HeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid

Similar documents
Confocal immunofluorescence microscopy

IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p53 activity

Supplementary Information

Plasmid DNA transfection of SW480 human colorectal cancer cells with the Biontex K2 Transfection System

supplementary information

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna

Protocol for induction of expression and cell lysate production

SureSilencing sirna Array Technology Overview

sirna Transfection Into Primary Neurons Using Fuse-It-siRNA

Supplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/-

Isolation, culture, and transfection of primary mammary epithelial organoids

SUPPLEMENTARY INFORMATION FIGURE 1 - 1

Pasteurella multocida

Supplemental Materials and Methods

SUPPLEMENTARY MATERIAL AND METHODS

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

NTM486-04, NTM174-04,

Conversion of plasmids into Gateway compatible cloning

Supporting Online Material for

Supplementary Information

Supplement Figure 1. Plin5 Plin2 Plin1. KDEL-DSRed. Plin-YFP. Merge

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.

Supplementary Information

Transcriptional Regulation of Pro-apoptotic Protein Kinase C-delta: Implications for Oxidative Stress-induced Neuronal Cell Death

Focus Application. Cell Migration. Featured Study: Inhibition of Cell Migration by Gene Silencing. xcelligence System Real-Time Cell Analyzer

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,

Roche Molecular Biochemicals Technical Note No. LC 10/2000

Supplemental Data Supplementary Figure Legends and Scheme Figure S1.

Supplemental Methods:

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling

affects the development of newborn neurons Brain Mind Institute and School of Life Sciences, Ecole Polytechnique Fédérale de

Supporting Information

Supplemental Information

Fundamentals and Applications of Biofilms Analysis, Structure and Physiology of Bacterial Biofilms Ching-Tsan Huang ( 黃慶璨 ) Office: Agronomy

Data Sheet. Hippo Pathway TEAD Reporter MCF7 Cell Line Catalog #: 60618

Supporting Information

SuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes

Creating RAFT 3D Cell Cultures with Different Thicknesses and Different Cell Types

Supplementary Materials

Nucleofector technology and transient protein production

Cignal Reporter Assay Handbook

Generation of ips-derived model cells for analyses of hair shaft differentiation

Assay Design Considerations, Optimization and Validation

Supplementary Information Design of small molecule-responsive micrornas based on structural requirements for Drosha processing

SANTA CRUZ BIOTECHNOLOGY, INC.

pdsipher and pdsipher -GFP shrna Vector User s Guide

TrkB knockdown cell lines (i.e., BBM1-KD and 361-KD cells) were prepared by

BLOCK-iT Transfection Optimization Kit

including, but not limited to:

Calcium Assay Kit. Technical Data Sheet. Product Information. Description. Storage. Materials not included

Investigating Apoptosis. For more information:

Cell were phenotyped using FITC-conjugated anti-human CD3 (Pharmingen, UK)

Quantitative analysis of PCR fragments with the Agilent 2100 Bioanalyzer. Application Note. Odilo Mueller. Abstract

ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG

Supplemental Data. Regulating Gene Expression. through RNA Nuclear Retention

ingenio electroporation kits & solution

Supplementary Figures and Legends

Supplemental Information. The TRAIL-Induced Cancer Secretome. Promotes a Tumor-Supportive Immune. Microenvironment via CCR2

DNA Laddering Assay Kit

HiPer RT-PCR Teaching Kit

To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well

Percent survival. Supplementary fig. S3 A.

Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application

Alternative Cleavage and Polyadenylation of RNA

Supplementary Figure 1. Isolation of GFPHigh cells.

a. Primers were purchased from Display Systems Biotech and are listed numerically to differentiate them

Functional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update

Intracellular receptors specify complex patterns of gene expression that are cell and gene

Supporting Information

Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion

Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.

Standard Operating Procedure

Roche Molecular Biochemicals Technical Note No. LC 9/2000

Immunofluorescence Staining Protocol for 3 Well Chamber, removable

of Medicine, Zhejiang University, Hangzhou, Zhejiang , China Michigan, 4424B MS-1, 1301 Catherine Street, Ann Arbor, MI 48109, USA.

HEK293A cells were cultured in high glucose (4.500 mg/l) Dulbecco s modified

Summary of Mutagenic Toxicity Test Results for EvaGreen

Supplemental Table S1. Primers used for relevant analysis. Gene Accession# Forward primer (5 -) Reverse primer (5 -) Application

Cisne Enterprises, Inc. MELANOMA CANCER TEST

An improved quantitative real-time PCR protocol for precisely measuring D-amino acid oxidase mrna in rat tissues

Cell culture. HeLa cells were cultured as monolayers in Dulbecco s Minimal Essential

Lecture Four. Molecular Approaches I: Nucleic Acids

sirna Overview and Technical Tips

AmpliScribe T 7 Aminoallyl-RNA Transcription Kit

TOOLS sirna and mirna. User guide

TransIT -LT1 Transfection Reagent

GeneCopoeia TM. All-in-One qpcr Mix For universal quantitative real-time PCR. User Manual

ApoTrack Cytochrome c Apoptosis ICC Antibody

SOP: SYBR Green-based real-time RT-PCR

Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX

MicroRNA Analysis Paired with Novel Cell Health Assays: A Complete Workflow

Score winning cdna yields with SuperScript III RT

Technical Review. Real time PCR

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...

Supplementary Figure 1

Regulation of cellular differentiation by tissue specific transcription factor

Khaled_Fig. S MITF TYROSINASE R²= MITF PDE4D R²= Variance from mean mrna expression

ab Mitochondrial Viability Assay

Kostandin V. Pajcini, Stephane Y. Corbel, Julien Sage, Jason H. Pomerantz, and Helen M. Blau

Application Note sirna dependent gene silencing in HeLa cells cultivated on various cell culture surfaces

Transcription:

SUPPLEMENTAL MATERIALS AND METHODS Cell culture, transfection and treatments. HeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid encoding vmia (HeLa vmia) 1 were cultured in DMEM medium supplemented with 10 % fetal calf serum, 10 mm HEPES and 100 U/ml penicillin/streptomycin at 37 C under 5% CO 2. Growth medium and supplements for cell culture were purchased from Gibco-Invitrogen (Carlsbad, USA). Cells were transfected in 6-well plates at 60% of confluence by means of the Oligofectamine transfection reagent (Invitrogen), following the manufacturer s instructions. The following sirnas were employed to downregulate the mitochondrial phosphate carrier (PiC) and mitofusin 2 (Mfn-2): PiC1, sense 5 - CUGGCGCACAUCACUAUAUdTdT-3 ; PiC2, sense 5 - CCAGGUUAUGCCAACACUUdTdT-3 ; Mfn-2, sense 5 - CGGCAAGACCGACUGAAAUdTdT-3. As a control, an irrelevant sirna was employed (sense 5'-GCCGUAUGCCGGUUAAGUdTdT-3'). 2 To induce cell death, cells were treated with 500 nm staurosporine (Sigma-Aldrich, St. Louis, USA) or with 500 ng/ml α-cd95 monoclonal antibody clone 7C11 (Immunotech, Prague, Czech Republic) plus 100 µg/ml cycloheximide (Sigma-Aldrich), for 6 hours. Immunofluorescence microscopy and cytofluorometry. Immunofluorescence experiments were performed as previously described. 3 Mitochondria were visualized by staining live cells with MitoTracker Orange (Molecular Probes- Invitrogen), following the manufacturer s recommendations, or by using a monoclonal antibody that specifically recognize the respiratory chain complex III core 2 subunit (A11143, Molecular Probes-Invitrogen) revealed with Alexa Fluor 568-coupled secondary antibodies

(Molecular Probes-Invitrogen). Acquisition was performed on a Leica DMIR2 inverted fluorescence microscope (camera Leica DFC300FX, acquisition software Leica FW4000). To measure mitochondrial transmembrane potential and cell viability, cells were incubated for 20 min at 37 C with 40 nm 3,3'-dihexyloxacarbocyanine iodide (DiOC 6 (3), from Molecular Probes-Invitrogen) plus 1 µg/ml propidium iodide (PI, from Sigma-Aldrich), immediately followed by cytofluorometric analysis on a FACScan cytofluorometer (Becton Dickinson, San Jose, USA). 4 RT-PCR. Total RNA was isolated by means of the RNeasy Mini Kit (Qiagen, Hilden, Germany), according to the manufacturer s instructions, followed by generation of total cdna with the ImProm-II TM Reverse Transcription System (Promega, Madison, USA). Primer pairs specific for the isoform B of PiC (gene name: slc25a3; accession number NM_213611.1; forward primer 5 -GTTCTCGTCCGTGGCGCACCTGGCG-3, reverse primer 5 - GGGAACCACAGCAGTGTGTGTCAGACCACAA-3 ) and β-actin (as control, primers G5740 purchased from Promega) were used for semi-quantitative PCR amplification (25 cycles, linear range, PCR Master Mix from Promega). Finally PCR products were separated on 2% agarose gels containing 0.1 µg/ml ethidium bromide (from Sigma-Aldrich) and visualized on a standard UV transilluminator. SUPPLEMENTAL REFERENCES 1. Goldmacher VS et al. A cytomegalovirus-encoded mitochondria-localized inhibitor of apoptosis structurally unrelated to Bcl-2. Proc Natl Acad Sci USA 1999; 96:12536-12541 2. de La Motte Rouge T et al. A novel epidermal growth factor receptor inhibitor promotes

apoptosis in non-small cell lung cancer cells resistant to erlotinib. Cancer Res 2007; 67:6253-6262 3. Castedo M et al. Quantitation of mitochondrial alterations associated with apoptosis. J Immunol Methods 2002; 265:39-47 4. Criollo A et al. Mitochondrial control of cell death induced by hyperosmotic stress. Apoptosis 2007; 12:3-18

A sirna Mfn-2 + UNR sirna Mfn-2 + PiC B p < 0.001 p < 0.001 % of cells with fragment ed mitochondria 100 80 60 40 20 0 sirna Mfn-2 sirna PiC Suppl. Fig. 1

LEGENDS TO SUPPLEMENTAL FIGURES Supplemental Figure 1. A-B. sirna-mediated depletion of PiC prevents mitochondrial fragmentation induced by the knockdown of mitofusin 2 (Mfn-2). A549 cells were transfected with a control, irrelevant sirna (UNR) or with sirnas for the downregulation of Mfn-2 and PiC in the indicated combinations for 48 hours, then labelled with MitoTracker Orange for the evaluation of mitochondrial morphology. Panel A reports representative pictures of cells exhibiting normal () or near-to-normal (sirna Mfn-2 + PiC) mitochondria, in contrast with cells displaying mitochondrial macrofragmentation (sirna Mfn-2 + UNR). Scale bars represent 2 µm. Panel B depicts the percentage of cells with fragmented mitochondria, as assessed in a population of at least 300 cells (mean ± STE; n = 3). Paired Student s t tests were performed to evaluate statistical significance.