O C. 5 th C. 3 rd C. the national health museum

Transcription

1 Elements of Molecular Biology Cells Cells is a basic unit of all living organisms. It stores all information to replicate itself Nucleus, chromosomes, genes, All living things are made of cells Prokaryote, Eukaryote Human genome is around 3 billions base pair long Almost every cell in human body contains same set of genes But not all genes are used or expressed by those cells Terminology Genome is an organism s complete set of DNA. a bacteria contains ~ 600,000 DNA base pairs human and mouse genomes have some 3 billion. Chromosomes Human genome has 24 distinct chromosomes. Each chromosome contains many genes. Gene basic physical and functional units of heredity. specific sequences of DNA bases that encode instructions on how to make proteins. Genotype: : Genetic makeup of an organism Phenotype: : Physical expressed traits of an organism Elements of Molecular Biology All Life depends on 3 critical molecules DNA Hold information on how cell works RNA Act to transfer short pieces of information to different parts of cell Provide templates to synthesize into protein Proteins Form enzymes that send signals to other cells and regulate gene activity Form body s major components (e.g. hair, skin, etc.) Central dogma DNA DNA is composed of Four Nucleotides, Adenine (A), Guanine (G), Thymine (T) and Cytosine (C) DNA composed of four nucleotides or "bases": A,T,C,G O C 5 th C 3 rd C the national health museum 1

2 Four types of nucleotides of DNA Nucleotides are joined together to form phosphodiester bonds Note that A pairs with T; and C pairs with G. DNA Structure 5 3 DNA Replication RNA RNA composed of four bases: A,C,G,U bases: (T transcribed as U) 2

3 Proteins Amino Acid Proteins are composed of amino acids Basic Amino Acid Structure: The side chain, R, varies for each of the 20 amino acids Side chain H H N Amino group R C α H C O OH Carboxyl group Central Dogma of Molecular Biology DNA RNA protein Sequence structure function Protein Central Dogma DNA to RNA to Protein transcription translation Gene expression DNA RNA protein A string of the alphabet {A,C,G,T} Ex. CCTAAGA A string of the alphabet {A,C,G,U} Ex. CCUAAGA A string of the alphabet {20 amino acids} Ex. TGFIKYL A gene is expressed in two steps: Transcription: RNA synthesis; Translation: Protein synthesis 3

4 Transcription Transcription Transcription is accomplished by RNA polymerase RNA polymerase binds to promoters promoters have distinct regions "-35" and "-10" efficiency of transcription controlled by binding and progression rates transcription start and stop affected by secondary structure regulatory sequences can be positive or negative Translation (animation) Translation conversion from RNA to protein is by codon: 3 bases = 1 amino acid translation done by ribosome and trna translation efficiency controlled by mrna copy number (turnover) and ribosome binding efficiency translation affected by mrna tertiary structure More on Translation Start: AUG Stop: UAA, UAG, UGA the national health museum 4

5 DNA to RNA to Protein Biology, 7/c, Peter H. Raven Gene expression hill.com/sites/ /student_view0/chap ter18/animations.html# A gene is expressed in two steps: Transcription: RNA synthesis; Translation: Protein synthesis Exercise Translate the following DNA to a protein: ctatgcccaagctgaaaaatgagcgtaatgaggtcatcat -3 gatacgggttcgactttttactcgcattactccagtagta -5 Human Genome Project The human genome sequence is complete - - approximately 3 billion base pairs. template Whole genome sequencing has now become routine How does the human genome stack up? Organism Genome Size (Bases) Estimated Genes Human (Homo sapiens) 3.2 billion 25,000 Laboratory mouse (M. musculus) 2.6 billion 25,000 Mustard weed (A. thaliana) 100 million 27,000 Rice (Oryza sativa) 430 million 50,000 Roundworm (C. elegans) 97 million 19,000 Fruit fly (D. melanogaster) 137 million 13,000 Yeast (S. cerevisiae) 12.1 million 6,000 Bacterium (E. coli) 4.6 million 3,200 Human immunodeficiency virus (HIV) H1N U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society,

6 The Path Forward How does DNA impact health? Identify and understand the difference in DNA sequence among human populations What do all the genes do? Discover the functions of human genes by experimentation and by finding genes with similar funcs in the model organisms What are the functions of nongene areas? Identify important elements in the nongene regions of DNA How does info in the genome enable life? Explore life at the ultimate level of the whole organism instead of single genes/proteins. Diverse applications Medicine customized treatments, Microbes for energy and the environment generate clean energy source, clean up toxic wastes, Bioanthropology human lineage Agriculture, livestock breeding, Bioprocessing crops&animals more resistant to diseases, efficient industrial processes, DNA identification implicate people accused of crimes, identify contaminants in air, water, U.S. Department of Energy, 2005 U.S. Department of Energy, 2005 NCBI PubMed Literature Databases Bioinformatics Online Nature Science Molecular Biology Technique PCR Polymerase chain reaction 6