Supplementary Materials for Applied Microbiology and Biotechnology Novel zero-valent iron assembled reactor for strengthening anammox performance under low temperature Long-Fei Ren a, b, #, Lu Lv a, #, Jian Zhang a, Baoyu Gao a, Shou-Qing Ni a, *, Ning Yang a, Qingxin Zhou c, Xiaoyong Liu c a Shandong Provincial Key Laboratory of Water Pollution Control and Resource Reuse, School of Environmental Science and Engineering, Shandong University, No. 27 Shanda South Road, Jinan 250100, Shandong, PR China. b School of Environmental Science and Engineering, Shanghai Jiao Tong University, No. 800 Dongchuan Road, Shanghai 200240, Shanghai, PR China. c Institute of Agro-Food Science and Technology, Shandong Academy of Agricultural Sciences, Jinan 250100, PR China. # These authors contributed equally to this work and share the first authorship. *Correspondence to: Shou-Qing Ni, School of Environmental Science and Engineering, Shandong University, Jinan, Shandong, PR China, 250100. E-mail: sqni@sdu.edu.cn. Phone and Fax numbers: 86-0531-88365660. Number of pages: 10 (including cover page) Number of figures and tables: 8 1
Fig. S1 Schematic diagram of ZVI strengthened anammox process. 2
Fig. S2 Picture of sponge iron assembled in R1 and SEM image of milled sponge iron used in batch test. 3
Fig. S3-1 The amplification curves of anammox 16S rrna genes in R1 (red) and R0 (blue). Fig. S3-2 The amplification curves of nirs genes in R1 (red) and R0 (blue). Fig. S3-3 The amplification curves of nirk genes in R1 (red) and R0 (blue). 4
Fig. S4 The fitting functions of nitrogen removal performance of R1 and R0 under sudden increased NLR. R1: Ammonium removal efficiency = 2.3087 * Days - 290.97, R² = 0.9809, Nitrite removal efficiency = 2.5609 * Days - 325.74, R² = 0.9715; R0: Ammonium removal efficiency = 1.8929 * Days - 238.24, R² = 0.9873, Nitrite removal efficiency = 1.9031 * Days - 235.1, R² = 0.9858. 5
Table S1 Properties of the sponge iron used in this study. Index Property Component Fe 88%, SiO 2 +Al 2 O 3 5.5%, S 0.03%, Cu 0.002%, Bi 0.002%, Cu 0.002% Volume weight 2.2 g/cm 3 Compressive strength 1500 N/T Corrosion resistance 3.4 Specific surface area 85 g/cm 3 6
Table S2 Primers of target genes used in qpcr analysis. Target genes Primers Primer sequence (5-3 ) anammox AMX809F GCCGTAAACGATGGGCACT 16S rrna AMX1066R AACGTCTCACGACACGAGCTG nirs nirscd3af GT(C/G)AACGT(C/G)AAGGA(A/G)AC(C/G)GG nirsr3cd GA(C/G)TTCGG(A/G)TG(C/G)GTCTTGA nirk nirk583f TCA TGGTGCTGCCGCGKGACGG nirk909r GAA CTTGCCGGTKGCCCAGAC 7
Target genes anammox 16S rrna Table S3 Programs of target genes used in qpcr analysis. Primer Primer sequence (5-3 ) 0.4 µl nirs 0.4 µl nirk 0.2 µl Pre-heating (50 C, 2 min), pre-denaturation (95 C, 10 min), denaturation (95 C, 15 s), annealing (56 C, 45 s), and extension (72 C, 30 s). Pre-heating (50 C, 2 min), pre-denaturation (95 C, 10 min), denaturation (95 C, 15 s), annealing (57 C, 30 s), and extension (72 C, 30 s). Pre-heating (50 C, 2 min), pre-denaturation (95 C, 10 min), denaturation (95 C, 15 s), annealing (64 C, 40 s), and extension (72 C, 30 s). 8
Table S4 Comparison of different anammox reactors under similar low temperature. Reactor type V (L) SBR 1 UASB 8 UASB 2.5 UASB 1 UASB 1 SBR b 1 Source activated activated anammox anammox anammox anammox Dosage Operation condition Maximal Maximal T References (VSS mg/l) Ammonium (mg/l) Nitrite (mg/l) HRT (hour) NRR (mg N/L/d) NRR/NLR (%) ( o C) 150 150 24 290 100 a 18 Dosta et al. 16.9 20.5 0.3 2280 16 Ma et al. 22500 280 280 4 4520 84.8 10.7-21.6 Guo et al. 82000 5490 65 14.8 Yu et al. 3420 280 280 1 8200 63.1 12.8±1 Jin et al. Vazquez- 1500 700 0 6 200 28.6 15 Padın et al. De Clippeleir RBC c 2.5 60 0 1.57±0.02 529 36±9 15±0.8 et al. UASB mixed 3 (R1) 11660 252 302.7 12 960 86.7 10-15 This study UASB mixed 3 (R0) 11660 252 302.7 12 760 68.5 10-15 This study a : NLR and NRR was calculated only including ammonium and nitrite. b : The CANON process was performed in this SBR. c : The OLAND process was performed in this RBC. References: Dosta, J., Fernandez, I., Vazquez-Padin, J., Mosquera-Corral, A., Campos, J., Mata-Alvarez, J., Mendez, R. 2008. Short-and long-term effects of temperature on the Anammox process. Journal of Hazardous Materials, 154(1), 688-693. Ma, B., Peng, Y.-Z., Zhang, S.-J., Wang, J.-M., Gan, Y.-P., Chang, J., Wang, S.-Y., Wang, S.-Y., Zhu, G.-B. 2013. Performance of anammox UASB reactor treating low strength wastewater under moderate and low temperatures. Bioresource Technology, 129, 606-611. Guo, Q., Xing, B.-S., Li, P., Xu, J.-L., Yang, C.-C., Jin, R.-C. 2015. Anaerobic ammonium oxidation (anammox) under realistic seasonal temperature variations: Characteristics of biogranules and process performance. Bioresource Technology, 192, 765-773. 9
Yu, J.-J., Chen, H., Zhang, J., Ji, Y.-X., Liu, Q.-Z., Jin, R.-C. 2013. Enhancement of ANAMMOX activity by low-intensity ultrasound irradiation at ambient temperature. Bioresource Technology, 142, 693-696. Jin, R.-C., Ma, C., Yu, J.-J. 2013. Performance of an Anammox UASB reactor at high load and low ambient temperature. Chemical Engineering Journal, 232, 17-25. Vazquez-Padın, J., Fernandez, I., Morales, N., Campos, J., Mosquera-Corral, A., Méndez, R. 2011. Autotrophic nitrogen removal at low temperature. Water Science & Technology, 9(63.6), 9. De Clippeleir, H., Vlaeminck, S.E., De Wilde, F., Daeninck, K., Mosquera, M., Boeckx, P., Verstraete, W., Boon, N. 2013. One-stage partial nitritation/anammox at 15 C on pretreated sewage: feasibility demonstration at lab-scale. Applied Microbiology and Biotechnology, 97(23), 10199-10210. 10