of Medicine, Zhejiang University, Hangzhou, Zhejiang , China Michigan, 4424B MS-1, 1301 Catherine Street, Ann Arbor, MI 48109, USA.

Similar documents
Inhibition of Twist1 mediated invasion by Chk2 promotes premature senescence in p53 defective cancer cells

SUPPLEMENTARY INFORMATION

Supplemental Figure 1: CIP2A and SET levels are increased in some. primary human pancreatic cancer samples. (A) CIP2A mrna levels were

MEFs were treated with the indicated concentrations of LLOMe for three hours, washed

Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan).

B. ADM: C. D. Apoptosis: 1.68% 2.99% 1.31% Figure.S1,Li et al. number. invaded cells. HuH7 BxPC-3 DLD-1.

Journal of Cell Science Supplementary Material

MiR-150 promotes cellular metastasis in non-small cell lung cancer by targeting

Supplementary Figures and Legends.

Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.


Supplementary Material. TRIB3 inhibits proliferation and promotes osteogenesis in hbmscs by regulating the. ERK1/2 signaling pathway

Isolation, culture, and transfection of primary mammary epithelial organoids

Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and

Supplementary Material: Peroxisomes protect lymphoma cells from HDAC inhibitor-mediated apoptosis

JCB. Supplemental material THE JOURNAL OF CELL BIOLOGY. Kimura et al.,

Supplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators.

cells (MLEC) that produce luciferase under the control of the PAI-1 promoter in response to

(a) Immunoblotting to show the migration position of Flag-tagged MAVS

Utility of the dual-specificity protein kinase TTK as a therapeutic target

Supplementary information for: Ten-Eleven Translocation-2 (Tet2) Is Involved in Myogenic Differentiation of Skeletal Myoblast Cells in

Resveratrol inhibits epithelial-mesenchymal transition of retinal. pigment epithelium and development of proliferative vitreoretinopathy

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna

0.9 5 H M L E R -C tr l in T w is t1 C M

Supplementary Figure 1. ERK signaling is not activated at early hypertension. a, Western blot analysis for the level of phospho-erk (perk) and total

supplementary information

Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas.

Li et al., Supplemental Figures

SUPPLEMENTARY INFORMATION

Table 1. Primers, annealing temperatures, and product sizes for PCR amplification.

Stabilization of the Transcription Factor Foxp3 by the Deubiquitinase USP7 Increases Treg-Cell-Suppressive Capacity

Supplementary Figure 1. Intracellular distribution of the EPE peptide. HeLa cells were serum-starved (16 h, 0.1%), and treated with EPE peptide,

Supplementary Figure 1. Co-localization of GLUT1 and DNAL4 in BeWo cells cultured

Cancer cells that survive radiation therapy acquire HIF-1 activity and translocate toward tumor blood vessels Supplementary Information

Supplementary Information

Supplemental Table/Figure Legends

Single cell resolution in vivo imaging of DNA damage following PARP inhibition. Supplementary Data

monoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal antibody was examined in

SUPPLEMENTARY INFORMATION

FIGURE LEGENDS HDAC3-FcεRIβ interaction occurs in mast cells isolated from ears of BALB/c mouse in mouse model of chronic allergic inflammation.

Supplementary Information

SUPPLEMENTARY INFORMATION

Supplementary Material

Site-Directed Mutagenesis. Mutations in four Smad4 sites of mouse Gat1 promoter

Supplemental Fig. 1: PEA-15 knockdown efficiency assessed by immunohistochemistry and qpcr

Quantitative real-time RT-PCR analysis of the expression levels of E-cadherin

B. C. Staurosporine BEZ235 DMSO. -actin. Suppl. Fig. 1 BEZ235 and BGT226 inhibit phosphorylation of Akt and downstream targets of PI3K and mtor.

CDK5 is essential for TGF-β1-induced epithelial-mesenchymal transition and breast cancer progression

Supplementary Information. Title BRD3 and BRD4 BET Bromodomain Proteins Differentially Regulate Skeletal Myogenesis

Figure S1. Specificity of polyclonal anti stabilin-1 and anti stabilin-2 antibodies Lysates of 293T cells transfected with empty vector, mouse

HeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid

Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days,

Dual PI3K/ERK inhibition induces necroptotic cell death of Hodgkin Lymphoma cells through IER3 downregulation

Supplementary information; Mungamuri et al., 2006

Supplemental Information. Pacer Mediates the Function of Class III PI3K. and HOPS Complexes in Autophagosome. Maturation by Engaging Stx17

MLN8237 induces proliferation arrest, expression of differentiation markers and

Supplementary Fig. 1. (A) Working model. The pluripotency transcription factor OCT4

Supplementary Figure 1. Soft fibrin gels promote growth and organized mesodermal differentiation. Representative images of single OGTR1 ESCs cultured

Online Supplementary Information

Supplementary Figure 1 Validate the expression of mir-302b after bacterial infection by northern

Supplemental Material for

Supplementary Figure 1, Wiel et al

Supplemental Methods Cell lines and culture

Supplementary Figure Legend

Supplementary Information

Supplemental Figure 1. HepG2 cells were transfected with GLI luciferase reporter construct

immunofluorescence. Name of antibodies Manufacturer Catalog Number Rabbit anti-pdyn Rabbit anti-kor-1

Supplementary Materials for

Data Sheet PD-1 / NFAT - Reporter - Jurkat Recombinant Cell Line Catalog #: 60535

a KYSE270-CON KYSE270-Id1

AIP1 functions as an endogenous inhibitor of VEGFR2-mediated signaling and inflammatory angiogenesis

Post-translational modification

Nature Medicine: doi: /nm.4169

Primers used for PCR of conductin, SGK1 and GAPDH have been described in (Dehner et al,

Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate

Tumor tissues or cells were homogenized and proteins were extracted using

SUPPLEMENTARY INFORMATION

Description of supplementary material file

Fig. S1. eif6 expression in HEK293 transfected with shrna against eif6 or pcmv-eif6 vector.

Flow cytometric determination of apoptosis by annexin V/propidium iodide double staining.

Supplementary Figure 1. Confirmation of sirna in PC3 and H1299 cells PC3 (a) and H1299 (b) cells were transfected with sirna oligonucleotides

A) B) Ladder. Supplementary Figure 1. Recombinant calpain 14 purification analysis. A) The general domain structure of classical

Thyroid peroxidase gene expression is induced by lipopolysaccharide involving Nuclear Factor (NF)-κB p65 subunit phosphorylation

Supplementary material and methods

USP19 modulates autophagy and antiviral immune responses by. deubiquitinating Beclin-1

Supplementary Information

WT Day 90 after injections

SUPPLEMENTAL FIGURES AND TABLES

Supplementary Information. ATM and MET kinases are synthetic lethal with. non-genotoxic activation of p53

Supplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified

Parthanatos mediates AIMP2-activated age-dependent dopaminergic neuronal loss

Supplementary Figure 1. Reintroduction of HDAC1 in HDAC1-/- ES cells reverts the

Marilyn G. Rimando, Hao-Hsiang Wu, Yu-An Liu, Chien-Wei Lee, Shu-Wen Kuo, Yin-

Supplemental material

Supplementary Information

Data Sheet. TCR activator / PD-L1 - CHO Recombinant Cell line Cat. #: 60536

Legend for Supplemental Figures and Tables

supplementary information

Long Noncoding RNA LOC Suppresses Apoptosis by. Targeting mir p and mir-4767 in Vascular Endothelial Cells

Supplementary Figure 1

Transcription:

Supplemental figure legends: Neddylation inhibitor MLN4924 suppresses growth and migration of human gastric cancer cells Huiyin Lan 1,2#, Zaiming Tang 1#, Hongchuan Jin 2, and Yi Sun 1,3,4* 1 Institute of Translational Medicine, School of Medicine, Zhejiang University, Hangzhou, Zhejiang 310029, China 2 Laboratory of Cancer Biology, Institute of Clinical Science, Sir un un Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou, Zhejiang 310020, China 3 Collaborative Innovation Center for Diagnosis and Treatment of Infectious Diseases, Zhejiang University, Hangzhou, China 4 Division of adiation and Cancer Biology, Department of adiation Oncology, University of Michigan, 4424B MS-1, 1301 Catherine Street, Ann Arbor, MI 48109, USA. # These authors contribute equally *Corresponding authors: Yi Sun at yisun@zju.edu.cn or sunyi@umich.edu

igure S1. ACS profiling of human gastric cancer cells (elated to igure 2). Cells were treated with DMSO control or MLN4924 at indicated concentrations for 48 hrs before subjected to ACS analysis. Shown on the left is representative ACS profiling images, and on the right is mean ± SD from three independent experiments. igure S2. MLN4924-mediated growth inhibition was not due to apoptosis induction in gastric cancer cells (elated to igure 2). (a, b), Cells were treated with DMSO or MLN4924 at indicated concentrations for 48 hrs before being subjected to ACS-apoptosis analysis (a) or Western blot analysis using antibodies against indicated proteins (b). Percentage shown in (a) is mean of triplicated samples. igure S3. escue of MLN4924-induced growth arrest and senescence by sina based knockdown of CDT1 and p21 in SGC-7901 cells (elated to igure 3). Cells were treated with DMSO control or MLN4924 at indicated concentrations for 48 hrs (a) or 72 hrs (b) before being subjected to ACS analysis (a) or SA-β-Gal staining (b). Shown on the left are representative ACS profiling images (a) or cell staining images (b), and on the right is mean ± SD from three independent experiments. Photos on (b) were taken with Leica DM4000 at 40 x amplification. igure S4. MLN4924 induced protective autophagy in SGC-7901 cells (elated to igure 4). (a), Cells were treated with DMSO, MLN4924 (0.3 μm ) or CQ (3 μm) alone or in combination for 48 hrs, followed by immunofluorescence staining of LC3 and analyzed by Leica microscopy

(left). The number of LC3 puncta per cell were quantified (right) with more than 50 cells counted. (b), Cells were transfected with sina oligonucleotides targeting PHLPP1, along with scrambled control sina before MLN4924 treatment (0.3μM) for 72 hrs. One portion of cells was split for immunofluorescent staining for LC3 puncta structure (left) with quantified data shown (right). ***P<0.001, two-tailed unpaired student's t-test. igure S5. Effect of MLN4924 on protein half-life and mna levels of EMT regulators (elated to igure 5). (a, b) Cells were treated with DMSO or MLN4924 (0.3 μm) in fresh medium (10% BS) containing cycloheximide (CHX, 50 µg/ml) for indicated time periods and harvested for Western blot analysis using indicated Abs (a). The band density was quantified using ImageJ software and plotted (b). (c), Cells were treated with MLN4924 at indicated concentrations for 48 hrs, followed by total NA isolation and qt-pc analysis for indicated genes. Data were plotted after normalization and analyzed by one-way ANOVA followed by Bonferroni post hoc test using GraphPad Prism statistical programs. Shown is mean ± SD from three independent experiments.

Supplement Table 1. Sequence of sina oligonucleotides Gene name CDT1 p21 PHLPP1 Sence or Antisene S AS S AS S AS Sequence (5'-3') CGUGGAUGAAGUACCCGACUU GUCGGGUACUUCAUCCACGUU GUGGACAGCGAGCAGCUGAUU UCAGCUGCUCGCUGUCCACUU GGAAGACGCUGCUUCUGAATT UUCAGAAGCAGCGUCUUCCTT

Supplement Table 2. Primer sequences for qt-pc Gene name or Primer sequence GAPDH E-cadherin MMP-9 N-cadherin ibronectin Vimentin GGAGTCAACGGATTTGGT GTGATGGGATTTCCATTGAT CAGAGCCTCTGGATAGAGAACGC A GGCATTGTAGGTGTTCACATCAT CGTC CCTGGAGACCTGAGAACCAATC GATTTCGACTCTCCACGCATCT CAGATAGCCCGGTTTCATTTGA CAGGCTTTGATCCCTCAGGAA GCGAGAGTGCCCCTACTACA GTTGGTGAATCGCAGGTCA GAACGCCAGATGCGTGAAATG CCAGAGGGAGTGAATCCAGATTA

2024 © businessdocbox.com Privacy Policy | Terms of Service | Feedback