5 CGTAAGAGTACGTCCAGCATCGGF ATCATTATCTACATCXXXXXTACCATTCATTCAGATCTCACTATCGCATTCTCATGCAGGTCGTAGCCXS 29 Supplementary Figure 1 Sequence of the DNA primer/template pair used in Figure 1bc. A 23nt primer is 6FAM labeled (F) on its 5 terminus and annealed proximal to the 3 end of a 70mer DNA template strand. A blocking oligomer (not shown) is annealed to a nt segment of the template (underlined). The template has 5 abasic residues at position to 29 from the position that act as a reporter for template displacement through the nanopore. An abasic monomer (X) linked to a three carbon spacer (S) protects the template 3 terminus from phi29 DNAPcatalyzed exonucleolysis (see Supplementary Fig. 2).
a abasic (X) = P H 2 C H b C3 spacer (S) = P H 3 c d i. FCCATTCATTCAGATCTCACTATCGCATTCTCATGCAGGTCGTAGCC3 ii. FCCATTCATTCAGATCTCACTATCGCATTCTCATGCAGGTCGTAGCCXS3 3 SXCGTAAGAGTACGTCCAGCATCGG iii. FCCATTCATTCAGATCTCACTATCGCATTCTCATGCAGGTCGTAGCC3 3 SXCGTAAGAGTACGTCCAGCATCGG iv. FCCATTCATTCAGATCTCACTATCGCATTCTCATGCAGGTCGTAGCCXS3 DNA substrate i i i ii ii iii iii iv iv wt phi29 DNAP Mg 2 46nt 23nt 1 2 3 4 5 6 7 8 9 Supplementary Figure 2 Protection of DNA template 3 termini against exonucleolysis. Phi29 DNAP contains an exonuclease domain that hydrolyzes nucleotides from the 3 termini of ssdna and dsdna. In the nanopore experiments, the 3 termini of DNA primer strands were protected by blocking oligomers, but the 3 termini of the DNA templates also required protection. To this end, we appended a protecting group to the template strands composed of (a) an abasic (1, 2 H) residue (X), and (b) a three carbon spacer (S). (c) DNA strands used to test efficacy of this protection strategy. i) 6FAM (F) labeled 46nt template unprotected at its 3 terminus. ii) Same as (i) but protected at its 3 terminus (XS). iii) Template as in (i) annealed to a 23nt DNA strand protected at its 3 terminus (SX). iv) Template as in (ii) annealed to a 23nt DNA strand protected at its 3 terminus (SX). (d) DNA substrates iiv were incubated for 5 hours in nanopore buffer at 23 C then analyzed by denaturing PAGE (17% gel). MgCl 2 (10 mm) or phi29 DNAP (1 µm) were added as noted. We found that 3 protected DNA templates were not degraded either as singlestranded substrates (lane 5) or as components of doublestranded substrates (lane 9). By comparison, the respective controls absent 3 protection were degraded (lanes 3 & 7).
a ii v i iii iv 5 s b SXX X X XXXATGGTAACTAAGTATAGAGTGATA CGTAAGAGTACGTCCAGCATCGG 5 CTCACCTATCCTTCCACTCATACTATCATTATCTACATCXXXXXTACCATTGATTCATATCTCACTATCGCATTCTCATGCAGGTCGTAGCCXS c 29 dgmp d 1 s 1 s Supplementary Figure 3 The causes of the first and second ionic current peaks. In the main text, we hypothesized that traversal of the first ionic current peak in Figure 2b was due to mechanical unzipping of the blocking oligomer, and that traversal of the second ionic current peak was dependent upon primer elongation catalyzed by phi29 DNAP. This hypothesis predicts that traversal of the first peak, but not the second, would be observed absent the Mg 2 ions required for phi29 DNAP catalytic function. This was tested in an experiment in which phi29 DNAP and the DNA substrate shown in Figure 2a of the main text were added to the nanopore cis chamber absent MgCl 2. A representative currrent trace (a) from this experiment shows i) nanopore capture of a phi29 DNAPDNA complex with a blocking oligomer bound, yielding a 2324 ionic current; ii) traversal of a current peak as the abasic insert moves through the major pore constriction due to mechanical unzipping of the blocking oligomer; iii) a long stall at, as the 3 H terminus of the DNA primer reaches the polymerase active site; followed by iv) eventual voltagepromoted dissociation of the complex to restore the v) open
channel current. The second peak was not observed in this experiment. The hypothesis also predicts that DNA synthesis would stall if a dntp required for replication was omitted from the nanopore cis chamber in the presence of all other required components. The data presented below are the result of this test. (b) DNA substrate. The template strand is a 94mer protected against exonucleolysis at its 3 end (XS, see Supplementary Fig. 2). It bears a fiveabasic reporter at positions to 29 downstream from the n = 0 position and a unique dgmp residue (red arrow). The DNA template is annealed to a 23nt primer wherein the 3 end is protected by a blocking oligomer (red line; see Fig. 1b, iii for details). (c) Stalling of replication at the dgmp residue of the template strand in the absence of dctp. DNA substrate and phi29 DNAP were added to the nanopore cis chamber containing all constituents necessary for replication (see Fig. 2) except dctp. Under these conditions, capture of the phi29 DNAPDNA complex at 180 mv resulted in traversal of the first ionic current peak due to mechanical unzipping of the blocking oligomer as in Figure 2. However, after removal of the blocking oligomer, the ionic current rose to the second peak then stalled and oscillated between 31 and (red arrow) in of 34 events analyzed. Stalling at this position was anticipated absent dctp (Lieberman, et al., 10, J. Am. Chem. Soc., 132, 1796172.) given the distance between the abasic reporter and the unique dgmp of the template strand. (d) Addition of dctp results in progression through the second peak. Conditions of the experiment are the same as panel (c) except for the addition of 100 μm dctp to the cis chamber. Replication proceeds past the dgmp template residue resulting in rapid progression of the ionic current trace from 31 to on the shoulder of the second peak (red arrow). This pattern was observed in 26 of 26 events. These results are consistent with the hypothesis that the second ionic current peak is caused by phi29 DNAPdependent replication, drawing the DNA template strand through the nanopore toward the cis chamber.
a b 100 nm dctp, 100 μm d(a,t,g)tp 1 s GGCTACGACCTGCATGAGAATGC SXCCGATGCTGGACGTACTCTTACGCTATCACTCTAGACTTACTTACCATXXXXX...CTA5 n11 78 n11 c 100 nm dttp, 100 μm d(a,c,g)tp n2 n5 12 3 67 n10 n12 89 n16 1011 n n23 14 16 5 s d n2 n5 n10n12 n16 n n23 GGCTACGACCTGCATGAGAATGC SXCCGATGCTGGACGTACTCTTACGCTATCACTCTAGACTTACTTACCATXXXXX...CTA5 e 100 nm dgtp, 100 μm d(a,t,c)tp n0 n4 0 23 10 s n6 34 n8 45 n13 9 26 n21 14 n16 1112 n22 f n0 n4n6n8 n13 n17 n21 n22 GGCTACGACCTGCATGAGAATGC SXCCGATGCTGGACGTACTCTTACGCTATCACTCTAGACTTACTTACCATXXXXX...CTA5 g 0 nm datp, 100 μm d(g,t,c)tp n14 n 10 n9 01 n1 56 2 n3 5 s 4 n7 26 24 01 n1 n18 1213 n19 n24 28 26 13 16 24 h n1 n3 n7 n9 n14 n n18 n24 n19 GGCTACGACCTGCATGAGAATGC SXCCGATGCTGGACGTACTCTTACGCTATCACTCTAGACTTACTTACCATXXXXX...CTA5
Supplementary Figure 4 Independent confirmation of discrete ionic current states during phi29 DNAPcontrolled template movement. In Figure 3 of the main text, we highlighted 16 discrete ionic current states observed during both forward and reverse ratcheting of a DNA substrate through the nanopore. We aimed to use these 16 states to determine the rate of template movement through the nanopore controlled by phi29 DNAP. Therefore we needed a method to confirm that the observed ionic current states corresponded to translocation of template nucleotides. To this end, we repeated the experiment presented in Figure 2 using the same DNA template. However, rather than using 100 μm of each dntp in the reaction mixture, we ran four independent experiments where, in each case, one of the four dntp substrates was present at 1000 nm and all others were at 100 μm (panels a, c, e, g). In these panels, the first peak is traversed due to voltagedriven unzipping of the blocking oligomer until the 3 hydroxyl of the primer strand is situated in the polymerase catalytic domain (arrow, ). The ionic current trace to the right of in each panel is due to reverse template movement driven by DNA replication. Depending upon the identity of the dilute dntp for each panel, pauses in the current trace > 0 ms were observed at various ionic current states during replication. These pauses occurred as the template base complementary to the dilute dntp arrived at the polymerase active site. For example, in panel (a) (dilute dctp), one discrete pause in the ionic current trace was observed as a template dgmp residue reached the active site. This one pause was predicted from the single dgmp residue at position n11 in the template sequence (panel b). The number of pauses in panels (c), (e), and (g) were likewise predicted from the template sequence (panels d, f, h). Each pause in the current trace is marked by template position (n0 to n24), and by numbers that correspond to ionic current states 016 in Figure 3a,b. Two numbers, e.g. 78 in panel (a), denotes a pause where ionic current fluctuations occurred between two states, while a single number, e.g. 3 in panel (c), denotes a pause with only one ionic current state. In the case where a pause fluctuated between two states, the template position was assigned to the second state. The current traces corresponding to template positions n21n22 (blue) in panel (e) and n1 (green), n18, n19, and n24 (blue) in panel (g) are expanded for clarity. Scale bars in these expansions equal 0ms. In panel (g), pauses at two neighboring template positions (n and n16) gave the same ionic current state (see Supplementary Figure 6). Discontinuities are present in panel (g) because pauses at template positions n2, n16, and n19 lasted 10s of seconds. By combining the data summarized in these four experiments, all nucleotides that could be replicated in the model DNA template were accounted for in sequential order within the 16 ionic current states in Figure 3b.
a 5 S X X X X X X X AGTCTAGAGTGATAGCGTAAGAGTACGTCCAGCATCGGF ATCATTATCTACATCXXXXXTACCATTCATTCAGATCTCACTATCGCATTCTCATGCAGGTCGTAGCCXS 29 b blocking oligomer dntps wt phi29 DNAP Mg 2 nt extension 23nt primers 1 2 3 4 5 6 7 degradation products Supplementary Figure 5 A blocking oligomer optimized for increased DNA template throughput on the nanopore. (a) ptimized blocking oligomer (red line) annealed to a DNA substrate. The segment of the blocking oligomer complementary to the template strand was reduced from to nucleotides to facilitate faster removal by the applied voltage at the nanopore. The primer strand is a 23mer bearing a FAM group (F) at its 5 terminus. (b) PAGE gel (17%) demonstrating protection of DNA using the shortened blocking oligomer. DNA substrate (1 μm) was incubated for 5 hr in nanopore buffer at 23 C with or without phi29 DNAP (0.75 μm), dntp (100 μm each), and Mg2 (10 mm) as indicated. Lanes 14 are reactions run absent blocking oligomer; lanes 57 are reactions run in the presence of blocking oligomers preannealed to the DNA substrate. In the presence of phi29 DNAP and Mg 2, but absent blocking oligomer, exonucleolysis by the enzyme resulted in disappearance of the 23nt primer band (lane 3); by comparison the same reaction run present the blocking oligomer showed no loss of the 23nt primer (lane 6). When the reaction was run present all components necessary for replication including dntp but absent blocking oligomer (lane 4) most of the primers were extend by nt to full length products; by comparison the same reaction run present the blocking oligomer showed no appearance of longer products and no loss of the 23nt primer (lane 7). We conclude that this blocking oligomer optimized for removal at the nanopore remains effective at primer protection in bulk phase.
a i. ii. iii. iv. v. vi. vii. viii. n0 n10 GGCTACGACCTGCATGAGAATGCGATAGTGAG SXCCGATGCTGGACGTACTCTTACGCTATCACTCTAGACTTACTTACCATXXXXXCTACATCTATTACTA5 n11 GGCTACGACCTGCATGAGAATGCGATAGTGAGA SXCCGATGCTGGACGTACTCTTACGCTATCACTCTAGACTTACTTACCATXXXXXCTACATCTATTACTA5 n12 GGCTACGACCTGCATGAGAATGCGATAGTGAGAT SXCCGATGCTGGACGTACTCTTACGCTATCACTCTAGACTTACTTACCATXXXXXCTACATCTATTACTA5 n13 GGCTACGACCTGCATGAGAATGCGATAGTGAGATC SXCCGATGCTGGACGTACTCTTACGCTATCACTCTAGACTTACTTACCATXXXXXCTACATCTATTACTA5 n14 GGCTACGACCTGCATGAGAATGCGATAGTGAGATCT SXCCGATGCTGGACGTACTCTTACGCTATCACTCTAGACTTACTTACCATXXXXXCTACATCTATTACTA5 n GGCTACGACCTGCATGAGAATGCGATAGTGAGATCTG SXCCGATGCTGGACGTACTCTTACGCTATCACTCTAGACTTACTTACCATXXXXXCTACATCTATTACTA5 n16 GGCTACGACCTGCATGAGAATGCGATAGTGAGATCTGA SXCCGATGCTGGACGTACTCTTACGCTATCACTCTAGACTTACTTACCATXXXXXCTACATCTATTACTA5 n17 GGCTACGACCTGCATGAGAATGCGATAGTGAGATCTGAA SXCCGATGCTGGACGTACTCTTACGCTATCACTCTAGACTTACTTACCATXXXXXCTACATCTATTACTA5 b 36 32 n13 n12 n14 n n16 n11 28 n10 n17 24 7 8 9 10 Ionic current state 11 12 Supplementary Figure 6 Verification of ionic current state transitions in Figure 3b that represent a singlenucleotide displacement of the template strand in the nanopore. We aimed to estimate the frequency of singlenucleotide indel (insertion and deletion) errors reported in the ionic current trace during phi29 DNAPcontrolled movement of the template through the nanopore (Fig. 4 of main text). Therefore, we needed to verify specific transitions between ionic current states that represent a single nucleotide displacement of the template strand in the nanopore. Missing or repeating these transitions would be equal to inserting or deleting a single nucleotide read. To this end, we used a series of eight primer/template substrates (panel a). Prior to capture of each substrate on the nanopore, phi29 DNAPcatalyzed incorporation of the appropriate complementary ddntp was allowed to occur in the nanopore bath. After ddntp incorporation, these substrates spanned the ionic current states 712 in Figure 3b. Complexes were captured in
the presence of the next complementary dntp in order to form a stable ternary (DNADNAPdNTP) complex at the indicated position along the template (arrow). For example, 1 μm DNA substrate (i) was added to the nanopore chamber in the presence of 0.75 μm phi29 DNAP, 10 mm MgCl 2, 600 μm ddatp, and 50 μm dttp. Two minutes were allowed for phi29 DNAPcatalyzed addition of the ddntp to the primer 3 terminus, after which capture of each ternary complex resulted in an ionic current state corresponding to the n10 templating base residing in enzyme active site. This experiment was repeated for each DNA substrate, and the results are summarized in panel (b). Red circles superimposed on the ionic current states from Figure 3b (black connected circles) indicate the residual ionic current measured when each ternary complex was captured on the nanopore. Each point is the calculated median of at least 10 measured events. These data indicate that transitions from ionic current state 7 to 8, 8 to 9, 10 to 11, and 11 to 12 each represent a single nucleotide displacement of the template strand in the nanopore.
Supplementary Video 1 Forward and reverse ratcheting of DNA in a nanopore controlled by phi29 DNA polymerase. A single αhl pore (gray) is embedded in a lipid bilayer that separates two chambers each containing ~100 μl of a 0.3 M KCl solution buffered at ph 8 (23 C). The solution at the top is supplemented with Mg 2, dntp, and DNA substrate (red backbone) that is protected by a blocking oligomer (yellow backbone). Phi29 DNA polymerase (orange) is prebound to the DNA. Catalysis in bulk phase does not occur because the blocking oligomer prevents enzyme access to the 3 prime hydroxyl of the primer strand. A 180 mv potential is applied across the nanopore resulting in an ionic current (white trace at left). Initially (t = 0 seconds) the channel is open with a current of ~60. Capture of the DNA template (t = 2 s) results in a current drop to ~23.5. Due to the force applied by the electric field, the blocking oligomer is mechanically unzipped from the DNA template complex in single nucleotide increments. During this unzipping process, a five abasic insert within the template strand (green bars with white highlights) passes through the pore causing traversal of a current peak (t = 8 to s) Eventually, the blocking oligomer unzips completely from the DNA template and dissociates exposing the 3 prime hydroxyl of the primer strand (flashing red circle at t = 24 s). Primer elongation now drives the template and the abasic insert back through the nanopore in reverse order, causing the ionic current to traverse the once again (t = 29 to 34 s). Template movement is ~ 10fold faster during the catalytic process compared to the mechanical unzipping process. The animation is not in real time for clarity. Supplementary Video 2 Typical ionic current traces caused by forward and reverse ratcheting of DNA in a nanopore. See Figure 2 for details. Three consecutive events are shown wherein the peak is traversed twice, first due to mechanical unzipping of the blocking oligomer from the template and second due to elongation of the primer strand driving the DNA template back through the pore in reverse order. The peak corresponds to passage of an abasic segment of the template through the limiting constriction of the nanopore. The data were processed with a digital 2 khz Gaussian low pass filter for clarity and presented at 1.5 X real time. The three events begin at 2.7 s, 13.4 s, and 29 s as indicated by the X axis.