Sadaf Haghiri PhD student at Environmental engineering faculty Middle East Technical University. Supervisor: Assoc. Prof. Dr.

Similar documents
Supplementary. Table 1: Oligonucleotides and Plasmids. complementary to positions from 77 of the SRα '- GCT CTA GAG AAC TTG AAG TAC AGA CTG C

Lecture 10, 20/2/2002: The process of solution development - The CODEHOP strategy for automatic design of consensus-degenerate primers for PCR

Supplemental Data Supplemental Figure 1.

Figure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis

Supporting information for Biochemistry, 1995, 34(34), , DOI: /bi00034a013

Supplementary Information. Construction of Lasso Peptide Fusion Proteins

Electronic Supplementary Information

Hes6. PPARα. PPARγ HNF4 CD36

Supplementary Figure 1A A404 Cells +/- Retinoic Acid

PGRP negatively regulates NOD-mediated cytokine production in rainbow trout liver cells

Y-chromosomal haplogroup typing Using SBE reaction

ΔPDD1 x ΔPDD1. ΔPDD1 x wild type. 70 kd Pdd1. Pdd3

Supplemental Data. mir156-regulated SPL Transcription. Factors Define an Endogenous Flowering. Pathway in Arabidopsis thaliana

Arabidopsis actin depolymerizing factor AtADF4 mediates defense signal transduction triggered by the Pseudomonas syringae effector AvrPphB

Disease and selection in the human genome 3

Supporting Information

Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC

SUPPORTING INFORMATION

Table S1. Bacterial strains (Related to Results and Experimental Procedures)

II 0.95 DM2 (RPP1) DM3 (At3g61540) b

Materials Protein synthesis kit. This kit consists of 24 amino acids, 24 transfer RNAs, four messenger RNAs and one ribosome (see below).

Supplemental Data. Bennett et al. (2010). Plant Cell /tpc

NAME:... MODEL ANSWER... STUDENT NUMBER:... Maximum marks: 50. Internal Examiner: Hugh Murrell, Computer Science, UKZN

Supplemental material

Overexpression Normal expression Overexpression Normal expression. 26 (21.1%) N (%) P-value a N (%)

Supporting Online Information

ORFs and genes. Please sit in row K or forward

Supplementary Materials for

Dierks Supplementary Fig. S1

PCR analysis was performed to show the presence and the integrity of the var1csa and var-

hcd1tg/hj1tg/ ApoE-/- hcd1tg/hj1tg/ ApoE+/+

Multiplexing Genome-scale Engineering

Supplemental Information. Human Senataxin Resolves RNA/DNA Hybrids. Formed at Transcriptional Pause Sites. to Promote Xrn2-Dependent Termination

Supplementary Figures

Lecture 11: Gene Prediction

Supporting Information

G+C content. 1 Introduction. 2 Chromosomes Topology & Counts. 3 Genome size. 4 Replichores and gene orientation. 5 Chirochores.

Supplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR

Homework. A bit about the nature of the atoms of interest. Project. The role of electronega<vity

SUPPLEMENTARY INFORMATION

SUPPORTING INFORMATION FILE

Supplemental Table 1. Primers used for PCR.

Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH).

Quantitative reverse-transcription PCR. Transcript levels of flgs, flgr, flia and flha were

Search for and Analysis of Single Nucleotide Polymorphisms (SNPs) in Rice (Oryza sativa, Oryza rufipogon) and Establishment of SNP Markers

RPA-AB RPA-C Supplemental Figure S1: SDS-PAGE stained with Coomassie Blue after protein purification.

S4B fluorescence (AU)

SAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer

Supporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2006

Complexity of the Ruminococcus flavefaciens FD-1 cellulosome reflects an expansion of family-related protein-protein interactions

Table S1. Sequences of mutagenesis primers used to create altered rdpa- and sdpa genes

Gene synthesis by circular assembly amplification

Supplementary Methods Quantitative RT-PCR. For mrna, total RNA was prepared using TRIzol reagent (Invitrogen) and genomic DNA was eliminated with TURB

SUPPLEMENTARY MATERIALS

evaluated with UAS CLB eliciting UAS CIT -N Libraries increase in the

11th Meeting of the Science Working Group. Lima, Peru, October 2012 SWG-11-JM-11

2

Anti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR

Appendix 1a. Microsatellite analysis of P1-hyg, P2-neo and their. Amplified cdna (base pairs) P1-hyg P2-neo All progeny A A

Supplemental Information. Target-Mediated Protection of Endogenous. MicroRNAs in C. elegans. Inventory of Supplementary Information

BioInformatics and Computational Molecular Biology. Course Website

SUPPLEMENTAL MATERIAL GENOTYPING WITH MULTIPLEXING TARGETED RESEQUENCING

The B1 Protein Guides the Biosynthesis of a Lasso Peptide

strain devoid of the aox1 gene [1]. Thus, the identification of AOX1 in the intracellular

Supplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of

for Programmed Chemo-enzymatic Synthesis of Antigenic Oligosaccharides

Protein Structure Analysis

National PHL TB DST Reference Center PSQ Reporting Language Table of Contents

Supplementary Material and Methods

Supporting Information

SUPPLEMENTAL TABLE S1. Additional descriptions of plasmid constructions and the oligonucleotides used Plasmid or Oligonucleotide

Primer Design Workshop. École d'été en géné-que des champignons 2012 Dr. Will Hintz University of Victoria

PCR-based Markers and Cut Flower Longevity in Carnation

Codon Bias with PRISM. 2IM24/25, Fall 2007

Legends for supplementary figures 1-3

MacBlunt PCR Cloning Kit Manual

Lecture 19A. DNA computing

A green method of staining DNA in polyacrylamide gel electrophoresis based on fluorescent copper nanoclusters synthesized in situ

NESTED Sequence-based Typing (SBT) protocol for epidemiological typing of Legionella pneumophila directly from clinical samples

Nature Genetics: doi: /ng Supplementary Figure 1

Supplemental Data. Jones et al. Plant Cell. (2010) /tpc

Converting rabbit hybridoma into recombinant antibodies with effective transient production in an optimized human expression system

Supplemental Figure 1 Real-time RT-PCR analysis of 16 genes other than those shown in Fig. 6C.

DNA sentences. How are proteins coded for by DNA? Materials. Teacher instructions. Student instructions. Reflection

Supplemental Data. Distinct Pathways for snorna and mrna Termination

Cat. # Product Size DS130 DynaExpress TA PCR Cloning Kit (ptakn-2) 20 reactions Box 1 (-20 ) ptakn-2 Vector, linearized 20 µl (50 ng/µl) 1

A Genetically Encoded Toolbox for Glycocalyx Engineering: Tunable Control of Cell Adhesion,

FAT10 and NUB1L bind the VWA domain of Rpn10 and Rpn1 to enable proteasome-mediated proteolysis

Supplementary Information

-15 diopter negative lenses in wild-type and homozygous CHRM2-deleted mice, and

Supplementary Figure 1. The level of pri-mir-8 gradually decreases while those of BR-C and E74 increase during 3rd instar larval development.

Dynamic enhancer-gene body contacts during transcription elongation

Marcos-Ramiro et al., http :// /cgi /content /full /jcb /DC1

An evolutionarily conserved negative feedback mechanism in the hippo pathway reflects functional difference between LATS1 and LATS2

Supporting Information

Supporting Information. Table of Contents

Engineering Escherichia coli for production of functionalized terpenoids using plant P450s

Det matematisk-naturvitenskapelige fakultet

Efficient genome replication of hepatitis B virus using adenovirus vector: a compact pregenomic RNA-expression unit

Phosphate and R2D2 Restrict the Substrate Specificity of Dicer-2, an ATP- Driven Ribonuclease

Transcription:

Sadaf Haghiri PhD student at Environmental engineering faculty Middle East Technical University Supervisor: Assoc. Prof. Dr. Bülent İçgen October 2016

2 Outline Intoduction Motivation for this research and background Aim of this study Methods and materials Results so far

Discharg or reuse of municipal waste water Introduction 3

4 Sludge Treatment Raw sludge or non-stabilized sludge tends to acidify digestion and produces odor. Stabilization to stop natural fermentation by converting its organic materials to water and biogas.

Treatment of Sludge 5

Anaerobic digestion process Anaerobic digestion is a bacterial process that is carried out in the absence of oxygen. The sludge is fed into large tanks and held for a minimum of 12 days to allow the digestion process to perform the four stages necessary to digest the sludge. 6

7 Upgrading anaerobic digestion pre-treatment: Limitation in digester: Slow rate of hydrolytic step, which is leading to slow degradation of the organic matter and high retention time. Solution: Use of chemical disintegration method: ozonation pre-treatment.

Upgrading anaerobic digestion phase seperation: Limitation in digester: In a single-stage system the prevailing ph (7 8) favours the methanogenic archaea, leading to non-optimum growth conditions for acidifying hydrolytic bacteria. Solution: Separation of process phases, where reactor parameters such as ph can be optimized for each phase to suit requirements of the microorganisms. 8

Evaluation of enhancement methods 9 Limitation in digester: Difficulty in getting information about dynamic of microorganisms population during the digestion. Solution: Use of molecular technique in biotechnology

Fluorescence in situ Hybridization (FISH) 10

Microorganisms and Oligonucleotides probes used in this study Groups Target organisms Probe Sequence (5' 3') DSM-No. Acidogenic Acetogenic sulfur reducing bacteria Denitrifiers Methanogenic bacteria Acidobacteria HoAc1402 5'- CTT TCG TGA TGT GAC GGG -3' DSM-22465 Acidobacteria SS_HOL1400 5'- TTC GTG ATG TGA CGG GC -3' DSM-22743 Clostridium CLOST 5'- CAG GAG ATG TCA AGT CTA GG -3' DSM-10612 Actinobacteria Actino-221 5'- CGC AGG TCC ATC CCA GAC -3' DSM-20639 Flavobacterium CFB563 5'- GGA CCC TTT AAA CCC AAT -3' DSM-18451 Syntrophobacterales DSBAC355 5'- GCG CAA AAT TCC TCA CTG -3' DSM-10017 Thermacetogenium GTAG992 5'- CCAGGTCCGCAGAGATGTCA-3' DSM-26808 Syntrophobacter SYN835 5'-GCA GGA ATG AGT ACC CGC-3' DSM-2805 Tepidanaerobacter GTE1002 5'- TCCGTTTCCGGTCTCTACCA-3' DSM-21804 Acetobacteraceae Aceto3B 5'- CAA CAT CCA GCA CAC ATC GT -3' DSM-8909 Desulfovibrio sp. DSV687 5'- TAC GGA TTT CAC TCC T -3' DSM-2480 Desulfobacter sp. DSB129 5'- CAG GCT TGA AGG CAG ATT -3' DSM-17510 Desulfobulbus sp. DBB660 5'- GAA TTC CAC TTT CCC CTC TG -3' DSM-10215 Desulfosarcina variabilis DSC193 5'- AGG CCA CCC TTG ATC CAA -3' DSM-2060 Desulfococcus multivorans DCC209 5'- CCC AAA CGG TAG CTT CCT -3' DSM-2059 Desulfuromonas acetexigens SRB385Db 5'- CGG CGT TGC TGC GTC AGG -3' DSM-1397 Pseudomonas sp. Pae997 5'- TCT GGA AAG TTC TCA GCA -3' DSM-1110 Achromobacter ACH221 5'- CGC TCY AAT AGT GCA AGG TC -3' DSM-21681 Bacillus Bmy843 5'- CTT CAG CAC TCA GGT TCG -3' DSM-4337 Acetate-denitrifying cluster DEN124 5'- CGA CAT GGG CGC GTT CCG AT -3' DSM-14793 Acetate-denitrifying cluster DEN581 5'- TGT CTT ACT AAA CCG CCT GC -3' DSM-5691 Methanobacteriales MB311 5'- ACC TTG TCT CAG GTT CCA TCT CC -3' DSM-2257 Methanomicrobials MG1200 5'- CRG ATA ATT CGG GGC ATG CTG -3' DSM-1539 Methanosarcina MS821 5'- CGC CAT GCC TGA CAC CTA GCG AGC -3' DSM-2256 Methanosaeta MX825 5'-TCG CAC CGT GGC CGA CAC CTA GC-3 DSM-17206 Archaea Archaea ARC 915 5'-GTG CTC CCC CCG CCA ATT CCT-3' DSM-17251

Representative images of FISH analysis Results A1 A2 A1) Bacillus (DSM-4337) 35% formamide, stained with DAPI. A2) Bacillus (DSM-4337) 35% formamide, stained with FITC labeled probe. 12

Representative images of FISH analysis B1 B2 B1) syntrophobacter (DSM-10017) 30% formamide, stained with DAPI. B2) syntrophobacter (DSM-10017) 30% formamide, stained with FITC labeled probe. 13

Novelty and background: 14 Most researchers have focused on the optimization of gas production, removal of organic matter and optimization of process. however there is no detailed report on the topic of microbial population dynamics involved during use of ozone pre- treatment process in one-stage digetion Previous studies on two-stage digestion have focused on novel equipment testing and hydrogen production and increase in energy yields at a similar retention time for food wastes. The literature is very sparse in contrasting one and two-stage digestion. There is no investigation about use of chemical (ozonation) pre-treatment in phase seperated anaerobic digestions.

This study aims at 15 1. Monitoring the impact of ozone pre-treatments on the microbial population dynamics and biogas production (single-stage anaerobic digester) 2. determining appropriate ozone dose as pre-treatment (single-stage anaerobic digester) 3. Determined optimum ozone dose will be applied as pre-treatment, to two-stage anaerobic digester and The microbial population dynamics and biogas production will be observed. 4. Finally, the study will be usefull for comperative analysis of effect of ozone pretreatment in terms of microbial flora and biogas production in single and twostage anaerobic digesters.

Anaerobic sludge culture and feedstock Method Anaerobic sludge culture of the reactors will be collected from Return Activated Sludge of anaerobic digester line of the Tatlar Wastewater Treatment Plant, Ankara Wastes used to feed the reactors will be obtained from a VRM wastewater treatment plant (vacuum rotation membrane) located in Middle East Technical University, Ankara. 16

Feedstock Method The reactors will be fed semi-continuously and pre-treatment will be implemented in different doses of ozonation for each reactor OSC-Modular 4HC, WEDECO ITT INDUSTRIES (2007) ozone generator 17

The schematic flow diagram, first part of experiment (one-stage digestion) 18

The schematic flow diagram,second part of experiment (two-stage digestion) 19

Measurement on a regular basis: total solids (TS) Total suspended sulids (TSS) volatile suspended solids(vss) total gas volume (TG) chemical oxygen demand (COD) ph CH4 percentage 20

Results 21 What have been done so far 1. Ordering the pure culture of bacterias. 2. Ordering the specific pobes for bacterias 3. Optimization of fluorescence in situ hybridization for pure culture of targeted bacteria. 4. Conducting the one and two-stage reactors set ups...on going

Thank you. 22