Name First Last PD Number - (Pease Print) HOUR EXAM BOLOGY 108 FALL, 2003 n the spirit of the honor code, pedge that have neith 1 Signature 2 3 4 5 6 7 8 9 10
1. (10 points) From the foowing ist circe a of the components required for transation in E. coi. (Note that points wi be subtracted for incorrect answers). RNA poymerase ribosomes mrna trna ATP GTP datp,dttp,dctp,dgtp DNA poymerase amino acids igase reverse transcriptase aminoacy-trna synthase DNA poymerase ribosomes initiation factors RNA-dependent poymerase peptidogycan gucose eongation factors sigma factor termination factors primase heicase singe-stranded DNA binding protein DNA From the foowing ist circe a of the components required for repication of DNA in E. coi. (Note that points wi be subtracted for incorrect answers). RNA poymerase ribosomes mrna trna ATP GTP datp,dttp,dctp,dgtp DNA poymerase amino acids igase reverse transcriptase aminoacy-trna synthase DNA poymerase initiation factors RNA-dependent poymerase peptidogycan gucose eongation factors sigma factor termination factors primase heicase singe-stranded DNA binding protein DNA 2. (6 points) n answering the questions beow ist as many proteins as are necessary; if none are required state Anone@. What proteins does a bacterium require for the transcription of vegetative genes? What virus-encoded proteins does poio require for the transcription of its genes? What virus encoded proteins does T7 need for transcription of ate genes?
3. (14 points) RNA viruses that grow in pant or anima ces have to sove the probem that eukaryotic ces generay ony make one protein using one piece of mrna. Different viruses have used different strategies to circumvent this probem. Describe the strategy used by tobacco mosaic virus (a tobamo virus). Describe the strategy used by infuenza virus.
Use the foowing information for the remainder of the questions on the exam. amino acids vitamins sugars antibiotics threonine (thr) biotin (bio) gucose (gu) streptomycin (sm) eucine (eu) thiamine (thi) actose (ac) rifampicin (rif) histidine (his) matose (ma) ampiciin (amp) tryptophan (trp) arabinose (ara) arginine (arg) tetracycine (tet) 4. ( 9 points) You perform an conjugation between two E. coi strains with the foowing genotypes: F - : sm R, thr -, his -, thi -, ma -, ac + Hfr : sm S, thr +, his +, thi +, ma +, ac + You have avaiabe the ingredients isted above as we as minima medium and compex medium. What medium woud you use to seect transconjugants of each of the foowing genotypes? thr + ma + thi +
5. (9 points)you perform an interrupted mating between two E. coi strains with the foowing genotypes: F - : rif R arg -, eu -, thi -, ara - Hfr : rif S arg +, eu +,thi +, ara + The conjugates are pated on the foowing minima media at the times indicated: Media 1: eu, thi, gu, rif Media 2: arg, eu, gu, rif Media 3: arg, thi, eu, ara, rif Time of interrupted # of coonies Mating Media 1 Media 2 Media 3 5 min 0 0 0 10 min 0 0 4 15 min 2 9 24 20 min 12 26 44 30 min 32 56 84 Graph these data on the suppied graph paper. Be sure to abe the axes and to indicate which ine represents which data. Given the above data abe the order of gene transfer beow (1 st, 2 nd, or 3 rd ): arg thi ara What is the time of transfer of each gene (in min.)? arg thi ara
6. ( 10 points)you wish to determine the gene order and reative distances of three genes from E. coi. You prepare DNA from E. coi which is his - thi + ma + and use it to transform E. coi which is his + thi - ma -. You seect for ces which are thi + or ma + and test them for the abiity to make a his or thi, or to grow on matose. You obtain the foowing resuts: Seected marker Percentage of seected ces which are his + thi + ma + thi + 80 100 30 ma + 30 30 100 Draw a diagram to show the gene order and reative positions What medium did you use to test whether the thi + bacteria are his +? Why didn=t you pace the origina transformation on media to seect for his + ces
For the next two questions you have a of the foowing avaiabe: competent E. coi ac - your bacterium competent your bacterium DNA of pasmid pugh, which contains an origin of repication recognized by E. coi but not by your bacterium and a transposon Tn5 which encodes sm R pasmid p108 restriction enzymes and a other necessary enzymes and sma moecues and buffers X-ga the toxic chemica minima medium compex medium a of the chemicas, etc. isted on page wheat pants and medium in which to grow them _ phage mice 7. (9 points)you find a bacterium which can grow on a toxic chemica (using it as a carbon source) in the soi at a superfund site. You are interested to identify the genes required for growth on this chemica and decide to use transposon mutagenesis to identify these genes. Given the foowing things, fi in the banks in a protoco for transposon mutagenesis that wi enabe you to find these genes. Fi in the banks in the protoco beow for isoating transposon mutants of your bacterium which are unabe to grow on the toxic chemica. 1. ntroduce into by (process) 2. Grow the resut on medium containing. 3. To identify mutants which can no onger grow on the toxic chemica do the foowing: 4. n step 2, you are seecting/screening (circe one) for bacteria which carry the transposon 5. n step 3, you seecting/screening (circe one) for the particuar mutants you wish to obtain. 8. (14 points) Your ab partner has the same materias avaiabe in her ab. She decides to use gene coning instead of transposon mutagenesis to try to find the genes required for growth on the toxic chemica. Fi in the missing steps in her protoco.
1. 1. soate from and digest it with. Do a partia or compete (circe one) digest. 2. soate from and digest it with. Do a partia or compete (circe one) digest. 3. Mix the products of #s 1 and 2 and add (enzyme). 4. the product of # 3 into (ces). 5. Pate the resuting ces on medium containing. Keep the coonies. These coonies contain the genes required for growth on the toxic chemica.
9. (11 points) You are doing a survey of various strains of a bacterium which can produce a toxin. You wish to determine which isoated carry the toxin gene. For this purpose you decide to use pcr. You have sequenced the toxin gene from strain 1. The partia sequence is shown beow: 5'ATGCCGTGGCAGGACTTCGC...GTGCAGCGATTGCGCATTGCC 3' 3' TACGGCACCGTCCTGAAGCG...CACGTCGCTAACGCGTAACGG 5' The dots represent the midde of the gene. Given the foowing materias fi the protoco shown for obtaining the DNA encoding the gene by pcr from your various strains. oigonuceotide 1 5'ATGCCGTGGCAGGACTTCGC 3' oigonuceotide 2 5' GTGCAGCGATTGCGCATTGCC 3' oigonuceotide 3 3' TACGGCACCGTCCTGAAGCG 5' oigonuceotide 4 3' CACGTCGCTAACGCGTAACGG 5' your strains of bacteria igase competent E. coi ATP GTP E. coi DNA poymerase Thermobacterium aquaticus DNA poymerase datp,dctp, dgtp, dttp ATP, GTP, CTP, UTP buffers, etc. a heating bock with a programabe temperature contro 1. Extract and purify from. 2. Add to the purified materia the foowing :. 3. Program the heating bock to repeat the foowing cyce about 30 times: and incubate your reactions in the heat bock.
You now have your pcr products and decide to anayze them using ge eectrophoresis. You obtain the foowing resuts: strai n - + Where the represent the we where the sampe was appied to the ge and represents the stained DNA band observed. Remember that strain 1 was the strain from which the DNA sequence was obtained. What can you say about the toxin gene in strains 2, 3, 7, and 8? What can you say about the toxin gene in strain 4? What can you say about the toxin gene in strain 5? What can you say about the toxin gene in strain 6?