by Neurobasal medium (supplemented with B27, 0.5mM glutamine, and 100 U/mL
|
|
- Mitchell Collins
- 6 years ago
- Views:
Transcription
1 Supplementary Materials and methods Neuronal cultures and transfection The hippocampus was dissected from E8 rat embryos, dissociated, and neurons plated onto glass coverslips coated with poly-ornithine (Sigma) at a density of 8, cells per coverslip. After the neurons attached ( h after plating) they were transfected using Lipofectamine (Invitrogen) as described. After an incubation for h, the transfection medium was replaced by Neurobasal medium (supplemented with B7,.5mM glutamine, and U/mL penicillin/streptomycin; Invitrogen). The cells were detached after the transfection by moderate pipetting and replated onto new coverslips at a lower density (,-6, cells per coverslip in a -well plate). Alternatively, neurons were transfected by electroporation using the Rat Neuron Nucleofector Kit (Amaxa). For electroporation,.5 x 6 cells were resuspended in µl Nucleofectamin solution, transfected according to the manufacturer's recommendations, and plated at. cells per coverslip. Neurons were fixed at d.i.v. with % paraformaldehyde and 5% sucrose in phosphatebuffered saline (PBS) for min at o C or (for staining with anti-smurf and anti-smurf antibodies) with methanol/acetone (:) for min at - o C. For immunofluorescence, hippocampal neurons were permeabilised with.% Triton X- in PBS, blocked with % FCS in PBS (blocking buffer), and incubated with primary and secondary antibodies in blocking buffer. The following antibodies were used: Tau-, anti-synapsin I (Chemicon; #MAB, dilution :; AB5, dilution :), anti-map (Chemicon; #AB56, :5), anti-gfp (BabCo; #MMS-9P, :5), rabbit anti-par (Upstate; #7-, :), monoclonal anti- Rap (BD Biosciences; #695, :), polyclonal anti-smurf (#APa, :) and anti- Smurf (Abgent; #AP5a, :), and Alexa-conjugated secondary antibodies (Molecular
2 Probes; :). The specificity of the Smurf and Smurf antibodies was confirmed in Western blots (not shown) and by immunofluorescence (Supplementary Figure S5). The anti- Rap antibody recognises both RapA and RapB (95% amino acid sequence identity) but not other GTPases. Hippocampal neurons express mainly RapB (Schwamborn and Püschel, ). FM-6 dye uptake Uptake of FM-6 was analysed as described previously (Jiang et al., 5). At d.i.v., neurons were incubated with 5 mm K + solution in the presence of µm FM-6FX (Invitrogen) for min. Subsequently, neurons were washed for 5 min with a mm K + solution and fixed or incubated with 9 mm K + for 5 min before fixation. All solutions contained mm kynurenic acid (Calbiochem). References Jiang, H., Guo, W., Liang, X. and Rao, Y. (5) Both the establishment and the maintenance of neuronal polarity require active mechanisms: critical roles of GSK-beta and its upstream regulators. Cell,, -5. Schwamborn, J.C. and Püschel, A.W. () The sequential activity of the GTPases RapB and Cdc determines neuronal polarity. Nat. Neurosci., 7, 9-99.
3 Supplementary Figure Legends Supplementary Figure S Inhibition of the proteasome disrupts neuronal polarity. (A) Quantification of RapB immunoreactivity in the growth cones marked in Fig. A. (B) Quantification of the RapB signal from the Western Blot shown in Fig. E. (C-D) Hippocampal neurons were incubated with solvent (DMSO) or.5µm Lactacystin (dissolved in DMSO) for 8 h, and analysed at d.i.v. by staining with the Tau- (C, blue) and an anti-par antibodies (red). Axons identified by Tau- immunoreactivity are marked by asterisks. The marked growth cones are shown at a higher magnification. Treatment with Lactacystin induced the formation of multiple axons that were all positive for Par (arrow). Marked growth cones (, ) are shown at a higher magnification. Scale bars are µm. (D) The length of minor neurites was not changed by treatment with solvent (D, DMSO) Lactacystin (L), ALLN (A), or MG- (M; means ± s.e.m.; p<. compared to treatment with DMSO; n= independent experiments). (E-I) Hippocampal neurons were cultured in the presence of solvent (DMSO) or µm ALLN (dissolved in DMSO) for 8 h and analysed at d.i.v. (stage ) by staining with (E) an anti-map (red) and the Tau- antibody (blue), (F) rhodamine-phalloidin (red), the Tau- (blue), and an anti-par antibody (green), or (H) rhodamine-phalloidin (red), the Tau- (blue), and an anti-rap antibody (green). Axons identified by Tau- immunoreactivity are marked by asterisks. One neuron is shown at a higher magnification. Treatment with ALLN induced the formation of multiple axons, that were positive for Par and RapB (F, H; H, arrows). (G) Quantification of RapB immunoreactivity in the growth cones labeled in F. (H) Insets show higher magnifications of the marked growth cones. (I) Quantification of RapB immunoreactivity in the growth cones labeled in (H). (J) Hippocampal neurons were incubated overnight with solvent (DMSO, -) or µm ALLN (+). RapB was precipitated from cell lysates using an anti-rap antibody (xip) and analysed by Western blot using anti-ubiquitin, anti-rap, anti-α-tubulin, and the
4 Tau- antibodies (WB). Luminescence signals from Western blots were collected for second (s) and min to detect poly-ubiquitinated RapB visible after proteasome inhibition. Staining for tubulin confirmed the loading of comparable amounts of protein. The slight increase in the amount of α-tubulin upon inhibition of the proteasome is consistent with the formation of supernumerary axons. The Tau- antibody revealed a small increase in the level of the hypo-phosporylated tau isoform detected by this antibody after inhibition of the proteasome. Supplementary Figure S In vitro ubiquitination is specific for GDP-bound RapB. (A) HEK 9T cells were transfected with expression vectors for myc-tagged wild type RapB (wt), constitutively active RapB (V), or dominant negative RapB (N7). The cells were treated with. µm 8-CPT-Me-cAMP (8-CPT) as indicated which activates RapB through Epac. The amount of active RapB was determined by a GST pull-down assay using bacterially expressed GST-RalGDS-RBD coupled to glutathion-sepharose. Bound RapB was detected in Western blots using an anti-myc antibody. The expression of comparable amounts of RapB and GST-RalGDS-RB was confirmed by Western blot. (B) HEK 9T cells were transfected with expression vectors for Flag-SmurfC76A (F/SmurfCA) or HA-Epac (H/Epac; as a control for GDP-loading) and the cell lysates incubated with bacterially expressed GST-RapB coupled to glutathion-sepharose and preloaded with.7 mm GTPγS or.7 mm GDP as indicated. Bound Smurf (left panel) or Epac (right panel) were detected in Western blots using an anti-flag or anti-ha antibody. The expression of equivalent amounts of Smurf, Epac, and GST-RapB was confirmed by Western blot. Supplementary Figure S GST-RalGDS-RBD is specific for active RapB. (A, B) COS-7 cells were fixed 5 min after treatment with DMSO (-) or. µm 8-CPT-Me-cAMP (8- CPT), incubated with bacterially expressed GST (negative control) or GST-RalGDS-RBD
5 that specifically binds RapB-GTP and bound GST was detected in situ with an anti-gst antibody (green). RapB was detected with an anti-rap antibody (red). GST immunofluorescence intensity was color-coded. Blue indicates weak staining, white strong labeling. RapB immunofluorescence and RalGDS-RBD binding showed a high degree of colocalization. RapB was recruited to the cell membrane upon activation of Epac by 8-CPT, as previously described (LaFuente et al., ). (C) The specificity of the immunostaining for bound GST-RalGDS-RBD (Fig. ) was confirmed by incubation of stage and stage hippocampal neurons with GST and staining with an anti-gst antibody. Cells were labeled with the cell volume marker CMFDA (green). Neurons were analysed by confocal microscopy. Projections of z-stacks that contain the complete cell are shown. Pictures were taken with the same exposure time that was used for Fig. C. GST immunofluorescence intensity was color-coded. Blue indicates weak staining, white strong labeling. The cell body shows only a very weak staining after incubation with GST and no signals were detectable in neurites or growth cones. Scale bars are µm. Supplementary Figure S Smurf expression increases neurite length. (A-C) Hippocampal neurons were transfected h after plating with expression vectors for EGFP or EGFP and Smurf, SmurfC699A, Smurf, or SmurfC76A. Neurons were analysed at d.i.v. by staining with Tau- and anti-map antibodies. The total number of neurites (A, axon plus minor neurites), axon length (B) and the length of minor neurites (C) were determined (means ± s.e.m.; p<. compared to EGFP; n= independent experiments). Supplementary Figure S5 Efficiency of the shrnas. (A-F) Hippocampal neurons were transfected with pshag- (Mock) or expression vectors for anti-smurf, anti-smurf, anti- SmurfMut (inactive control vector), or anti-smurfmut shrnas and EGFP (A and B, green). Transfected cells were analysed at d.i.v. by staining with anti-smurf or anti-smurf
6 antibodies (A, red) or by staining with Tau- (blue) and anti-map antibodies (B, red). (A) Expression of anti-smurf or anti-smurf shrnas but not the control shrnas resulted in an almost complete loss of Smurf or Smurf from neurites and cell bodies. Only weak residual staining was visible in the cell bodies. Neurons expressing anti-smurfmut or anti- SmurfMut shrnas and EGFP showed normal Smurf or Smurf staining (A, arrows) and developed a normal polarity with one axon (B, asterisks) and several minor neurites. The number of minor neurites (C), the total number of neurites (D), axon length (E), and the length of minor neurites (F) were determined (means ± s.e.m.;, p<. compared to Mock; n= independent experiments). Higher magnifications of the growth cones marked in (A) are shown. Scale bars are µm. (G-N) To confirm the specificity of the Smurf knock-down, a second RNAi construct based on the psm vector (Silva et al., 5) and directed against a different target sequence in Smurf was used. Hippocampal neurons were transfected with EGFP (green) and psm or the expression vector for the anti-smurf shrna- (G, L). Transfected cells were analysed at d.i.v. by staining with the Tau- (blue) and anti-map antibodies (G, red) or an anti-smurf antibody (L, red). Tau- positive axons are marked by asterisks and axons formed by untransfected neurons by arrowheads (G) The knock-down of Smurf induced the formation of multiple axons (G, H), while the number of minor neurites remained unchanged (I). The length of axons was slightly reduced (J) while the length of the minor neurites was not affected significantly (K) (means ± s.e.m.;, p<. compared to control (psm); n= independent experiments). (L) The expression of the anti-smurf shrna- but not transfection with the vector psm resulted in an almost complete loss of Smurf from neurites and growth cones. The marked growth cones (: transfected cell, : untransfected cell) are shown at a higher magnification. (M-P) Hippocampal neurons were transfected h after plating with an expression vector for EGFP and psm or the vector for the anti-smurf shrna-. Transfected cells were analysed at 6 d.i.v. by staining with the Tau- (M, blue), anti-gfp (green) and anti-map antibodies (M, red). Because the density of
7 the neurites at this stage prevented the reliable and unambiguous assignment of Tau- positive neurites to a cell body (arrow), neuronal polarity was analysed only by morphology (N). Long neurites were scored as axons (asterisks) while short neurites were counted as dendrites. The number of axons (O) and dendrites (P) per cell was determined (means ± s.e.m.; p<. compared to psm; independent experiments).(q, R) Hippocampal neurons were transfected at d.i.v. with an expression vector for EGFP (green) and pshag-magic (EGFP) or the expression vector for the anti-smurf shrna- (Smurf-RNAi) and analysed at 5 d.i.v. by staining with the Tau- (Q, blue) and an anti-map antibody (Q, red). Neurons were plated at a lower density (, cells per coverslip) than for the experiments shown in (M-P). The number of axons and dendrites per cell is shown (means ± s.e.m.; p<. compared to EGFP/pSM; independent experiments). Controls (EGFP) formed. ±. axons and 6. ±. dendrites per cell (n=). Suppression of Smurf at this stage did not affect neuronal polarity (. ±. axons and 5. ±. dendrites per cell; n=). (S, T) Solvent (DMSO) or nm Lactacystin (dissolved in DMSO) was added to cultures of hippocampal neurons at d.i.v. and neurons analysed at 5 d.i.v. by staining with the Tau- (S, blue) and an anti-map antibody (S, red). The number of axons and dendrites per cell is shown (means ± s.e.m.; p<. compared to DMSO; independent experiments). Lactacystin induced the formation of multiple axons (Lactacystin:. ±. axons and.7 ±.9 dendrites per cell; n=5). (U) Hippocampal neurons were transfected with expression vectors for an shrna directed against Smurf (S RNAi) and EGFP (green). As control, a construct for an inactive shrna (S RNAi mut) was used. Transfected cells were analysed at d.i.v. (stage ) by staining with anti-synapsin I (blue) and anti-map antibodies (red). (V, W) Hippocampal neurons were transfected with expression vectors for EGFP and an shrna directed against Smurf (Smurf RNAi) or an inactive shrna as control (Smurf RNAi mut). At d.i.v. (stage ), the uptake of the dye FM-6 by transfected cells was analysed to confirm that axons show active synaptic vesicle recycling. In control neurons (Smurf RNAi 5
8 mut), all axons (marked with an asterisk) showed uptake of FM-6 after stimulation with K + (a higher magnification of the axon marked is shown) whereas little uptake was detectable in minor neurites (). Suppression of Smurf by RNAi induced the formation of supernumerary axons (marked with an asterisk). All axons (identified by their length) were positive for FM-6 uptake (higher magnification:, ) whereas minor neurites showed little dye uptake (). After a second stimulation with K +, most of the dye was released from axons (not shown). These results confirm that the supernumerary axons induced by suppression of Smurf are functional in vesicle recycling. The scale bars are µm. (W) The number of neurites per cell positive (black bars) or negative for FM-6 (white bars) is shown (Smurf RNAi mut:. ±. neurites/cell positive for FM-6 uptake,. ±. negative, n = 9; Smurf RNAi:. ±. positive,. ±. negative, n = ; means ± s.e.m.; p<. compared to Smurf RNAi mut). Supplementary Figure S6 Distribution of active RapB after expression of Smurf. (A, B) Hippocampal neurons were transfected h after plating with expression vectors for EGFP, EGFP and Smurf, or EGFP and SmurfC76A (green). Neurons were analysed at d.i.v. by incubation with bacterially expressed GST (A, negative control) or GST-RalGDS-RBD (B) that specifically binds RapB-GTP. GST was detected in situ with an anti-gst antibody (red). As an additional control, the growth cones of untransfected neurons in the vicinity of transfected cells are shown in (B). Neurons were analysed by confocal microscopy. Projections of z-stacks that contain the complete cell are shown. Incubation with RalGDS- RBD confirmed that the supernumerary axons induced by expression of SmurfC76A contained active RapB. The marked growth cones are shown at a higher magnification (picture shows growth cones from untransfected cells in the upper and middle panel of (B)). Scale bars are µm. 6
9 Supplementary Figure S7 Expression of RapBR5 and Smurf deletion constructs. (A) Alignment of RhoA and RapB N-terminal sequences. Conserved lysines are indicated in red. (B) HEK 9T cells were transfected with expression vectors for myc-rapb (M/RapB) or myc-rapbr5 (M/RapBR5) and the cell lysates incubated with bacterially expressed GST- SmurfC76A coupled to glutathion-sepharose. Bound RapB and RapBR5 (top panel) were detected in Western blots using an anti-myc antibody. The expression of equivalent amounts of RapB, RapBR5, and GST-SmurfC76A was confirmed by Western blot. (C) HEK 9T cells were transfected with expression vectors for myc-rapb (M/RapB) or myc- RapBR5 (M/RapBR5) and the cell lysates incubated with bacterially expressed GST- RalGDS-RBD coupled to glutathion-sepharose to determine the amount of active GTPase. Bound RapB and RapBR5 (top panel) were detected in Western blots using an anti-myc antibody. The expression of equivalent amounts of RapB, RapBR5, and GST-RalGDS- RBD was confirmed by Western blot with anti-gst and anti-myc antibodies. Equivalent amounts of active RapB and RapBR5 were detected showing that the R5 mutation does not increase Rap activity. (D) Hippocampal neurons were transfected h after plating with expression vectors for RapB, RapBR5, RapB and EGFP-Smurf, or RapBR5 and EGFP- Smurf. Transfected cells were analysed at d.i.v. by staining with the Tau- and anti-map antibodies, and neuronal morphology was analysed by determining the number of minor neurites per cell (means ± s.e.m.; p<. compared to EGFP; n= independent experiments). (E) Hippocampal neurons were transfected with expression vectors for EGFP (green) or EGFP and RapBR5. Transfected cells were analysed at d.i.v. (stage ) by staining with anti-synapsin I (blue) and anti-map antibodies (red). (F, G) Hippocampal neurons were transfected with expression vectors for EGFP or EGFP-RapBR5. At d.i.v. (stage ), the uptake of the dye FM-6 by transfected cells was analysed to confirm that axons show active synaptic vesicle recycling. In control neurons (GFP), all axons (marked with an asterisk) showed uptake of FM-6 after stimulation with K + (a higher magnification 7
10 of the axon marked is shown) whereas little dye uptake was detectable in minor neurites (). Transfection of neurons with an expression vector for RapBR5 induced the formation of supernumerary axons (marked with an asterisk). All axons (identified by their length) were positive for FM-6 uptake (higher magnification:, ) whereas minor neurites showed little dye uptake (). After a second stimulation with K +, most of the dye was released from the axons (not shown). These results confirm that the supernumerary axons induced by suppression of Smurf are functional in vesicle recycling. The scale bars are µm. (G) The number of neurites per cell positive (black bars) or negative for FM-6 (white bars) is shown (EGFP:. ±. neurites/cell positive for FM-6 uptake,. ±. negative, n = ; RapBR5:.9 ±. positive,.5 ±. negative, n = ; means ± s.e.m.; p<. compared to EGFP). 8
11 Suppl. Figure S A Rap fluorescence intensity (a.u.) DMSO Lactacystin B Rap amount (a.u.) RapB ohne DMSO RapB mit ALLN C Par Tau- Overlay DMSO Lactacystin D Length minor neurites (µm) DMSO Lacta D L A M
12 E MAP Tau- Overlay DMSO ALLN F Actin Tau- Par Overlay DMSO ALLN 6 5 G Par fluorescence intensity (a.u.) DMSO ALLN Suppl. Figure S
13 Suppl. Figure S H Actin Tau- Rap Overlay DMSO 5 ALLN I Rap fluorescence intensity (a.u.) DMSO ALLN
14 J s ALLN - + min ALLN - + WB: kd (Ub) n -RapB α-ub kd Rap kd α-rap tubulin xip: α-rap 55kD α-tubulin tau Lysate 55kD Tau- Suppl. Figure S
15 A M/RapB 8CPT RapB GST/RalGDS-RBD WT WT N7 V WB: α-myc GST/RalGDS-RBD α-gst RapB GST pull-down α-myc Lysate B GTPγS GDP F/Smurf / H/Epac GST/RapB F/Smurf CA GST/RapB H/Epac WB: + + α-flag / α- HA α-gst F/Smurf / H/Epac GST pull-down Lysate α-flag / α- HA Suppl. Figure S
16 Suppl. Figure S A Rap GST GST Overlay 8CPT - 8CPT - B Rap RalGDS-RBD RalGDS-RBD Overlay
17 Suppl. Figure S C CMFDA GST Overlay Stage Stage
18 Suppl. Figure S A Total no. neurites 9 7,5 6,5,5 EGFP Smurf Smurf CA Smurf Smurf CA B Length axons (µm) EGFP Smurf Smurf CA Smurf Smurf CA C Length minor neurites (µm) 8 6 EGFP Smurf Smurf CA Smurf Smurf CA
19 Suppl. Figure S5 A EGFP Smurf Overlay EGFP Smurf S RNAi Mock Smurf RNAi Mut Mock Smurf RNAi Mut EGFP Smurf Overlay EGFP Smurf Smurf RNAi B EGFP MAP Tau- Overlay Smurf RNAi Mut Smurf RNAi Mut
20 Suppl. Figure S5 C 6 D 7 No. minor neurites 5 Total no. of neurites 6 5 pshag Smurf RNAi Smurf RNAiMut Smurf RNAi Smurf RNAiMut pshag Smurf RNAi Smurf RNAiMut Smurf RNAi Smurf RNAiMut E 6 F 5 Length axons (µm) 8 6 pshag Smurf RNAi Smurf RNAiMut Smurf RNAi Smurf RNAiMut Length minor neurites (µm) pshag Smurf RNAi Smurf RNAiMut Smurf RNAi Smurf RNAiMut
21 Suppl. Figure S5 G EGFP MAP Tau- Overlay S RNAi- MOCK L S RNAi- MOCK EGFP Smurf Overlay H No. minor neurites No. Axons J minor neurite (µm) axons (µm) ILength K psm psm psm Smurf RNAi- Smurf RNAi- Smurf RNAi- psm Smurf RNAi-
22 Suppl. Figure S5 M MAP Tau- Overlay EGFP Smurf-RNAi- EGFP
23 N EGFP Smurf-RNAi- Suppl. Figure S5 EGFP
24 Suppl. Figure S5 O No. of axons EGFP Smurf-RNAi- P 7 No. of dendrites 6 5 EGFP Smurf-RNAi-
25 Suppl. Figure S5 Q MAP Tau- Overlay EGFP EGFP Smurf-RNAi R No. of dendrites No. of axons EGFP Smurf-RNAi EGFP Smurf-RNAi
26 S MAP Tau- Overlay DMSO Lactacystin T No. of axons DMSO Lactacystin 8 7 No. of dendrites 6 5 DMSO Lactacystin Suppl. Figure S5
27 U GFP Synapsin I Map Overlay Smurf RNAi Smurf RNAi mut Suppl. Figure S5
28 V GFP FM-6 Smurf RNAimut Smurf RNAi W # neurites/cell,5,5,5 FM-6 uptake no FM-6 uptake,5 Smurf RNAi mut Smurf RNAi Supplementary Figure S5
29 A EGFP GST Overlay Suppl. Figure S6 EGFP SmurfCA Smurf EGFP B EGFP RalGDS-RBD Overlay Smurf SmurfCA
30 B A RhoA MAAIRKKLVIVGD RapB MREYKLVVLGS GST/SmurfCA M/RapB WT R5 WB: M/RapB WT R5 WB: RapB α-myc RapB α-myc C GST/RalGDS-RBD Smurf α-gst RalGDS-RBD α-gst GST pull-down GST pull-down RapB α-myc RapB α-myc D No. minor neurites Lysate 6 EGFP RapB RapB5R RapB + Smurf RapB5R + Smurf Lysate E GFP Synapsin I MAP Overlay RapB R5 EGFP Suppl. Figure S7
31 F GFP FM-6 RapBR5 GFP G # neurites/cell,5,5,5 FM-6 uptake no FM-6 uptake,5 GFP RapB R5 Supplementary Figure S7
GM130 Is Required for Compartmental Organization of Dendritic Golgi Outposts
Current Biology, Volume 24 Supplemental Information GM130 Is Required for Compartmental Organization of Dendritic Golgi Outposts Wei Zhou, Jin Chang, Xin Wang, Masha G. Savelieff, Yinyin Zhao, Shanshan
More informationSupplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
More informationNature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 PCR-genotyping of the three mouse models used in this study and controls for behavioral experiments after semi-chronic Pten inhibition. a-c. DNA from App/Psen1 (a), Pten tg (b) and
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Dynamic Phosphorylation of HP1 Regulates Mitotic Progression in Human Cells Supplementary Figures Supplementary Figure 1. NDR1 interacts with HP1. (a) Immunoprecipitation using
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Legends for Supplementary Tables. Supplementary Table 1. An excel file containing primary screen data. Worksheet 1, Normalized quantification data from a duplicated screen: valid
More informationSupplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and
Supplementary Figure 1: Derivation and characterization of RN ips cell lines. (a) RN ips cells maintain expression of pluripotency markers OCT4 and SSEA4 after 10 passages in mtesr 1 medium. (b) Schematic
More informationFigure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion
Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin
More informationSupplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/-
#1074683s 1 Supplemental Online Material Materials and Methods Cell lines and tissue culture The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- knock-out animals
More informationShort hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna
Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6
More informationSegments of the obstructed intestinal loops were fixed in 4% paraformaldehyde
Supplementary text Supplementary materials and methods Histopathological examination Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin wax with
More informationsirna Transfection Into Primary Neurons Using Fuse-It-siRNA
sirna Transfection Into Primary Neurons Using Fuse-It-siRNA This Application Note describes a protocol for sirna transfection into sensitive, primary cortical neurons using Fuse-It-siRNA. This innovative
More informationSANTA CRUZ BIOTECHNOLOGY, INC.
TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same
More informationSupplemental information
Supplemental information - Control samples (200 subjects) - Immunohistochemistry of rat brain - Immunocytochemistry on neuronal cultures - Immunocompetition assay - Immunoprecipitation - Immunocytochemistry
More informationThis Document Contains:
This Document Contains: 1. In-Cell Western Protocol II. Cell Seeding and Stimulation Supplemental Protocol III. Complete Assay Example: Detailing the Seeding, Stimulation and Detection of the A431 Cellular
More informationRegulation of Synaptic Structure and Function by FMRP- Associated MicroRNAs mir-125b and mir-132
Neuron, Volume 65 Regulation of Synaptic Structure and Function by FMRP- Associated MicroRNAs mir-125b and mir-132 Dieter Edbauer, Joel R. Neilson, Kelly A. Foster, Chi-Fong Wang, Daniel P. Seeburg, Matthew
More informationmcherry Polyclonal Antibody Catalog Number PA Product data sheet
Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 mcherry Polyclonal Antibody Catalog Number PA5-34974 Product data sheet Details Size
More informationAmaxa Basic Neuron SCN Nucleofector Kit
Amaxa Basic Neuron SCN Nucleofector Kit For Primary Neural Cells (Small Cell Number) SCN Nucleofector Kits are compatible with Nucleofector ll Devices of serial version S with software version S4 4 or
More informationINOS. Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG00807
INOS Colorimetric Cell-Based ELISA Kit Catalog #: OKAG00807 Please read the provided manual entirely prior to use as suggested experimental protocols may have changed. Research Purposes Only. Not Intended
More informationSupplemental Movie Legend.
Supplemental Movie Legend. Transfected T cells were dropped onto SEE superantigen-pulsed Raji B cells (approximate location indicated by circle). Maximum-intensity projections from Z-stacks (17 slices,
More informationsupplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
More information*Corresponding author. Tel: ;
1 SUPPLEMENTARY DATA 2 3 4 5 6 7 8 9 10 11 Integrin 2 1 in nonactivated conformation can induce focal adhesion kinase signaling Maria Salmela 1, Johanna Jokinen 1,2, Silja Tiitta 1, Pekka Rappu 1, Holland
More informationEGFR (Phospho-Ser695)
Assay Biotechnology Company www.assaybiotech.com Tel: 1-877-883-7988 Fax: 1-877-610-9758 EGFR (Phospho-Ser695) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02090 Please read the provided manual entirely
More informationImmunofluorescence Staining Protocol for 3 Well Chamber, removable
Immunofluorescence Staining Protocol for 3 Well Chamber, removable This Application Note presents a simple protocol for the cultivation, fixation, and staining of cells using the 3 Well Chamber, removable.
More informationConfocal immunofluorescence microscopy
Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,
More informationNature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 BALB/c LYVE1-deficient mice exhibited reduced lymphatic trafficking of all DC subsets after oxazolone-induced sensitization. (a) Schematic overview of the mouse skin oxazolone contact
More informationab Ubiquitylation Assay Kit
ab139467 Ubiquitylation Assay Kit Instructions for Use For the activation of ubiquitin for use in ubiquitylation experiments This product is for research use only and is not intended for diagnostic use.
More informationIn-Cell Western Kits I and II
Odyssey and Aerius Infrared Imaging Systems In-Cell Western Assay Kits I and II Published November, 2006. The most recent version of this protocol is posted at http://biosupport.licor.com/protocols.jsp
More informationCytoPainter Golgi Staining Kit Green Fluorescence
ab139483 CytoPainter Golgi Staining Kit Green Fluorescence Instructions for Use Designed for the detection of Golgi bodies by microscopy This product is for research use only and is not intended for diagnostic
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/323/5910/124/dc1 Supporting Online Material for Regulation of Neuronal Survival Factor MEF2D by Chaperone-Mediated Autophagy Qian Yang, Hua She, Marla Gearing, Emanuela
More informationSmooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation
Smooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation Shu Liu 1, Zhongwen Xie 2, Qingwei Zhao 2, Huan Pang
More informationSupplemental Data. LMO4 Controls the Balance between Excitatory. and Inhibitory Spinal V2 Interneurons
Neuron, Volume 61 Supplemental Data LMO4 Controls the Balance between Excitatory and Inhibitory Spinal V2 Interneurons Kaumudi Joshi, Seunghee Lee, Bora Lee, Jae W. Lee, and Soo-Kyung Lee Supplemental
More informationIsolation, culture, and transfection of primary mammary epithelial organoids
Supplementary Experimental Procedures Isolation, culture, and transfection of primary mammary epithelial organoids Primary mammary epithelial organoids were prepared from 8-week-old CD1 mice (Charles River)
More informationRal Activation Assay Kit
Product Manual Ral Activation Assay Kit Catalog Number STA-408 20 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Small GTP-binding proteins (or GTPases) are a family of
More informationPlasmid DNA transfection of SW480 human colorectal cancer cells with the Biontex K2 Transfection System
Plasmid DNA transfection of human colorectal cancer cells with the Biontex K2 Transfection System Stephanie Hehlgans and Franz Rödel, Department of Radiotherapy and Oncology, Goethe- University Frankfurt,
More informationSupplementary Figure. S1
Supplementary Figure. S1 Supplementary Figure S1. Correlation of phagocytic ability measured with YG and YO beads. Fresh human monocytes (2 10 6 /ml) were labelled with APC conjugated anti CD14 mab alone
More informationOne-step split GFP staining for sensitive protein detection and localization in mammalian cells
Supplementary Materials For: One-step split GFP staining for sensitive protein detection and localization in mammalian cells Lara Kaddoum 1,3, Eddy Magdeleine 1,3, Geoffrey S. Waldo 4, Etienne Joly 1,3,
More informationRespiratory distress and early neonatal lethality in Hspa4l/Hspa4 double mutant mice
Respiratory distress and early neonatal lethality in Hspa4l/Hspa4 double mutant mice Belal A. Mohamed, Amal Z. Barakat, Torsten Held, Manar Elkenani, Christian Mühlfeld, Jörg Männer, and Ibrahim M. Adham
More informationSensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric*
Catalog # Kit Size SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric* AS-55550 One 96-well strip plate This kit is optimized to detect human/mouse/rat alpha-synuclein
More informationSupplemental Information. A Versatile Tool for Live-Cell Imaging. and Super-Resolution Nanoscopy Studies. of HIV-1 Env Distribution and Mobility
Cell Chemical Biology, Volume 24 Supplemental Information A Versatile Tool for Live-Cell Imaging and Super-Resolution Nanoscopy Studies of HIV-1 Env Distribution and Mobility Volkan Sakin, Janina Hanne,
More informationRho activation kit. Catalog Number: ADI-EKS-465. Table of Contents
Rho activation kit Catalog Number: ADI-EKS-465 Table of Contents Assay Design Page 1 Scientific Overview 2 Precautions 2 Materials Provided 3 Storage of Materials 3 Materials Required but Not Provided
More informationHow to run Alpha assay: How to setup an Alpha assay Make your own assay!
How to run Alpha assay: How to setup an Alpha assay Make your own assay! 1 2009 PerkinElmer AlphaLISA kits - recommendations before starting the assay Samples: Phenol red and hemoglobin: choose AlphaLISA
More informationThe ubiquitin ligase Rnf6 regulates local LIM kinase 1 levels in axonal growth cones
The ubiquitin ligase Rnf6 regulates local LIM kinase 1 levels in axonal growth cones Baris Tursun, 1,5 Anne Schlüter, 1,5 Marvin A. Peters, 1 Birte Viehweger, 1 Heather P. Ostendorff, 1 Juliana Soosairajah,
More informationCharacterization of Tau Isoforms Expressed in Cultured Human Cortical Neurons on Poly-L-lysine and Laminin Substrates
Characterization of Tau Isoforms Expressed in Cultured Human Cortical Neurons on Poly-L-lysine and Laminin Substrates Introduction Alzheimer s disease is characterized by two main lesions, extra-cellular
More informationRayBio Human, Mouse and Rat Phospho-STAT3 (Tyr705) ELISA Kit
RayBio Human, Mouse and Rat Phospho-STAT3 (Tyr705) ELISA Kit Catalog #: PEL-Stat3-Y705 User Manual Last revised August 10, 2016 Caution: Extraordinarily useful information enclosed ISO 13485 Certified
More informationDescription: Nuclear morphology and dynamics in nontargeting sirna transfected cells. HeLa Kyoto
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tables Title of file for HTML: Supplementary Movie 1 Description: Nuclear morphology and dynamics
More informationOPPF-UK Standard Protocols: Mammalian Expression
OPPF-UK Standard Protocols: Mammalian Expression Joanne Nettleship joanne@strubi.ox.ac.uk Table of Contents 1. Materials... 3 2. Cell Maintenance... 4 3. 24-Well Transient Expression Screen... 5 4. DNA
More informationmcherry Monoclonal Antibody (16D7) Catalog Number M11217 Product data sheet
Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 mcherry Monoclonal Antibody (16D7) Catalog Number M11217 Product data sheet Details
More informationTECHNICAL BULLETIN. Catalog Number RAB0012 Storage Temperature 20 C
Phospho-Akt (pser 473 )/pan-akt ELISA Kit for detection of human, mouse, or rat phospho-akt (pser 473 ) and pan-akt in cell and tissue lysates Catalog Number RAB0012 Storage Temperature 20 C TECHNICAL
More informationRayBio Phospho- Stat 3 (Tyr705) ELISA Kit
RayBio Phospho- Stat 3 (Tyr705) ELISA Kit For Measuring Phosphorylated Stat3 (Tyr705) in Human, Mouse and Rat Cell Lysates User Manual (Revised Mar 1, 2012) RayBio Stat3 (Tyr705) ELISA Kit Protocol (Cat#:
More informationRayBio Human NF-κB p65 Transcription Factor Activity Assay Kit
RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit Catalog #: TFEH-p65 User Manual Mar 13, 2017 3607 Parkway Lane, Suite 200 Norcross, GA 30092 Tel: 1-888-494-8555 (Toll Free) or 770-729-2992,
More informationRayBio Phospho- Akt (Ser473) ELISA Kit
RayBio Phospho- Akt (Ser473) ELISA Kit For Measuring Phosphorylated Akt (Ser473) in Human, Mouse and Rat Cell Lysates User Manual (Revised Mar 1, 2012) RayBio Akt (Ser473) ELISA Kit Protocol (Cat#: PEL-Akt-S473-001)
More informationRayBio Human, Mouse and Rat Phospho-STAT3 (Tyr705) and Total STAT3 ELISA Kit
RayBio Human, Mouse and Rat Phospho-STAT3 (Tyr705) and Total STAT3 ELISA Kit Catalog #: PEL-Stat3-Y705-T User Manual Last revised October 10, 2017 Caution: Extraordinarily useful information enclosed ISO
More informationFigure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.
/ 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG
More informationTransfection of Mouse ES Cells and Mouse ips cells using the Stemfect 2.0 -mesc Transfection Reagent
APPLICATION NOTE Page 1 Transfection of Mouse ES Cells and Mouse ips cells using the Stemfect 2.0 -mesc Transfection Reagent Authors: Amelia L. Cianci 1, Xun Cheng 1 and Kerry P. Mahon 1,2 1 Stemgent Inc.,
More informationMATERIAL DATA SHEET. NOTE: Kit contains reagents sufficient for 10 x 30 μl reactions and 5 Western Blots (minigel. Reagents Provided in Kit
Lot # XXXXX ITCH/AIP4 Ubiquitin Ligase Kit Cat. # K-270 MATERIAL DATA SHEET The mammalian Itchy homolog, or ITCH, (also known as Atrophin-1-interacting protein 4 or AIP4) is a HECT domain class ubiquitin
More informationTechnical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD
Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD Developed for: Aerius, Odyssey Classic, Odyssey CLx and Odyssey Sa Imaging Systems
More informationProtocols for Neural Progenitor Cell Expansion and Dopaminergic Neuron Differentiation
Protocols for Neural Progenitor Cell Expansion and Dopaminergic Neuron Differentiation In vitro neurological research presents many challenges due to the difficulty in establishing high-yield neuronal
More informationSupplemental Information. Loss of MicroRNA-7 Regulation Leads. to a-synuclein Accumulation and. Dopaminergic Neuronal Loss In Vivo
YMTHE, Volume 25 Supplemental Information Loss of MicroRNA-7 Regulation Leads to a-synuclein Accumulation and Dopaminergic Neuronal Loss In Vivo Kirsty J. McMillan, Tracey K. Murray, Nora Bengoa-Vergniory,
More informationCycles of vascular plexus formation within the nephrogenic zone of the developing mouse kidney
1 Supplementary text and data for: 2 3 4 5 Cycles of vascular plexus formation within the nephrogenic zone of the developing mouse kidney Authors: David A. D. Munro 1*, Peter Hohenstein 2, and Jamie A.
More informationAzure Biosystems Western Blotting Workflow
Azure Biosystems Western Blotting Workflow PROBE PLAN SEPARATE ANALYZE VISUALIZE PLAN Plan your experiment and choose your detection method Chemiluminescent Western Blotting The most common method for
More informationPlease read manual carefully before starting experiment
RayBio Cell-Based Phosphorylation ELISA Kit - Preliminary For the semi-quantitative detection of both phosphorylated and pan human, mouse or rat proteins in adherent whole cell lines. User Manual (Revised
More informationTECHNICAL BULLETIN. Color. Fig.1. Cell-Based protein phosphorylation procedure
Cell-Based ELISA Kit for detecting phospho-stat3 (ptyr 705 ) in cultured cell lines adequate for 96 assays (1 96 well plate) Catalog Number RAB0444 Storage Temperature 20 C TECHNICAL BULLETIN Product Description
More informationAssembly of synapses by neuronal adhesion molecules: single molecule studies
Assembly of synapses by neuronal adhesion molecules: single molecule studies Olivier Thoumine Interdisciplinary Institute of Neurosciences CNRS - University of Bordeaux Connectivity in the brain 300 nm
More informationRNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,
Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5
More informationSupporting Information
Supporting Information Shao et al. 10.1073/pnas.1504837112 SI Materials and Methods Immunofluorescence and Immunoblotting. For immunofluorescence, cells were fixed with 4% paraformaldehyde and permeabilized
More informationQS S Assist KINASE_MSA Kit
QS S Assist KINASE_MSA Kit Description KINASE MSA Kit is designed for use in pharmacological assays for KINASE based on Off-chip mobility shift assay (MSA). This kit includes Assay Buffer, Termination
More informationEdU Flow Cytometry Kit. User Manual
User Manual Ordering information: (for detailed kit content see Table 2) EdU Flow Cytometry Kits for 50 assays: Product number EdU Used fluorescent dye BCK-FC488-50 10 mg 6-FAM Azide BCK-FC555-50 10 mg
More informationAcetylated Microtubules Are Preferentially Bundled Leading to Enhanced
Biophysical Journal, Volume 113 Supplemental Information Acetylated Microtubules Are Preferentially Bundled Leading to Enhanced Kinesin-1 Motility Linda Balabanian, Christopher L. Berger, and Adam G. Hendricks
More informationReal-time 96-well antibody internalization assays using IncuCyte FabFluor Red Antibody Labeling Reagent
Nicola Bevan, Tim Dale, Del Trezise Essen BioScience Welwyn Garden City, Hertfordshire, UK Introduction Monoclonal antibodies are now widely used as anti-cancer, antiinflammatory and anti-viral therapeutic
More informationSupplementary Information
Journal : Nature Biotechnology Supplementary Information Targeted genome engineering in human cells with RNA-guided endonucleases Seung Woo Cho, Sojung Kim, Jong Min Kim, and Jin-Soo Kim* National Creative
More informationEPIGENTEK. EpiQuik In Situ Histone H3-K27 Tri-Methylation Assay Kit. Base Catalog # P-3014T PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE
EpiQuik In Situ Histone H3-K27 Tri-Methylation Assay Kit Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik In Situ Histone H3-K27 Tri-Methylation Assay Kit is suitable for specifically
More informationSUPPLEMENTARY MATERIAL
SUPPLEMENTARY MATERIAL Materials and Methods Circular dichroism (CD) spectroscopy. Far ultraviolet (UV) CD spectra of apo- and holo- CaM and the CaM mutants were recorded on a Jasco J-715 spectropolarimeter
More informationProtein Purification Products. Complete Solutions for All of Your Protein Purification Applications
Protein Purification Products Complete Solutions for All of Your Protein Purification Applications FLAG-Tagged Protein Products EXPRESS with the pcmv-dykddddk Vector Set Fuse your protein of interest to
More informationamaxa Peptide Transfection Control 2-3 Product specifications 2 Storage and stability 3 Product use limitations 3 Intended use 3
Contents amaxa Peptide Transfection Control 2-3 Product specifications 2 Storage and stability 3 Product use limitations 3 Intended use 3 Background Information 4 Cell culture 4 Supporting Data 5-8 Equipment
More informationPARP-1 (cleaved) Human In-Cell ELISA Kit (IR)
ab110215 PARP-1 (cleaved) Human In-Cell ELISA Kit (IR) Instructions for Use For the quantitative measurement of Human PARP-1 (cleaved) concentrations in cultured adherent and suspension cells. This product
More informationCFTR 2 is a phosphorylation-activated Cl channel expressed at the apical membranes of epithelial cells that are involved in salt secretion or
THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 281, NO. 16, pp. 11312 11321, April 21, 2006 2006 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A. Cysteine String Protein
More informationLab Module 7: Cell Adhesion
Lab Module 7: Cell Adhesion Tissues are made of cells and materials secreted by cells that occupy the spaces between the individual cells. This material outside of cells is called the Extracellular Matrix
More informationToll Receptor-Mediated Hippo Signaling Controls Innate Immunity in Drosophila
Cell Supplemental Information Toll Receptor-Mediated Hippo Signaling Controls Innate Immunity in Drosophila Bo Liu, Yonggang Zheng, Feng Yin, Jianzhong Yu, Neal Silverman, and Duojia Pan Supplemental Experimental
More informationImmunostaining Protocols
Immunostaining Protocols Lula L. Hilenski, Ph.D. Director Microscopy in Medicine Core Emory University Variables in standard immunostaining protocol 2-step or indirect immunofluorescence 1. Substrate on
More informationAssays for studying mitochondrial health and function
APPLICATION NOTE Fluorescence labeling and detection Assays for studying mitochondrial health and function Introduction Mitochondria play a critical role in maintaining normal cellular activities. Mitochondria
More informationIdentification of Phosphotyrosine Binding Domain-Containing Proteins as Novel Downstream Targets of the EphA8 Signaling Function
MOLECULAR AND CELLULAR BIOLOGY, Dec. 2007, p. 8113 8126 Vol. 27, No. 23 0270-7306/07/$08.00 0 doi:10.1128/mcb.00794-07 Copyright 2007, American Society for Microbiology. All Rights Reserved. Identification
More informationNTM486-04, NTM174-04,
Transfection of transformed human trabecular meshwork TM5, and primary human NTM210-05, NTM486-04, NTM174-04, and NTM153-00 cells with Metafectene Easy Adnan Dibas1A,C, Ming Jiang1A,C, Thomas Yorio1A,C.
More informationLDH-Cytotoxicity Assay Kit II
LDH-Cytotoxicity Assay Kit II Catalog Number KA0786 500 assays Version: 08 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information... 4 Materials
More informationRayBio Rat IL-6 ELISA Kit (For Lysates)
RayBio Rat IL-6 ELISA Kit (For Lysates) Catalog #: ELR-IL6-CL User Manual Last revised April 15, 2016 Caution: Extraordinarily useful information enclosed ISO 13485 Certified 3607 Parkway Lane, Suite 100
More informationover time using live cell microscopy. The time post infection is indicated in the lower left corner.
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Supplementary Movie 1 Description: Fusion of NBs. BSR cells were infected
More informationTECHNICAL BULLETIN. Color. Fig.1. Cell-Based protein phosphorylation procedure
Cell-Based ELISA Sampler Kit for detecting phospho-erk1/2 (pthr 202 /ptyr 204 ), phospho-jnk (pthr 183 /ptyr 185 ), and phospho-p38 MAPK (pthr 180 /ptyr 182 ) in cultured cell lines adequate for 192 assays
More informationDifferent Potential of Extracellular Vesicles to Support Thrombin Generation: Contributions of Phosphatidylserine, Tissue Factor, and Cellular Origin
Different Potential of Extracellular Vesicles to Support Thrombin Generation: Contributions of Phosphatidylserine, Tissue Factor, and Cellular Origin Carla Tripisciano 1, René Weiss 1, Tanja Eichhorn 1,
More informationQS S Assist STK_FP Kit
QS S Assist STK_FP Kit Description STK FP kit is designed for use in pharmacological assays for STK based on fluorescence polarization. The kit includes assay buffer, human protein kinase, ATP/fluorescence-
More informationSupplementary Figures and Legends
Supplementary Figures and Legends Figure S1. Tests of the optical alignment and focal properties of the confocal microscope. (A) Images of the optical cross-section of fluorescent microspheres differing
More informationViral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover
Supplementary Data Viral RNAi suppressor reversibly binds sirna to outcompete Dicer and RISC via multiple-turnover Renata A. Rawlings 1,2, Vishalakshi Krishnan 2 and Nils G. Walter 2 * 1 Biophysics and
More informationAnti-Asian Sea bass (Lates calcarifer) IgM monoclonal antibody labelled with horseradish peroxidase. Product no: C2-HRP
Anti-Asian Sea bass (Lates calcarifer) IgM monoclonal antibody labelled with horseradish peroxidase Product no: C2-HRP Product Description This monoclonal antibody (Mab) reacts with Asian Sea bass (Lates
More informationIdentification of red and white blood cells from whole blood samples using the Agilent 2100 bioanalyzer. Application Note
Identification of red and white blood cells from whole blood samples using the Agilent 2100 bioanalyzer Application Note Sylvie Veriac Valérie Perrone Madeleine Avon Abstract Agilent Equipment: 2100 bioanalyzer
More informationMSD Immuno-Dot-Blot Assays. A division of Meso Scale Diagnostics, LLC.
MSD Immuno-Dot-Blot Assays Example: High Throughput Western Blots Replacements Traditional Western Blots High content Molecular weight and immunoreactivity Labor and protein intensive Inherently low throughput
More informationSupporting Information
Supporting Information Cieslewicz et al. 10.1073/pnas.1312197110 SI Results Human and mouse lesions of atherosclerosis contain both M1 and M2 macrophage phenotypes (1, 2). Previous work has suggested the
More informationXfect Protein Transfection Reagent
Xfect Protein Transfection Reagent Mammalian Expression Systems Rapid, high-efficiency, low-toxicity protein transfection Transfect a large amount of active protein Virtually no cytotoxicity, unlike lipofection
More informationSupplementary Information
Supplementary Information Supplementary Figure 1. ZBTB20 expression in the developing DRG. ZBTB20 expression in the developing DRG was detected by immunohistochemistry using anti-zbtb20 antibody 9A10 on
More informationUse of Phase Contrast Imaging to Track Morphological Cellular Changes due to Apoptotic Activity
A p p l i c a t i o n N o t e Use of Phase Contrast Imaging to Track Morphological Cellular Changes due to Apoptotic Activity Brad Larson and Peter Banks, Applications Department, BioTek Instruments, Inc.,
More informationAutomated Protocol for ANTI-FLAG High Sensitivity, M2 coated 96-well plate Using the Sciclone ALH 3000 Workstation (Caliper Life Sciences)
Automated Protocol for ANTI-FLAG High Sensitivity, M2 coated 96-well plate Using the Sciclone ALH 3000 Workstation (Caliper Life Sciences) ANTI-FLAG High Sensitivity, M2 coated 96-well plate P 2983 Automation
More informationNotes to accompany the slidecast on theory of SDS PAGE and Western blotting
S317 Biological science: from genes to species Notes to accompany the slidecast on theory of SDS PAGE and Western blotting SDS PAGE SDS PAGE is a standard technique for determining the molecular size of
More information