from α- to β-cleavage

Similar documents
Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde

Supplemental Data Supplementary Figure Legends and Scheme Figure S1.

GM130 Is Required for Compartmental Organization of Dendritic Golgi Outposts

Supplementary Materials for

Supplementary Figure. S1

SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric*

ab Ubiquitylation Assay Kit (HeLa lysate-based)

ab Mouse and Rabbit AP/Fast-Red (ABC) Detection IHC Kit

1. Cross-linking and cell harvesting

SANTA CRUZ BIOTECHNOLOGY, INC.

Product Datasheet. Acetylcholinesterase/ACHE Antibody (HR2) NB Unit Size: 200uL. Store at -20C. Avoid freeze-thaw cycles.

GFP CCD2 GFP IP:GFP

Immunoprecipitation Protocol

FLUORESCENT PEPTIDES. Outstanding Performance and Wide Application Range

ab Ran Activation Assay Kit

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling

ab Mouse and Rabbit Specific HRP/DAB (ABC) Detection IHC Kit

64 CuCl 2 in 50 µl 0.1N NaOAc buffer, and 20 µg of each DOTA-antibody conjugate in 40 µl

Smooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation

JBC Papers in Press. Published on July 2, 2008 as Manuscript M

IMMUNOPRECIPITATION (IP)

supplementary information

Confocal immunofluorescence microscopy

Identification of Microprotein-Protein Interactions via APEX Tagging

Nature Neuroscience: doi: /nn Supplementary Figure 1

Supplemental information

Alzheimer s Disease. Table of Contents. Differential processing of APP Hyperphosphorylation of Tau

Transferrin Conjugates

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.

IMMUNOPRECIPITATION TROUBLESHOOTING TIPS

PSC 4-Marker Immunocytochemistry Kit PSC (OCT4, SSEA4) Immunocytochemistry Kit PSC (SOX2, TRA-1-60) Immunocytochemistry Kit

Post-expansion antibody delivery, after epitope-preserving homogenization.

ab Ubiquitylation Assay Kit

B-27 Plus Neuronal Culture System

Kinase Reaction and Alkylation Protocol

Supplementary File 3: DNA and RNA isolation

Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion

MagSi Beads. Magnetic Silica Beads for Life Science and Biotechnology study

Anti-Piscirickettsia salmonis monoclonal antibody. Product no: P05

by Neurobasal medium (supplemented with B27, 0.5mM glutamine, and 100 U/mL

phab Amine and Thiol Reactive Dyes for Antibody Internalization Studies Nidhi Nath, Ph.D. Group Leader, Protein Analysis Promega Corporation

Nature Immunology: doi: /ni Supplementary Figure 1

APP mutations in the A! coding region are associated with abundant cerebral deposition of A!38

ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG

ab TripleStain IHC Kit: M&M&R on human tissue (DAB, Red/AP & DAB/Ni)

2D gel Western blotting using antibodies against ubiquitin, SUMO and acetyl PTM

Electrophoresis and transfer

Respiratory distress and early neonatal lethality in Hspa4l/Hspa4 double mutant mice

Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD

AlphaLISA Total Amyloid-Beta 42

Nanoparticle orientation to control RNA loading and ligand display on extracellular vesicles for cancer regression

Supporting Information: Core-Shell Nanoparticle-Based Peptide Therapeutics and Combined. Hyperthermia for Enhanced Cancer Cell Apoptosis

mcherry Polyclonal Antibody Catalog Number PA Product data sheet

Methodology for Immunohistochemistry. Learning Objectives:

Supporting Online Material for

MSD Immuno-Dot-Blot Assays. A division of Meso Scale Diagnostics, LLC.

Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.

TAU AGGREGATION ASSAY D. JAGA

Tracking Cellular Protein Localization and Movement in Cells with a Flexible Fluorescent Labeling Technology. Chad Zimprich January 2015

Human Pluripotent Stem Cell Functional Identification Kit

Myers Lab ChIP-seq Protocol v Modified January 10, 2014

Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and

Human (6E10) Abeta Peptide Ultra-Sensitive Kits

TECHNICAL BULLETIN. MEK Activity Assay Kit. Product Code CS0490 Storage Temperature 20 C

Supplemental Material to: SRam Sripad, Dongyoung Kim, Raimund Ober, E. Sally Ward

A plasma proteolysis pathway comprising blood coagulation proteases

-PLEX. Immunogenicity Assay Application Note. Measuring anti-drug antibodies (ADAs) to two different drugs using a multiplex bridging assay

LAMININ. For Immunohistochemical Demonstration of Laminin in Paraffin-embedded and Frozen Human Tissue Sections Stock No. IMMH-7

Supplemental figures Supplemental Figure 1: Fluorescence recovery for FRAP experiments depicted in Figure 1.

Immunohistochemistry. How does it look like? When do we need IHC? When do we need IHC? In clinic: In research:

ELISPOT and FLUOROSPOT kits

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna

Immunofluorescence of organoids embedded in Basement Membrane Matrix

Protocols for Neural Progenitor Cell Expansion and Dopaminergic Neuron Differentiation

Supplementary Material. Levels of S100B protein drive the reparative process in acute muscle injury and muscular dystrophy

Supplement Figure 1. Characterization of the moab. (A) A series of moabs that are anti-hαiib-specific were tested for their ability to bind to

ab Hypoxic Response Human Flow Cytometry Kit

mcherry Monoclonal Antibody (16D7) Catalog Number M11217 Product data sheet

Supplemental Information for:

1. Paraffin section slides can be stored at room temperature for a long time.

mcherry Rat Monoclonal Antibody

In vivo BrdU Incorporation Assay for Murine Hematopioetic Stem Cells Ningfei An, Yubin Kang *

Supplementary Information

ab CFSE Fluorescent Cell Labeling Kit

Supporting Information

Orexin A (HUMAN, MOUSE, RAT, PORCINE, OVINE,

How to run Alpha assay: How to setup an Alpha assay Make your own assay!

MEK1/2 (MAPK Kinase) Activity Assay Kit

U-PLEX Custom Biomarker (Mouse) Multiplex Assays FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC OR THERAPEUTIC PROCEDURES.

Supplementary Figure 1. RAD51 and RAD51 paralogs are enriched spontaneously onto

Supplementary Materials: Viral Protein Kinetics of Piscine Orthoreovirus Infection in Atlantic Salmon Blood Cells

from Dr. David Livingston. Rabbit anti-myc, V5, and BACH1 were raised by immunizing rabbits with peptides EQKLISEEDI, GKPIPNPLLGLDST, and

About OMICS Group Conferences

Mitochondria/Cytosol Fractionation Kit

2. Sample dilution: Tissue lysate and cell lysate sample should be diluted at least 5-fold with 1x Sample Diluent Buffer.

Assays for studying mitochondrial health and function

Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.

(A) Schematic illustration of sciatic nerve ligation. P, proximal; D, distal to the ligation site.

Isolation, culture, and transfection of primary mammary epithelial organoids

CytoSelect LDH Cytotoxicity Assay Kit

Transcription:

Supplementary Information Specific antibody binding to the APP 672-699 region shifts APP processing from α- to β-cleavage Song Li 1,6,8, Juan Deng 1,7,8, Huayan Hou 1,8, Jun Tian 1, Brian Giunta 2,3, Yanjiang Wang 7, Darrell Sawmiller 1,2, Adam Smith 4, Paul R. Sanberg 4, Demian Obregon 1,2, Takashi Mori 5 and Jun Tan *,1,2 1 Rashid Laboratory for Developmental Neurobiology, Silver Child Development Center, Department of Psychiatry and Behavioral Neurosciences, Morsani College of Medicine, University of South Florida, Tampa, Florida, USA; 2 James A. Haley Veterans' Hospital, Tampa, Florida, USA; 3 Neuroimmunology Laboratory, Department of Psychiatry and Behavioral Neurosciences, Morsani College of Medicine, University of South Florida, Tampa, Florida, USA; 4 Center of Excellence for Aging and Brain Repair, Department of Neurosurgery and Brain Repair, Morsani College of Medicine, University of South Florida, Tampa, Florida, USA; 5 Departments of Biomedical Sciences and Pathology, Saitama Medical Center and Saitama Medical University, Kawagoe, Saitama, Japan; 6 Center for Translational Research of Neurology Diseases, First Affiliated Hospital, Dalian Medical University; 7 Department of Neurology, Daping Hospital, the Third Military Medical University, Chongqing, China Running title: Binding on APP 672-699 promotes APP β-cleavage 8 These authors contributed equally to this work. 1

Supplemental Figure S1 A schematic diagram of the β-amyloid precursor protein (APP) proteolytic cleavage sites and mutations. The sites of α-, β- and γ-secretase mediated cleavage are indicated with arrows. The trans-membrane domain (TMD) of APP is highlighted in blue, and ectodomain (ECD) of APP in green. γ-cleavage produces a pool of Aβ fragments that vary in length and hydrophobicity. The mutations (indicated in red) around α- and β- cleavage sites either increase the total Aβ production (670/671, 682, 692), alter Aβ biophysical properties (677, 678, 693), or affect the Aβ spectrum in both quantitative and qualitative ways (673, 716). 2

Supplemental Figure S2 Increased cell surface β-ctf is further confirmed by a β-ctf specific antibody. (A) CHO/APP wt cells in 24-well plates (5 10 5 /well) were treated with mab ED-C99 or IgG 1 isotype control at 1.25 μg/ml for 2 h, washed three times with PBS containing CaCl 2 and MgSO 4 (PBS-CM), and then cell lysate portions of these cells were directly subjected to WB analysis using a β-ctf specific antibody, mabbam10. The remaining cells were biotinylated with Sulfo-NHS-LC-Biotin dissolved in ice-cold borate buffer and quenched with NH 4 Cl-PBS-CM and lysed. These cell lysates were then immunoprecipitated (IP) using Neutravidin beads. The intracellular proteins obtained by IP/Neutravidin depletion (middle panels) and the cell surface (cell surf) proteins obtained by IP/Neutravidin precipitation (right panels) were subjected to WB analysis using mabbam10. (B) TgAPP wt -derived primary 3

neuronal cells were cultured from cortical tissues of one-day-old TgAPP wt mouse pups and replated in 24-well plate at 2 10 5 /well overnight. These primary cultured neuronal cells were treated with mab ED-C99 or IgG 1 isotype control at 1.25 μg/ml for 2 h, washed three times with PBS-CM, and then cell lysates were directly subjected to WB analysis using mabbam10. The remaining cells were biotinylated, immunoprecipitated with Neutravidin beads and subjected to WB analysis using mabbam10. These WB data are representative of four independent experiments with similar results. Supplemental Figure S3 Increased co-localization of APP with cholesterol is cell surface specific. CHO/APP wt cells were plated to 8-well slide chamber and then, after overnight 4

incubation, the cells were treated with mab ED-C99 or IgG 1 control at 1.25 μg/ml for 2 h. Two hours after treatment, these cells were stained by filipin, permeabilized and counterstained with rabbit anti-app-c-terminal antibody 4 C for overnight, as described for Figure 5. Alexa Fluor 594 Donkey anti-rabbit IgG was used to detect APP signal and images taken with a confocal microscopy. Supplemental Figure S4 Intracerebroventricular (i.c.v.) injection of mab ED-C99 yields no increase Aβ deposits. Eight-month-old 5 FAD female mice (n = 3) were treated with mab ED- C99 or isotype IgG 1 as negative control via i.c.v. injection daily for 5 days (5 μg/mouse). The immunohistochemical staining using an anti-aβ 17-26 antibody (4G8) indicated no changes of β- 5

amyloid plaques in retrosplenial cortex (RSC), entorhinal cortex (EC), and hippocampus (H) regions of 5 FAD mouse brain. Supplemental Figure S5. Illustration of effects of mab ED-C99 binding to APP 672-699 on wild-type APP processing. APP is primarily processed by α-secretase on the cell membrane surface leading to sappα release, or processed while co-localized with cholesterol on the cell membrane surface by β-secretase, leading to C99 production. In addition, APP can be endocytosed for β-secretase cleavage and endocytosed C99 is further processed by γ-secretase to yield Aβ. As shown, mab ED-C99 can (1) directly block α-secretase activity, (2) increase colocalization of APP with cholesterol, (3) promote APP to be cleaved by cell surface β-secretase, (4) block LRP1-mediated APP endocytosis, and thereby, (5) diminish intracellular cascade of APP processing. 6