BIO303, Genetics Study Guide II for Spring 2007 Semester 1 Questions from F05 1. Tryptophan (Trp) is encoded by the codon UGG. Suppose that a cell was treated with high levels of 5- Bromouracil such that mutations were induced at Trp codons. Would you expect that these mutations would results in a non-sense mutation, a silent mutation, a missense mutation. Explain your answer. 3. Animals require multiple origins of replication to replicate there genomes, while bacteria use only a single origin of replication. Would you predict plants would use multiple or single origins of replication? Explain your answer by discussing the nature of the plant genome. 4. Suppose that you were analyzing the DNA of a deep-ocean bacterium. You isolated the DNA from the bacterium and from yeast, dissolved them in the same buffer and compared their tm s. The bacterial DNA had a higher tm than the yeast DNA. Consider the three chemical interactions that influence the stability of DNA, hydrogen bonding, base interactions and phosphate interactions. Which of these three may account for the difference in tm? Explain your answer. 5. Very rarely translation prematurely terminates. (The ribosome releases the mrna and peptide before it reaches the stop codon) Premature termination involves the same translational release factors used in normal termination. a. In normal termination, how does the release factor interact with the ribosome? b. Predict how this interaction of the release factor and ribosome differs during premature termination? 6. Eukaryotic RNA undergoes three types of processing as it matures into a functional mrna. Briefly describe each of the three types of processing and list the function of each type of modification for mrna. 7. Draw the structure of a DNA dinucleotide with the 5-3 sequence of GT. Questions from Sp 04 2. Drawn below is the rare tautomeric form of one of the nitrogenous bases, the enol form of guanine. Draw the structure of the monophosphate deoxynucleotide which can base-pair with this form of guanine. Indicate which atoms of the two nucleotides form hydrogen bonds during base-pairing. 3. In addition to its polymerase activity, DNA Polymerase I has two other enzymatic activities, a 5-3 exonuclease activity and a 3-5 exonuclease activity. Explain the role of each of these exonuclease activities during DNA replication. 4 a. Prokaryotes have a single origin of replication per chromosomes. Vertebrates and other eukaryotes have multiple origins of replication per chromosomes. Explain why eukaryotes require multiple origins of replication on each chromosome. b. Eukaryotes have the additional characteristic of being able to vary the number of origins that are active during S- phase. Explain how varying the numbers of origins of replication is important to eukaryotic cells. 5. The -10 core promoter of the lac operon gene has the sequence TATGTT. Describe an example of a base substitution mutation which would lead to increase transcription of the gene. Explain whether this mutation would increase or decrease the fitness of the organisms. 6. One of the basic tenets of genetics is the one gene one polypeptide concept. However in the last 5 years, we have come to recognize that because of alternative splicing most vertebrate genes are capable of producing more than one polypeptide. Explain how alternative splicing can allow one gene to produce more than one polypeptide.
2 7. Shown below is the amino acid sequence for a very short wildtype protein and two mutant forms of the protein. Wildtype: Mutant 1: Mutant 2 Met-trp-tyr-arg-gly-ser-pro-thr Met-trp Met-trp-his-arg-gly-ser-pro-thr For both mutant proteins, describe the specific base substitution that would result in the altered proteins shown (example: nucleotide 13 of the ORF changed from a G to a C). Explain how the base substitution you describe would result in the alter protein. Questions from Sp 03 1. Draw the chemical structure of a single strand of DNA with the sequence AC. Draw arrows to indicate which of the atoms of the nitrogenous bases potentially could participate in hydrogen bonds in Watson-Crick base-pairing. 2. DNA polymerase has three separate catalytic activities, a 5'-3' polymerase activity, a 5'-3' exonuclease activity and a 3'-5' exonuclease activity. Describe the physiological role of each catalytic activity as it is used in DNA replication. 3. Assume that a genetic engineer introduced the entire human gene for the protein ovalbumin into the bacterial chromosome of E. coli. Describe three reasons that E. coli would not express the human gene and produce the protein. (Hint: Consider the processes of transcription, RNA processing and translation.) 4. Explain why open reading frame mutations caused by intercalating chemicals such as acridine orange are more likely to have a severe affect on phenotype when compared to mutations caused by deaminating chemicals such as nitrous acid. 5. Draw the structure of a ribosome that is actively translating a mrna at the stage immediately following translocation. Indicate the location of the P-site, the A-site, trna's and the nascent polypeptide chain. 6. The sequence of a transcribed region of a possible bacterial gene is written below. The sequence corresponds to the non-template strand of DNA. A thymine residue is circled. Consider the possible transition and transversion mutations at this nucleotide. Would these mutations be considered missense, nonsense or silent mutations? Explain your answer. GCCGCCCGCGACGAATGAAGGTCTGTTTAATCCGATAAGAAATCCGACGA Questions from Fall 2002 1. (15pts) Draw the chemical structure of dinucleotide fragment of single stranded DNA with the sequence GC. Indicate on your drawing the 5' end of the molecule, the 3' end of the molecule and the phosphodiester linkage.
3 2. (15pts) Compare and contrast the substrates, template and physiological role of the RNA polymerase, Primase, Telomerase and PolyA polymerase by filling in the following table. Enzyme Enzyme Substrate Template Required Physiological Role RNA Polymerase Primase Telomerase PolyA polymerase 3. (10pts) Eukaryotes use multiple origins of replication to copy their DNA while prokaryotes typically use a single origin of replication. Discuss the characteristics of prokaryotic cells that allow them to successfully copy their DNA using the single origin of replication. 4. (15pts) Two histidine auxotrophic strains of the bacterium, Salmonella tryphimurium, were generated by treating prototrophic cells with one of two mutagens. Auxotrophic Strain A was generated using nitrous acid as the mutagen; auxotrohic Strain B was generated using acridine orange as the mutagen. Strains A and B were then treated with 5-bromo uracil in an attempt to generate reversion mutations. Cells from each strain were mixed with the 5-bromo uracil, were allowed to complete several cell divisions and then were spread on bacterial plates with growth media lacking histidine. Cells that had undergone reversion mutations could grow on the media lacking histidine. The 5-bromo-uracil generated a few reversion mutants for strain A, but no reversion mutants for strain B. Explain why 5-bromo uracil could generate revertants for strain A but not for strain B in terms of the molecular mechanism of mutagenesis of 5-bromo-uracil. 5. (15pts) Histone genes are unusual because they lack introns. The first 70 nucleotides of the transcribed region of a tobacco histone gene are written below. Assume that a transition mutation occurs at nucleotide 25. (Nucleotide 25 is in bold and underlined.) Would this mutation be a mis-sense, a non-sense or a silent mutation? Explain your answer. The genetic code is provided at the bottom of the page. ttagaaagatgtcggcaactggaaaagtggagagctccgccgtggagcagccgccggcaaaggctcccat
Questions from Fall 2001 4 4. (10pts) Diagram the chemical structure of a dinucleotide fragment of DNA with the sequence GC. 5. (15pts) Okazaki fragments are generated on the lagging strand of the replication fork. Describe the two key enzymes and their enzymatic activities that convert the Okazaki fragments into a continuous strand of DNA. 6. (10pts) Discuss the differences between eukaryotic and prokaryotic translation that allow for prokaryotic mrna to be polycistronic but cause eukaryotic mrna to be monocistronic. 7. (15pts) In class we discussed the observation that many mutations do not affect the fitness of the organism or alter the phenotype. These mutations are called neutral mutations. For each of the following classes of mutations explain how they might result in neutral mutations. (Hint: be sure to discuss protein structure and function in your answer) Silent Mutation Missense Mutation Nonsense Mutation 8. (15pts) E. coli cells grown on bacterial growth media containing the thymine analogue 5'-bromo-uracil have a high rate of transition mutations. Discuss the mechanism by which 5'-bromo-uracil increases the rate of mutation in E. coli. Explain why 5'-bromo-uracil results in more transition mutations than in transversion mutations. Questions from Sp99 1. The structure below is adenine after it has been deaminated by nitrous acid. Diagram the likely hydrogen bonds that this base can form with cytosine. (Hint: Draw the molecular structure of the base-pairing between deaminated adenine and cytosine) (15 points) 2. Compare and contrast the activities of DNA polymerase, RNA polymerase and PolyA polymerase by filling-in the following table. (15 points) DNA Polymerase RNA Polymerase PolyA Polymerase Substrate Specificity Template Requirements Primer Requirement Physiological Role 3. The Buffalo News had an article two Sundays ago that described strain of mice that lacked to enzyme telomerase. The News reported that these mice showed symptoms of premature aging, for example hair loss. A) What is telomerase? B) Speculate on the likely mechanisms that may have resulted in premature aging in mice that lacked telomerase (15 points) 4. Below is the sequence of the coding strand (non-template strand) of a piece of DNA that is used as a template for mrna synthesis. A) What RNA sequence would be transcribed from this double stranded DNA? B) What protein would be encoded by this RNA. A thymine nucleotide is underlined in the DNA sequencing. C) Explain how base substitutions at this nucleotide could results in a non-sense mutation, a mis-sense mutation and a silent mutation (15 points)? GTCACATGCCTACTGTGTGTGAAGCTTTTTAAAAAAGA
Questions from Sp97 5 1. Phenylalanyl trna synthetase funcitons by linking phenylalanine to its cognate trna. Describe the two types of errors which can be made by a phenylalanyl trna synthetase. Discuss how each rare error would specifically affect protein synthesis. 2. The glossary of your textbook defines a promoter as "a region to which RNA polymerase binds prior to the initiation of transcription." Discuss why this definition is not appropriate for eukaryotic promoters. How might you modify the definition to take into account the details of transcriptional initiation in both prokaryotes and eukaryotes. 3. There are a few prokaryotic mutants which show reduced efficiency in both excision repair mechanisms and DNA synthesis in the lagging strand. When these mutants are characterized at the molecular level, what set of genes would you expect to find altered. 4. When some viruses infect eukaryotic cells they bring a decapping enzyme into the host cell. The decapping enzyme removes the 5-7 methylguanosine caps from the host mrna. Predict how the removal of the cap will affect the host mrna. 5. Nitrous acids mutagenic activity results from its ability to deaminate the nitrogenous bases of DNA. In the process of deamination, an amino group is converted to a keto group. Draw the product of deamination of cytosine. Draw the nitrogenous base that will base pair with this modified cytosine. What atoms will be involved in the hydrogen bonds that stabilize the base pair structure? 6. Discuss the structure of a frame shift mutation hot spot. How does this structure suggest a mechanism for spontaneous frame shift mutations? Fall 1997 1. Compare and contrast the enzymatic activities and cellular funcitons of DNA polymerase and RNA polymerase. 2. ICR-21 is a potent mutagen in both eukaryotes and prokaryotes. Its structure is drawn below. What type of mutation would you predict ICR-21 causes based on i9ts chemical structure? Explain your prediction. 3. Prokaryotes typically have a single origin of replication on their chromosome, while eukaryotes have multiple origins of replication. Explain the differences between eukaryotes and prokaryotes that necessitates multiple origins in eukaryotes. 4. Identify the nitrogenous base drawn below. Which nucleotide base pairs with this nitrogenous base in the double helical structure of DNA? Diagram this base-pair structure indicating all hydrogen bonds. 5. Eukaryotic mrna is polyadenylated. What is polyadenylation and what is its physiological function in eukaryotic cells? 6. In the genetic code, the nucleotide sequence UGG correspondes to the codon for the amino acid tryptophan. However in mrna not every sequence of "UGG" functions as a codon for tryptophan. What distinguishes those UGG sequences that function as codons for tryptophan and those UGG that do not?