Supplementary Material

Similar documents
Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...

Construction of plant complementation vector and generation of transgenic plants

Lecture Four. Molecular Approaches I: Nucleic Acids

Multiple choice questions (numbers in brackets indicate the number of correct answers)

SUPPLEMENTARY INFORMATION

Contents. 1 Basic Molecular Microbiology of Bacteria... 1 Exp. 1.1 Isolation of Genomic DNA Introduction Principle...

Computational Biology I LSM5191

% Viability. isw2 ino isw2 ino isw2 ino isw2 ino mM HU 4-NQO CPT

MIT Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr.

Supplementary Fig. 1. Characteristics of transcription elongation by YonO. a. YonO forms a saltstable EC. Immobilized ECs were washed with

Supplementary Information

Alternative Cleavage and Polyadenylation of RNA

pdsipher and pdsipher -GFP shrna Vector User s Guide

CHAPTER 9 DNA Technologies

Supplementary Materials

3 Designing Primers for Site-Directed Mutagenesis

Supplementary Information

Fatchiyah

Problem Set 8. Answer Key

Chapter 20: Biotechnology

Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.

7 Gene Isolation and Analysis of Multiple

Some types of Mutagenesis

Biotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for

Supplementary Figure 1: sgrna library generation and the length of sgrnas for the functional screen. (a) A diagram of the retroviral vector for sgrna

2. In Figure 10-4, why is edna made only from mrna and not also from trnas and ribosomal RNAs?

466 Asn (N) to Ala (A) Generate beta dimer Interface

NAME TA SEC Problem Set 4 FRIDAY October 15, Answers to this problem set must be inserted into the box outside

Justin Veazey. Experiment 3; Analysis of digestion products of puc19, GFPuv, and pgem-t easy

R1 12 kb R1 4 kb R1. R1 10 kb R1 2 kb R1 4 kb R1

HiPer RT-PCR Teaching Kit

M Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour

Transport of Potato Lipoxygenase into the Vacuole Larsen, Mia Kruse Guldstrand; Welinder, Karen Gjesing; Jørgensen, Malene

Antisense RNA Insert Design for Plasmid Construction to Knockdown Target Gene Expression

Supporting Information

AP Biology. Chapter 20. Biotechnology: DNA Technology & Genomics. Biotechnology. The BIG Questions. Evolution & breeding of food plants

Enzymatic assembly of DNA molecules up to several hundred kilobases

Guangdong Province Key Laboratory of Pharmacodynamic Constituents of TCM and New Drugs Research, Jinan University, Guangzhou, , China

Supporting Information-Tables

PRESENTING SEQUENCES 5 GAATGCGGCTTAGACTGGTACGATGGAAC 3 3 CTTACGCCGAATCTGACCATGCTACCTTG 5

Supplementary information, Figure S1

Supplementary Figures Montero et al._supplementary Figure 1

Quantitative analysis of recombination in YFP and CFP gene of FRET biosensor induced by lentiviral or retroviral gene transfer.

BS 50 Genetics and Genomics Week of Nov 29

Name_BS50 Exam 3 Key (Fall 2005) Page 2 of 5

Biology 201 (Genetics) Exam #3 120 points 20 November Read the question carefully before answering. Think before you write.

Concepts: What are RFLPs and how do they act like genetic marker loci?

Supplementary Material. Increased heterocyst frequency by patn disruption in Anabaena leads to enhanced photobiological

7.013 Practice Quiz

BC2004 Review Sheet for Lab Exercises 7-11 Spring Semester 2005

Molecular Biology: DNA sequencing

Using mutants to clone genes

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling

Molecular characterization, detection & quantitation of biological products Purin Charoensuksai, PhD

Technical Review. Real time PCR

XactEdit Cas9 Nuclease with NLS User Manual

A tool kit for rapid cloning and expression of. recombinant antibodies

Bacterial DNA replication

Sept 2. Structure and Organization of Genomes. Today: Genetic and Physical Mapping. Sept 9. Forward and Reverse Genetics. Genetic and Physical Mapping

sides of the aleurone (Al) but it is excluded from the basal endosperm transfer layer

NAME TA SEC Problem Set 3 FRIDAY March 5, Problem sets will NOT be accepted late.

TrueORF TM cdna Clones and PrecisionShuttle TM Vector System

Molecular Analysis of Genes and Gene Products. BIT 220 Chapter 22

Subtractive hybridization is a powerful technique particularly well-suited for the identification of target cdnas that correspond to rare

Recombinant DNA Technology

Franzens-Universitaet Graz, Humboldtstrasse 50, 8010 Graz. Phone: ++43 (0) Fax: ++43 (0)

Your name: BSCI410-LIU/Spring 2007 Homework #2 Due March 27 (Tu), 07

The Expression of Recombinant Sheep Prion Protein (RecShPrPC) and its Detection Using Western Blot and Immuno-PCR

Supplemental Fig. S1. Key to underlines: Key to amino acids:

F 11/23 Happy Thanksgiving! 8 M 11/26 Gene identification in the genomic era Bamshad et al. Nature Reviews Genetics 12: , 2011

Supplemental Information. Natural RNA Polymerase Aptamers. Regulate Transcription in E. coli

Supplementary Figure 1 qrt-pcr expression analysis of NLP8 with and without KNO 3 during germination.

SUPPLEMENTARY INFORMATION

A CRISPR/Cas9 Vector System for Tissue-Specific Gene Disruption in Zebrafish

Genetics Lecture 21 Recombinant DNA

Genetic Engineering & Recombinant DNA

A 5 P degradation hot spot influences molecular farming of anticancerogenic nuclease TBN1 in tobacco cells

7.17: Writing Up Results and Creating Illustrations

The GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity

Student Learning Outcomes (SLOS)

Genome Sequence Assembly

Gene mutation and DNA polymorphism

Enhancers mutations that make the original mutant phenotype more extreme. Suppressors mutations that make the original mutant phenotype less extreme

BIOLOGY Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR)

strain devoid of the aox1 gene [1]. Thus, the identification of AOX1 in the intracellular

Lecture 25 (11/15/17)

DNA Technology. Asilomar Singer, Zinder, Brenner, Berg

TECHNICAL BULLETIN. In Vitro Bacterial Split Fluorescent Protein Fold n Glow Solubility Assay Kits

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,

Supplementary Material

Microbial Diversity and Assessment (III) Spring, 2007 Guangyi Wang, Ph.D. POST103B

Chapter 11. Restriction mapping. Objectives

Heme utilization in the Caenorhabditis elegans hypodermal cells is facilitated by hemeresponsive

2.5. Equipment and materials supplied by user PCR based template preparation Influence of temperature on in vitro EGFP synthesis 11

Quiz Submissions Quiz 4

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.

Supplementary Fig. S1. SAMHD1c has a more potent dntpase activity than. SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with

Transcription:

Supplementary Material The Cerato-Platanin protein Epl-1 from Trichoderma harzianum is involved in mycoparasitism, plant resistance induction and self cell wall protection Eriston Vieira Gomes 1, Mariana do Nascimento Costa 1, Renato Graciano de Paula 1, Rafael Ricci de Azevedo, Francilene Lopes da Silva, Eliane F. Noronha, Cirano José Ulhoa, Valdirene Neves Monteiro 5, Rosa Elena Cardoza 6, Santiago Gutiérrez 6, Roberto Nascimento Silva 1* 1 - Department of Biochemistry and Immunology, Ribeirão Preto Medical School, University of São Paulo, Ribeirão Preto, SP, Brazil. - Department of Molecular and Cellular Biology and Pathogenic Bioagents, Ribeirão Preto Medical School, University of São Paulo, Ribeirão Preto, SP, Brazil. - Department of Cellular Biology, University of Brasilia, Brasília, Distrito Federal, Brazil. - Department of Biochemistry and Cellular Biology, Biological Sciences Institute, Federal University of Goias, Goiânia, Goiás, Brazil. 5 - Department of Biochemistry, State University of Goias, Anápolis, Goiás, Brazil. 6 - Department of Microbiology, University School of Agricultural Engineers, University of León, Ponferrada, Spain. *Correspondence: Dr. Roberto do Nascimento Silva University of São Paulo Ribeirão Preto Medical School Department of Biochemistry and Immunology 9, Bandeirantes Av. 19-9 Ribeirão Preto, SP rsilva@fmrp.usp.br

1 - Supplementary Figures: Supplementary Figure 1: Analysis of potential O-glycosylation sites in T. harzianum Epl-1 protein sequence. The red horizontal line indicates the threshold potential O- glycosylation. The blue vertical lines indicate the position of the site in the protein sequence. Sites with blue vertical lines which cross the red threshold line have potential O-glycosylation. Supplementary Figure : Analysis of potential O-β-N-Acetil-Glicosilation sites in T. harzianum Epl-1 protein sequence. The horizontal blue line indicates the threshold potential O-β-N-Acetyl glycosylation. The green vertical lines indicate the position of the site in the protein sequence. Sites with green vertical lines exceeding the threshold blue line have a potential of O-β-N-Acetyl glycosylation.

Supplementary Figure : Analysis of potential phosphorylation sites on T. harzianum Epl-1 protein sequence. The horizontal gray line indicates the threshold phosphorylation potential. The vertical colored lines indicate the potential amino acid; the position of the potential amino acid in the protein sequence. Sites with vertical lines cross the threshold line present potential phosphorylation.

5 AT G epl- Supplementary Figure : Representation of predicted regulatory motifs in the promoter region of T. harzianum epl-1 gene. The numbers indicate the position relative to the ATG translation start codon. Arrows indicate the orientation of the motif in the sense (5 ' ') and antisense strands (5 ' ') respectively. CAAT box and TATAA box transcription initiation sites; MYC-1 Mycoparasitism Response Element -1; CreA Carbon response regulator; GCCARG ph regulatory protein site; CCCCT Stress response elements; HGATAR Global nitrogen regulation.

A B C Supplementary Figure 5: Transformants screening scheme. A Schematic representation of the genomic region containing the epl-1 gene and the respective annealing sites of mutant screening primers set (MSEpl-1) (arrows). B Mutant screening: agarose gel electrophoresis of epl-1 gene PCR amplification. WT - T. harzianum wild type (19 bp); 1 1- Screening of mitotically stable epl-1 transformants (57bp). C - Mutant screening agarose gel electrophoresis of hph gene PCR amplification. WT - T. harzianum wild type (no amplification); 1 1- Screening

of mitotically stable epl-1 transformants (6bp). Individuals marked with orange rectangle were selected for further analysis; (1kb) Molecular weight marker. Supplementary Figure 6: Southern Blot analysis. (A) Representation of epl-1 encoding gene in T. harzianum Wild Type strain with EcoRV restriction sites, the fragments formed after digestion with its respective size (vertical lines in black) and MSEpl-1 primers annealing sites for probe construction and hybridization; (B) Representation of epl-1 deletion cassette with EcoRV restriction sites. The fragments formed after digestion with their respective sizes (vertical black lines) and MSEpl-1 primers annealing sites for probe hybridization; (C) Southern Blot Analysis of total DNA from T. harzianum Wild Type (T.h WT) and T. harzianum Epl-1 deleted mutant (T. h - Epl-1) digested with EcoRV endonuclease; (ƛHindIII) Size Markers.

Supplementary Figure 7: T. harzianum RecEpl-1-GFP strain construction. A - Schematic representation of the Epl-1 recover cassette fused with GFP construction. B - T. harzianum RecEpl-1-GFP strain fluorescence microscopy, x magnification. C agarose gel electrophoresis of epl-1 gene PCR amplification. WT - T. harzianum wild type strain (66 bp); Th Epl-1 T. harzianum epl-1 strain (no amplification product); Th RecEpl-1-GFP T. harzianum epl-1 complemented strain (66 bp). Size Marker 1kb Molecular weight marker. D - Relative Expression levels (linear) of epl-1 gene in different T. harzianum strains. (Th) T. harzianum (WT); ( epl1) T. harzianum epl1; (RecEpl-1) T. harzianum RecEpl-1-GFP; (ND) No detected.

DAYS BC DAYS C 7 DAYS AC Supplementary Figure 8: Direct Confrontation Assay. (T) T. harzianum wild type; ( Epl-1) T. harzianum epl-1; (S) S. sclerotiorum; BC Before hyphae contact; C hyphae contact; AC After hyphae contact.

epl-1 1,-β-exoglucanase (exg1) A B C 8 8 7 6 6 ND ND ND BC AC BC AC BC AC BC BC AC TxT TxS TxΔEpl1 ΔEpl1 SxΔEpl1 * 5 1 * ND ** BC AC BC AC BC AC BC BC AC TxT TxS TxΔEpl1 ΔEpl1 SxΔEpl1 1 α-mannosidase (gh9) ** D α-1,-glucosidase (mutaw) E acid phosphatase F 5 18 15 1 1 * ** ** 9 6 ND 1 Phytase (phyat) Supplementary Figure 9: Relative Expression levels (linear) of T. harzianum mycoparasitism-related genes in direct confrontation assay. (T) T. harzianum (WT); (S) S. sclerotiorum; ( Epl1) T. harzianum epl1; (BC) before hyphae contact; (AC) after hyphae contact; (ND) No detected. The data were presented using the -ΔΔCt method. * p<.5, ** p<.1, p<.1.

Chitinase (nag1) Chitinase (chit) A B 6 C 1 9 8 7 6 5 1 ** * ** 1 Chitinase (chit) D E F 6 5 Aspartyl Protease (papa) 1 18 16 1 1 1 8 6 Trypsin-like Protease (PRA1) 5 Serine Protease (sprt) 6 * Supplementary Figure 1: Relative Expression of T. harzianum mycoparasitism-related genes in direct confrontation assay. (T) T. harzianum (WT); (S) S. sclerotiorum; ( Epl1) T. harzianum epl1; (NC) no hyphae contact; (C) with hyphae contact; (ND) No detected. The data were presented using the -ΔΔCt method.* p<.5, ** p<.1, p<.1.

A B A B Supplementary Figure 11: Construction of Epl-1 deletion vector. A - pbluescript SK+ vector with selection hph-cassette (pbshph) with its respective restriction sites. B Complete pbshphepl-1 deletion vector with promoter and terminator epl-1 region in its respective cloning sites.

Supplementary Figure 1: Schematic Bell et al., 198 modified method, to classify Trichoderma strains in antagonistic activity assay in plate. TRIC. T. harzianum strains. PAT. Pathogen strains. - Supplementary Videos Legends: Supplementary Video 1: Fluorescence microscopy of Trichoderma harzianum RecEpl-1-GFP strain hyphae in x optical magnification. Supplementary Video : Fluorescence microscopy of Trichoderma harzianum RecEpl-1-GFP strain hyphae in x optical magnification.