SUPPLEMENTARY INFORMATION

Transcription

1 SUPPLEMENTARY INFORMATION Conserved arginines on the rim of Hfq catalyze base pair formation and exchange Subrata Panja and Sarah A. Woodson T.C. Jenkins Department of Biophysics, Johns Hopkins University, Baltimore, MD 21218, USA Table S1: Oligoribonucleotides and molecular beacons used in this study. Beacon rmbd FAM-CCAGGGCACUUAAAAAAUUCGCCUGG-C6-NH-DABCYL 3 rmbdss 5 6-FAM-GGUCCCCCACUCGACUCACCACCGGACC-C6-NH-DABCYL 3 RNA D16 cd16 Oligo CA Oligo CU A18 U6 5 CGAAUUUUUUAAGUGC 5 GCACUUAAAAAAUUCG 5 GUGGUCAGUCGAGUGGAAAAAAAAAAAAAAAAAA 5 GUGGUCAGUCGAGUGGUUUUUU 5 AAAAAAAAAAAAAAAAAA 5 UUUUUU These RNAs were previously reported in (Hopkins et al. 2009; Panja and Woodson 2012b).

2 Figure S1 Figure S1: Multiple sequence alignment of Hfq protein. Alignment of 384 bacterial Hfq sequences (top bars) with Clustal Omega shows that the basic patch on the rim of Hfq is highly conserved. Arginine at position 16 is invariant within the curated sequences used to create the multiple sequence alignment (*). The one exception is S. aureus, which has a lysine at position 16. Position 17 is typically lysine or arginine, position 18 is glutamate, while position 19 is least conserved within this region. The consensus sequence for the arginine patch is RKER (black bars). Sequences from select organisms in which Hfq s function has been characterized are shown below the alignment results for comparison.

3 Figure S2 Figure S2: Activation of rpos expression. Cells were grown on MacConkey / lactose agar with % arabinose overnight at 37 C. Red color indicates up-regulation of rpos::lacz expression in the presence of Hfq and ArcZ srna; white color indicates a lack of srnadependent activation.

4 Fig S3: Fig S3: Stability of Hfq hexamer. Over-expressed and purified E. coli Hfq (wt) and other mutant Hfq proteins (50 µm) were analyzed by semi-native PAGE as previously described (Panja & Woodson, 2012a) and stained with Coomassie blue. a. Comparison of WT and S23W Hfq on 15% polyacrylamide. b. Rim mutants on 4-20% polyacrylamide. Bands migrating at 11 kda, 66 kda and 132 kda correspond to the Hfq monomer, hexamer and dodecamer, respectively.

5 Figure S4 Figure S4: Reduced binding of Hfq:R16A to rpos mrna and srnas. Native gel electrophoresis of each RNAs with WT Hfq (top) or Hfq:R16A (middle). (a) rpos323, (b) DsrA, (c) RprA, (d) ArcZ56. Bands assigned to the free RNA (R, D, Rp and A, respectively) and to complexes with one or more Hfq hexamers are indicated to the left of each gel. In part a, the rightmost lane contains only rpos323. Binding constants were obtained by fitting the fraction of R-H complex to a two state binding model (black = wt, red = R16A). For rpos323, DsrA, RprA, we summed the counts in all shifted complexes. For ArcZ56, the fraction bound was based on the disappearance of free RNA, as its Hfq complexes are not well resolved (Soper et al., 2010).

6 Figure S5 Figure S5: Hfq:R16A is defective in RNA annealing. Binding kinetics of rpos srna complexes at 30 C was measured using radiolabeled rpos323 and 200 nm srna (DsrA/RprA/ArcZ56). First row, no Hfq (first row); second row, 1 µm WT Hfq; third row, 1 µm Hfq:R16A. Control reactions with rpos323 only, rpos323 plus srna, rpos323 plus 1 µm Hfq and all three components were incubated 2 h at 30 C before loading on the gel. R, free rpos323; R H, rpos-hfq compex; R D, rpos-dsra complex, R D H, ternary complex. Complexes of RprA (Rp) and ArcZ (A) were labeled analogously. Lower panel, progress curves for forming binary ( Hfq) and ternary (+Hfq) complexes (grey, no Hfq; black, WT Hfq; red, Hfq:R16A; blue, R16K; cyan, R19A; magenta, TM), were fitted to rate equations to obtain observed rate constants (Materials and Methods).

7 Figure S6 Figure S6: Fluorescence anisotropy measurements of Hfq binding. (a) Hfq binding was measured by fluorescence anisotropy. (b) 5 nm D16-FAM equilibrated in TNK buffer was titrated with Hfq (nm monomer) at 30 C. The increase in anisotropy was measured by exciting the sample at 490 nm and recording the polarization of emission intensity at 515 nm as previously described (Hopkins et al. 2009). The binding isotherm was fit to a cooperative (Hill) model. The fit parameters were: R16A, K d = 239 nm and n = 1.4; TM, K d = 105 nm and n = Only one transition is observed because the R16A mutation blocks hexamer association (Panja and Woodson 2012a). (c) Binding of ra18-fam to WT, R16A and TM Hfq as above. The fit parameters were: WT, K d = 80 nm and n = 1.7; R16A, K d = 14 nm and n = 0.7; TM, K d = 101 nm and n = 3.

8 Figure S7 (a) (b) (c) Figure S7: A positively charged rim is required for strand exchange. (a) The rate of strand exchange was measured by challenging 50 nm rmb-d16 D16 RNA complex with 50 nm cd16 RNA in TNK buffer at 30 C. (b) Release of the beacon upon exchange with cd16 RNA decreases the fluorescence emission. (c) Observed rates depended on the amino acid at position 16 and 19, with only WT Hfq exhibiting significant strand exchange activity. Error bars indicate the standard deviation from the mean of 5 trials.

9 Figure S8 Figure S8: Hfq:R16A binds RNA slowly and dissociates slowly from the ternary complex. (a-c) FRET assay for Hfq binding. (a) 50 nm D16-FAM RNA (red) was mixed with 0.5 µm Cy3-labeled Hfq monomer. The decrease in FAM emission due to FRET was detected using a 515 nm cut-off filter. (b) WT Hfq binds with two kinetic phases and the data were fit to a double exponential (k obs = 37 s -1 and 0.2 s -1 ). (c) Hfq:R16A displays only the slow phase of binding, and data were fit to a single exponential over 10 s (k obs = 0.62 s -1 ). (d-f) FRET assay for Hfq release. (d) 100 nm D16-FAM (red) was pre-mixed with 0.5 µm Hfq-Cy3, and the D16- FAM Hfq-Cy3 complex challenged with 100 nm complementary cd16 RNA (green line). Release of base paired D16 cd16 causes a loss of FRET. (e) For WT Hfq, release of dsrna resulted in a rapid loss of FRET and increase in FAM emission. (f) There was little change in FRET signal for Hfq:R16A, indicating no net release of D16-cD16 double helix. (g-i) To observe turnover of the ternary complex, cd16 RNA (100 nm) was pre-mixed with 0.5 µm Hfq-Cy3, and challenged with 100 nm complementary D16-FAM RNA. (h) For WT Hfq, binding of D16- FAM to the cd16 Hfq-Cy3 complex resulted in initial decrease in FAM emission (high FRET). Subsequent release of WT Hfq from the ternary complex was manifest as increased emission (low FRET). (i) For Hfq:R16A, we did not observe any signal corresponding to release of R16A Hfq within 10 s. The observed rate constant of the signal decay was 0.35 sec -1, which corresponds to the binding rate of Hfq:R16A in part c. Data in (e) and (h) taken from Hopkins et al. (2011).