio Electroporation Kit and realize significant savings without sacrificing performance x Buy Only What You Need Ingenio Electroporation Solution is available alone or as part of a complete kit with cuvettes and cell droppers x Higher Cell Viabillity Less cell death than other electroporation solutions Mirus Bio has developed the Ingenio Electroporation Solution to facilitate efficient and reliable delivery of nucleic acids to eukaryotic cells resistant to chemical transfection. Ingenio is a broad spectrum solution that supports high efficiency electroporation with minimal toxicity. It replaces standard electroporation solutions including phosphate buffered saline and serumfree media. Ingenio is compatible with multiple instruments and facilitates a wide range of applications requiring nucleic acid delivery to cells. The Ingenio Solution is available alone and as part of a kit with cuvettes and cell droppers. Ingenio Electroporation Kits (solution, 0.4 cm cuvettes, cell droppers) Product No. MIR 50113 MIR 50116 MIR 50119 Size 25 RXN a 50 RXN a 100 RXN a Ingenio Electroporation Kits (solution, 0.2 cm cuvettes, cell droppers) Product No. MIR 50112 MIR 50115 MIR 50118 Ingenio Electroporation Solution Size 25 RXN a 50 RXN a 100 RXN a Product No. Size Quantity MIR 50111 25 RXN b MIR 50114 50 RXN b MIR 50117 100 RXN b 6.25 ml 12.5 ml 25 ml Ingenio Electroporation Accessories Product No. DESCRIPTION SIZE MIR 50120 0.2 cm Cuvettes 25 PK MIR 50121 0.2 cm Cuvettes 50 PK MIR 50122 0.4 cm Cuvettes 25 PK MIR 50123 0.4 cm Cuvettes 50 PK MIR 50124 Cell Droppers MIR 50125 Cell Droppers a Electroporations per kit. b Number of electroporations in 0.4 cm cuvette. 25 PK 50 PK Ingenio Electroporation Solution May also contain cuvettes and cell droppers Store Ingenio Electroporation Solution at 4 C Store all other components at room temperature 4 FOR PRODUCT INFORMATION % toll free 888.530.0801 % direct 608.441.2852 % www.mirusbio.com

Electroporation x Kits and Solution Percent EGFP Positive Cells Percent EGFP Positive Cells 100 80 60 40 20 0 80 60 40 20 0 HL-60 K-562 Jurkat E6-1 SK-N-MC Ingenio Solution using Gene Pulser Ingenio Solution using amaxa Nucleofector amaxa Nucleofector Solution V on amaxa Nucleofector Ingenio Electroporation Solution PBS HL-60 K-562 Jurkat E6-1 SK-N-MC Gene Pulser Electroporation Buffer Figure 2. Ingenio Solution Provides Comparable Efficiency on amaxa's Nucleofector Device. Cells were electroporated in parallel with an EGFP reporter vector. Two electroporators were used with different electroporation kits: the Ingenio Electroporation Kit was used in the Gene Pulser Xcell Eukaryotic System (Bio-Rad) and the amaxa Nucleofector II Device (Lonza); the amaxa Nucleofector Kit V was used in the amaxa Nucleofector II Device, all according to manufacturer's recommendations. EGFP expressing cells were identified 24 hours post-electroporation by flow cytometry and presented as a percentage of the live cell population. Experiments were performed in triplicate on three separate days and the data averaged. Figure 3. Ingenio Solution Outperforms Other Electroporation Reagents. Cells were electroporated in parallel with an EGFP reporter vector using either Ingenio Electroporation Solution, PBS or the Gene Pulser Electroporation Buffer (Bio-Rad) on the Gene Pulser Xcell Eukaryotic System. EGFP expressing cells were identified 24 hours post-electroporation by flow cytometry and presented as a percentage of the live cell population. Experiments were performed in triplicate on three separate days and the data averaged. Electroporation x Kits and Solution Percent Propidium Iodide Negative Cells 100 80 60 40 20 HL-60 K-562 Jurkat E6-1 SK-N-MC Figure 4. High Cell Viability with Ingenio Solution. DNA was electroporated into cells using either Ingenio Electroporation Solution, PBS or Gene Pulser Electroporation Buffer (Bio-Rad) and the Gene Pulser Xcell Eukaryotic System. Twenty-four hours post-electroporation, cells were assayed for viablility by propidium iodide staining and flow cytometry analysis. Experiments were performed in triplicate on three separate days and the data averaged. 0 Ingenio Electroporation Solution PBS Gene Pulser Electroporation Buffer FOR PRODUCT INFORMATION % toll free 888.530.0801 % direct 608.441.2852 % www.mirusbio.com 5

Electroporation x IMAGING and DNA LOCALIZATION Label IT Tracker Intracellular Nucleic Acid Localization Kits x Superior Tracking and Expression Monitor both subcellular localization and reporter transgene expression following delivery of labeled plasmid DNA x Versatile Labeling Efficiently label and visualize the DNA of your choice Label IT Tracker Intracellular Nucleic Acid Localization Kits without TransIT -LT1 Transfection Reagent Electroporation x IMAGING and LOCALIZATION x One-step Chemical Method Easily and precisely control the labeling reactions x High Efficiency Labeling Optimal visualization of DNA in cells The Label IT Tracker Intracellular Nucleic Acid Localization Kits provide a convenient approach to directly label plasmid DNA. Both subcellular localization and reporter transgene expression can be monitored simultaneously following electroporation or in vivo delivery of the labeled plasmid. For your convenience, Label IT Tracker Intracellular Nucleic Acid Localization Kits are also available with the TransIT-LT1 Transfection Reagent. Figure 5. Simultaneous Detection of Intracellular Localization and Transgene Expression. CHO-K1 cells were electroporated in Ingenio Electroporation Solution with Label IT Tracker Cy 3 (red) labeled peyfp (yellow). Twenty-four hours post electroporation cells were washed, fixed and counterstained to identify the nucleic (blue). The image was acquired using a confocal microscope. LABEL Product NO. Size* Cy 3 MIR 7020 50 200 µg Cy 5 MIR 7021 50 200 µg Fluorescein MIR 7025 50 200 µg CX-Rhodamine MIR 7022 50 200 µg TM-Rhodamine MIR 7023 50 200 µg Biotin MIR 7024 50 200 µg Label IT Tracker Reagent Reconstitution Solution Labeling Buffer A Store Label IT Reagent as a dry pellet or as a reconstituted solution at 20 C Store all other components at 4 C Label IT Plasmid Delivery Controls Ingenio Electroporation Kits & Solution TransIT -LT1 Transfection Reagent Label IT Tracker Intracellular Nucleic Acid Localization Kits with TransIT -LT1 Transfection Reagent 6 FOR PRODUCT INFORMATION % toll free 888.530.0801 % direct 608.441.2852 % www.mirusbio.com

Electroporation x IMAGING and sirna LOCALIZATION Label IT sirna Tracker Intracellular Nucleic Acid Localization Kits x Superior Tracking and Functionality Monitor both subcellular localization and functionality of your sirna following transfection x High Efficiency Labeling Optimal visualization of sirna in cells x One-step Chemical Method Easily and precisely control the labeling density The Label IT sirna Tracker Intracellular Localization Kits provide a straightforward approach to directly label sirna. Intracellular localization and functional inhibition of target gene expression can be monitored following electroporation or in vivo delivery of the labeled sirna. For your convenience, Label IT sirna Tracker Kits are also available with either TransIT-TKO or TransIT-siQUEST sirna Transfection Reagents. Figure 7. Labeling of sirna with Label IT sirna Tracker Does Not Affect Functionality. TransIT-TKO Transfection Reagent was used to transfect anti-firefly luciferase sirna into CHO-luc cells that stably express firefly luciferase. The sirna was either unlabeled or labeled with Label IT sirna Tracker Cy 3, Cy 5, Fluorescein, or CX Rhodamine Reagents. Bars indicate the percent firefly luciferase expression 24 hours after delivery of 5 nm anti-firefly luciferase sirna. Figure 6. Visualization of Electroporated Label IT sirna Tracker Cy 3-labeled sirna. CHO-K1 cells were electroporated using Ingenio Electroporation Solution with Label IT sirna Tracker Cy 3-labeled sirna (red). Twenty-four hours postelectroporation, cells were washed, fixed and counterstained to identify the nuclei (blue) and actin (green). The image was acquired using a confocal microscope. % Target Gene Expression 100 90 80 70 60 50 40 30 20 10 0 TransIT-TKO Reagent Alone Unlabled Cy 3 Cy 5 Labeled sirna Fluorescein CX-Rhodamine Label IT sirna Tracker Intracellular Localization Kits without Transfection Reagent LABEL Product NO. Size Cy 3 MIR 7212 50 µg Cy 5 MIR 7213 50 µg Fluorescein MIR 7216 50 µg CX-Rhodamine MIR 7214 50 µg TM-Rhodamine MIR 7215 50 µg Biotin MIR 7217 50 µg Label IT sirna Tracker Reagent Reconstitution Solution Labeling Buffer A sirna Dilution Buffer Store Label IT Reagent as a dry pellet or as a reconstituted solution at 20 C Store all other components at 4 C Label IT RNAi Delivery Controls TransIT-TKO Transfection Reagent TransIT-siQUEST Transfection Reagent Label IT sirna Tracker Intracellular Nucleic Acid Localization Kits with TransIT-TKO or TransIT-siQUEST Transfection Reagent Electroporation x imaging and sirna localization FOR PRODUCT INFORMATION % toll free 888.530.0801 % direct 608.441.2852 % www.mirusbio.com 7

Electroporation accessories x dna localization controls Label IT Plasmid Delivery Controls Electroporation accessories x dna localization controls x Compatible with Any Delivery Technology Electroporate using any electroporator or deliver in vivo and easily detect labeled plasmid in cells by fluorescent microscopy x Inert Co-deliver any unlabeled nucleic acid without affecting activity of the co-delivered nucleic acid x Easy to Use Supplied as a ready to use 0.5 mg/ml solution x Convenient Use as a positive labeled control with other Label IT Kits The Label IT Plasmid Delivery Controls consist of either a Cy 3 or a fluorescein labeled 2.7 kb plasmid for assessment of delivery efficiency in mammalian cells or as a positive control with other Label IT Kits. Figure 8. Label IT Cy 3 Plasmid Delivery Control Allows Quick Assessment of Electroporation Efficiency. CHO-K1 cells were electroporated in Ingenio Electroporation Solution with Label IT Cy 3 Plasmid Delivery Control (red). Twenty-four hours post-electroporation, cells were washed, fixed and counterstained to identify the nuclei (blue) and actin (green). The image was acquired using a confocal microscope. Label IT Plasmid Delivery Controls LABEL Product No. Quantity Cy 3 MIR 7904 10 µg MIR 7905 100 µg Fluorescein MIR 7906 10 µg MIR 7907 100 µg Label IT Plasmid Delivery Control Store at 20 C Label IT Tracker Intracellular Nucleic Acid Localization Kits Ingenio Electroporation Kits & Solution TransIT Transfection Reagents Label IT Nucleic Acid Labeling Kits 8 FOR PRODUCT INFORMATION % toll free 888.530.0801 % direct 608.441.2852 % www.mirusbio.com

Electroporation accessories x sirna localization controls Label IT RNAi Delivery Controls x Compatible with Any Delivery Technology Electroporate using any electroporator or deliver in vivo and easily detect labeled RNAi Control in cells by fluorescent microscopy x Inert Does not target any known mammalian genes or cause off target effects x Compatible Co-deliver with any functional sirna without affecting knockdown activity of the sirna x Easy to Use Supplied as a ready to use 10 µm solution with an RNAi Dilution Buffer x Convenient Use as a positive labeled control with other Label IT Kits The Label IT RNAi Delivery Controls consist of either Cy 3 or fluorescein labeled RNA duplex that has the same length, charge and configuration as standard sirna. The sequence of the Label IT RNAi duplex is inert and is not known to affect any cellular events. These controls are designed to facilitate assessment of delivery efficiency of dsrna oligonucleotides in both in vitro and in vivo applications and can be co-delivered with a functional target gene-specific sirna. Label IT RNAi Delivery Controls LABEL Product No. Quantity Cy 3 MIR 7900 10 µg MIR 7901 100 µg Fluorescein MIR 7902 10 µg MIR 7903 100 µg Label IT RNAi Delivery Control 10X RNAi Dilution Buffer Store both components at 20 C Label IT sirna Tracker Intracellular Localization Kits Ingenio Electroporation Kits & Solution TransIT-TKO Transfection Reagent TransIT-siQUEST Transfection Reagent Label IT Nucleic Acid Labeling Kits Electroporation accessories x sirna localization controls Figure 9. Visualization of Label IT RNAi Delivery Control. HeLa cells were transfected in complete medium with the Label IT Fluorescein RNAi Delivery Control (green) using the TransIT-TKO Transfection Reagent. Twenty-four hours post-transfection, the cells were fixed then counterstained to locate the nuclei (blue) and actin (red). The image was acquired using a confocal microscope. Figure 10. Visualization of Label IT Cy 3 RNAi Delivery Control in Liver Sections Following Tail Vein Injection. TransIT -QR Delivery Solution was used to deliver 25 µg of Label IT Cy 3 RNAi Delivery Control (red) to a mouse using hydrodynamic delivery via the tail vein. Forty-five minutes post-injection the liver was harvested. Sections were fixed and counterstained to locate the nuclei (blue) and actin (green). The image was acquired using a confocal microscope. FOR PRODUCT INFORMATION % toll free 888.530.0801 % direct 608.441.2852 % www.mirusbio.com 9

Electroporation accessories x endotoxin removal MiraCLEAN Endotoxin Removal Kit Electroporation accessories x endotoxin removal x Effectively Removes Endotoxin from Plasmid DNA Samples Aids in the safety and efficiency of gene delivery research x Compatible with In Vitro and In Vivo Applications Removes harmful endotoxin that can decrease electroporate efficiencies in vitro and induce inflammatory reactions in vivo x Easy to Use Simple separation protocol with colored extraction reagent allows quick visualization of phase separation The MiraCLEAN Endotoxin Removal Kit is a rapid and efficient kit for the removal of endotoxins (bacterial lipopolysaccharides) from DNA before electroporation, transfection or injection into an animal host. The presence of endotoxins in a DNA sample can decrease electroporation efficiency and induce cell death or cause endotoxic shock and death in animals. Luciferase Expression (ng) 30 25 20 15 10 5 0 Commercial Plasmid (35 EU/mg) Crude Plasmid (11,635 EU/mg) Crude Plasmid with 3 Rounds of MiraCLEAN Treatment (10 EU/mg) Product No. Size* Quantity MIR 5910 10 mg DNA Each MIR 5900 100 mg DNA Each * Amount of DNA purified with each kit. EndoGO Extraction Reagent MiraCLEAN Buffer Store both components at 4 C, Do Not Freeze Ingenio Electroporation Kits & Solution TransIT -LT1 Transfection Reagent TransIT Cell Line Specific Transfection Reagents Figure 11. Endotoxin Removal from Plasmid DNA Improves Expression. COS-7 cells were transfected with the indicated plasmid DNA using TransIT -LT1 Transfection Reagent. Cells were harvested 24 hours post-transfection and assayed for luciferase activity (1 ng of lipopolysaccharide = 1 10 EU). 10 FOR PRODUCT INFORMATION % toll free 888.530.0801 % direct 608.441.2852 % www.mirusbio.com

Electroporation accessories x beta-gal staining Beta-Gal Staining Kit x Compatible with In Vitro and In Vivo Applications Efficiently identifies b-galactosidase expressing cells both in vitro and in vivo x Easy to Use Fast staining process allows accurate visualization of in situ b galactosidase expression The Beta-Gal Staining Kit is a simple and efficient kit for the detection of b galactosidase expressing cells. This kit can be used to determine electroporation efficiency by identifying b-galactosidase expressing cells after delivery of a b-galactosidase expression vector. Product No. Size* Quantity MIR 2600 100 Each * Number of b-galactosidase stainings in 6 well plates or 35 mm dishes. Cell Fixative Reagent Cell Staining Solution X-GAL Reagent Store Cell Fixative Reagent at 4 C Store Cell Staining Solution at 4 C Store X-GAL Reagent at 20 C Ingenio Electroporation Kits & Solution TransIT -LT1 Transfection Reagent TransIT Cell Line Specific Transfection Reagents TransIT -mrna Transfection Kit Electroporation accessories x beta-gal staining lacz mrna Transfection Transfection Control Figure 12. Detection of b-galactosidase Expression in CHO-K1 Cells Transfected with a lacz mrna. CHO-K1 cells were transfected with an in vitro synthesized lacz mrna using the TransIT -mrna Transfection Kit. Cells were stained 18 hours posttransfection with the Beta-Gal Staining Kit to detect b galactosidase activity. FOR PRODUCT INFORMATION % toll free 888.530.0801 % direct 608.441.2852 % www.mirusbio.com 11

Electroporation x PRODUCT INFORMATION Electroporation x PRODUCT INFORMIATION Electroporation Kits & Solution Product Name product No. Size Quantity Ingenio Electroporation Kits MIR 50113 25 Reactionsª (solution, 0.4 cm cuvettes, MIR 50116 50 Reactionsª cell droppers) MIR 50119 100 Reactionsª Ingenio Electroporation Kits MIR 50112 25 Reactionsª (solution, 0.2 cm cuvettes, MIR 50115 50 Reactionsª cell droppers) MIR 50118 100 Reactionsª Ingenio Electroporation MIR 50111 25 Reactions b 6.25 ml Solution MIR 50114 50 Reactions b 12.5 ml MIR 50117 100 Reactions b 25 ml Ingenio Electroporation MIR 50120 0.2 cm Cuvettes 25 Pack Accessories MIR 50121 0.2 cm Cuvettes 50 Pack MIR 50122 0.4 cm Cuvettes 25 Pack MIR 50123 0.4 cm Cuvettes 50 Pack MIR 50124 Cell Droppers 25 Pack MIR 50125 Cell Droppers 50 Pack ª Electroporation per kit. b Number of electroporations in 0.4 cm cuvette. Cellular Imaging & DNA Localization Kits without TransIT -LT1 Transfection Reagent Product Name product No. Quantity*. Label IT Tracker Cy 3 Kit MIR 7020 labels 50-200 μg Label IT Tracker Cy 5 Kit MIR 7021 labels 50-200 μg Label IT Tracker Fluorescein Kit MIR 7025 labels 50-200 μg Label IT Tracker CX-Rhodamine Kit MIR 7022 labels 50-200 μg Label IT Tracker TM-Rhodamine Kit MIR 7023 labels 50-200 μg Label IT Tracker Biotin Kit MIR 7024 Labels 50-200 μg Cellular Imaging & sirna Localization Kits without TransIT-TKO Transfection Reagent Product Name product No. Quantity Label IT sirna Tracker Cy 3 Kit MIR 7212 labels 50 μg Label IT sirna Tracker Cy 5 Kit MIR 7213 labels 50 μg. Label IT sirna Tracker CX-Rhodamine Kit MIR 7214 labels 50 μg Label IT sirna Tracker TM-Rhodamine Kit MIR 7215 labels 50 μg Label IT sirna Tracker Fluorescein Kit MIR 7216 labels 50 μg Label IT sirna Tracker Biotin Kit MIR 7217 Labels 50 μg Labeled Plasmid Delivery Controls Product Name product No. Quantity. Label IT Plasmid MIR 7904 10 μg Delivery Control, Cy 3 MIR 7905 100 μg Label IT Plasmid MIR 7906 10 μg Delivery Control, Fluorescein MIR 7907 100 μg Labeled RNAi Delivery Controls Product Name product No. Quantity. Label IT RNAi MIR 7900 10 μg Delivery Control, Cy 3 MIR 7901 100 μg Label IT RNAi MIR 7902 10 μg Delivery Control, Fluorescein MIR 7903 100 μg Endotoxin Removal Product Name product No. Quantity. MiraCLEAN Endotoxin MIR 5910 10 mg DNA Removal Kit MIR 5900 100 mg DNA Beta-Gal Staining Product Name product No. Quantity. Beta-gal Staining Kit MIR 2600 100* * Number of ß-galactosidase stainings in 6-well plates or 35 mm dishes. Broad Spectrum DNA Transfection Product Name product No. Quantity TransIT -LT1 MIR 2300 1 ml Transfection Reagent MIR 2304 0.4 ml MIR 5305 5 x 1 ml MIR 5306 10 x 1 ml sirna & mirna Transfection Product Name product No. Quantity TransIT-TKO MIR 2150 1 ml Transfection Reagent MIR 2154 0.4 ml MIR 5155 5 x 1 ml MIR 5156 10 x 1 ml TransIT-siQUEST MIR 2110 1 ml Transfection Reagent MIR 2114 0.4 ml MIR 5115 5 x 1 ml MIR 5116 10 x 1 ml For questions contact the Mirus Bio Technical Support Team: Toll Free (U.S. Only): 888.530.0801 E-mail: techsupport@mirusbio.com EPBR11/2008 BN1126081 FOR PRODUCT INFORMATION % toll free 888.530.0801 % direct 608.441.2852 % www.mirusbio.com