Table S1. List of antibodies used in this study. All antibodies were raised in rabbits.

Similar documents
Environmental ph Affects Photoautotrophic Growth of Synechocystis sp. PCC 6803 Strains Carrying Mutations in the Lumenal Proteins of PSII.

Serine/Threonine Protein Kinase SpkG Is a Candidate for High Salt Resistance in the Unicellular Cyanobacterium Synechocystis sp.

Gong Y M, et al. Chin Sci Bull March (2012) Vol.57 No.7 761

The microtubule-associated tau protein has intrinsic acetyltransferase activity. Todd J. Cohen, Dave Friedmann, Andrew W. Hwang, Ronen Marmorstein and

Table of content. Chaperone Competent Cells pkje7/bl21. Chaperone Competent Cells ptf16/bl21. TaKaRa Competent Cells BL21

Enhancers mutations that make the original mutant phenotype more extreme. Suppressors mutations that make the original mutant phenotype less extreme

A subclass of HSP70s regulate development and abiotic stress responses in Arabidopsis thaliana

Transcription factor-based biosensors in biotechnology: current state and future prospects

SI Results Peculiarities in the consumption of ammonium and glucose by AmtB- strains SI Materials and Methods Strain Construction

over time using live cell microscopy. The time post infection is indicated in the lower left corner.

Supplementary Figure S1 Selected examples of nodulation with M. loti in plate experiments

Research Biochemicals. ANTIBODIES TO PRION PROTEINS

Interactions between Small Heat Shock Protein Subunits and Substrate in Small Heat Shock Protein-Substrate Complexes

SUPPLEMENTARY INFORMATION

Materials and methods. by University of Washington Yeast Resource Center) from several promoters, including

Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or

SUPPLEMENTARY INFORMATION

MATF Antigen Submission Details and Standard Project Deliverables

HAWAII. Renewable Bio-solar Hydrogen Production from Robust Oxygenic Phototrophs AFOSR MURI Progress Update: January 2007.

Supporting Information

Hossain_Supplemental Figure 1

MATERIAL DATA SHEET. Reagents Provided in Kit

Supplementary Fig. S1. SAMHD1c has a more potent dntpase activity than. SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with

Relating mrna and protein biomarker levels in a Dehalococcoides and Methanospirillum containing community

Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.

Supplementary materials

ANTIBODY IMMUNOGENICITY

Heme utilization in the Caenorhabditis elegans hypodermal cells is facilitated by hemeresponsive

Supplemental Materials and Methods

Enabling Systems Biology Driven Proteome Wide Quantitation of Mycobacterium Tuberculosis

Building Better Algae

Supplemental Information. Acclimation of Oxygenic Photosynthesis. to Iron Starvation Is Controlled by the srna IsaR1

ARBRE-P4EU Consensus Protein Quality Guidelines for Biophysical and Biochemical Studies Minimal information to provide

For the quantitative detection of human IL6 in serum, plasma, cell culture supernatants and urine.

Supplementary Text. eqtl mapping in the Bay x Sha recombinant population.

JBC Papers in Press. Published on March 7, 2014 as Manuscript M

Algorithm for Matching Additional Spectra

TIGR THE INSTITUTE FOR GENOMIC RESEARCH

SUPPLEMENTARY INFORMATION

ipep User s Guide Proteomics

A) B) Ladder. Supplementary Figure 1. Recombinant calpain 14 purification analysis. A) The general domain structure of classical

Supplementary Materials for

Peptide libraries: applications, design options and considerations. Laura Geuss, PhD May 5, 2015, 2:00-3:00 pm EST

Supplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/-

Chapter 8 Lecture Outline. Transcription, Translation, and Bioinformatics

Supplemental Information. A Versatile Tool for Live-Cell Imaging. and Super-Resolution Nanoscopy Studies. of HIV-1 Env Distribution and Mobility

Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.

CBI Toolbox Tour 2015

Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms

Control of secondary cell wall patterning involves xylan deacetylation by a GDSL esterase

Self-test Quiz for Chapter 12 (From DNA to Protein: Genotype to Phenotype)

Rat IGF-1 ELISA Kit (rigf-1-elisa)

INTRODUCTION. Marco Schottkowski a, Janina Ratke a, Ulrike Oster b, Marc Nowaczyk c and Jörg Nickelsen a,1

Western-GUARANTEED Antibody Service FAQ

Solutions to Quiz II

Rapid GST Inclusion Body Solubilization and Renaturation Kit

Supplemental Data. Steiner et al. Plant Cell. (2012) /tpc

The GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity

plant species. An shsp in sweet chestnut (Castanea sativa L.), CsHsp17.5, was constitutively

FINDING GENES AND EXPLORING THE GENE PAGE AND RUNNING A BLAST (Exercise 1)

BA, BSc, and MSc Degree Examinations

Fatchiyah

Comparison of the total protein profiles of clove EO treated (dashed line) and untreated

Protein-Protein-Interaction Networks. Ulf Leser, Samira Jaeger

The Two-Hybrid System

PXBioVisioN. Protease Inhibition. Analysis of Peptides as Surrogates for Protease Activity to Monitor Protease Inhibition in-vivo

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,

sirna Overview and Technical Tips

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Supplemental Data. Lee et al. Plant Cell. (2010) /tpc Supplemental Figure 1. Protein and Gene Structures of DWA1 and DWA2.

A highly sensitive and robust 150 µm column to enable high-throughput proteomics

Z -LYTE KINASE ASSAY KIT SER/THR 9 PEPTIDE PROTOCOL

Molecular and Cell Biology (MCB)

Spectrum Mill MS Proteomics Workbench. Comprehensive tools for MS proteomics

The Expression of Recombinant Sheep Prion Protein (RecShPrPC) and its Detection Using Western Blot and Immuno-PCR

Inferring the connectivity of a regulatory network from mrna quantification in Synechocystis PCC6803

PI NAME: Eleftherios Papoutsakis. Department of Chemical Engineering and the Delaware Biotechnology Institute, University of Delaware

Rajan Sankaranarayanan

[4] SCHEMA-Guided Protein Recombination

Confirming the Phenotypes of E. coli Strains

Microbially Mediated Plant Salt Tolerance and Microbiome based Solutions for Saline Agriculture

The Molecular Chaperone DnaJ is Involved in the Peroxideinduced Oxidative Stress Response in Escherichia coli

SUMOylated protein capture kit

The World Leader in SPR Technology. Jimmy Page, PhD, Biacore, Inc.

pgbkt7 Anti- Myc AH109 strain (KDa) 50

Use of Drosophila Melanogaster as a Model System in the Study of Human Sodium- Dependent Multivitamin Transporter. Michael Brinton BIOL 230W.

CHAPTER 14 Genetics and Propagation

Deducing the kinetics of protein synthesis in vivo from the transition rates measured in vitro

Antibody Services from GenScript

Nature Structural & Molecular Biology: doi: /nsmb.1969

H 2. Direct Biological Conversion of Sunlight to Hydrogen. Producing Fuels the Old-Fashioned Way: Using Biology

Species predicted to react based on 100% sequence homology: Chicken, Bovine, Dog.

Multiplex Assay Design

SUPPLEMENTAL FIGURE LEGENDS. Figure S1: Homology alignment of DDR2 amino acid sequence. Shown are

A Dual Pathogenic Mechanism Links Tau Acetylation to Sporadic Tauopathy

MATERIAL DATA SHEET. Reagents Provided in Kit

A Physical Map of the Genome of a Unicellular Cyanobacterium Synechocystis sp. Strain PCC6803

Coleman et al., Supplementary Figure 1

Cell-free TX-TL systems for synthetic biology

Plant Growth and Cultivation

Transcription:

Supplementary Materials Materials and Methods Cells Size and Granularity Measurements Cell size and granularity determination was estimated by the analysis of images acquired on ImageStream MkII (Amnis Corporation, Seattle, WA, USA) high throughput imaging flow cytometer based on 10,000 cells sample statistics for each experiment time-point. Table S1. List of antibodies used in this study. All antibodies were raised in rabbits. Designation ClpB1 ClpB2 D1 DnaK2 GroEL HspA KatG RbcL Antiserum description AS08 344 (Agrisera, Sweden) raised against recombinant ClpB1 protein, derived from Slr1641 of Synechocystis PCC 6803 strain sequence; protein has an internal translation site. AS08 355 (Agrisera, Sweden) raised against recombinant Slr0156 protein, derived from Synechocystis PCC 6803 strain slr0156 sequence. This protein is annotated as ClpB1 in a data base but was originally named ClpB2 according to [1]. AS10 704 (Agrisera, Sweden) raised against KLH-conjugated synthetic peptide, amino acids 234-242 of D1 protein P83755 (AtCg00020) AS08 350 (Agrisera, Sweden) raised against full length recombinant DnaK2 protein derived from Synechocystis PCC 6803 DnaK2 protein sequence P22358 Raised against a mixture of Hsp60s (homologous GroEL1 and Cpn60) of Synechocystis vulcanus [2]. AS08 286 (Agrisera, Sweden) raised against recombinant protein. Synechocystis PCC 6803 Hsp16.6 CI (class one) P72977 AS08 374 (Agrisera, Sweden) raised against recombinant full length KatG protein from Synechocystis sp. PCC 6803 (accessions P73911 and Sll1987) with six His-tag on the terminus AS03 037 (Agrisera, Sweden) raised against KLH-conjugated synthetic peptide conserved across all known plant, algal and (cyano)bacterial RbcL protein sequences (form I L8S8 and form II L2), including Arabidopsis thaliana AtCg00490, Hordeum vulgare P05698, Oryza sativa P0C510, Chlamydomonas reinhardtii P00877, Synechococcus PCC 7920 A5CKC5

Life 2015, 5 S2 Table S2. Genes regulated by histidine-kinase 34 under different abiotic stresses. Genes that are positively regulated by Hik34 under salt stress [3,4] hspa clpb1 dnak2 groel2 dnaj hik34 sodb slr1915 sigb pbp slr1916 sll1884 sll1107 slr0959 sll0528 slr0095 slr1687 slr0960 slr1917 sll1541 ribf hypa ssl3044 slr1674 ssr3188 leub sll1757 slr1918 sll1106 Genes that are positively regulated by Hik34 under osmotic stress [5] hspa clpb1 dnak2 groel2 groel1 dnaj hik34 sodb slr1915 groes htpg spkh sll0846 slr1963 ssl2971 slr1413 slr0959 sll1884 slr1603 Genes that are negatively regulated by Hik34 under normal conditions and heat stress [6,7] hspa clpb1 dnak2 groel2 groel1 groes htpg sigb hlic sll1634 hema cpcc nrtd atpf ssl3044 psbd2 psba3 sll0846

Life 2015, 5 S3 Figure S1. Number of cells per ml of culture during and after heat stress at 44 C for 24 h. Before heat stress at 44 C, the culture was cultivated at 32 C for 28 h. Error bars represent standard deviation. The experiments were performed in duplicates, data from one representative experiment are shown. Figure S2. (a) Changes of cell sizes of WT and ΔHik34 mutant during the experiment. To provide better interpretation regarding all population, medians of cell size are given, as median goes toward the most abundant cell size in population. Dashed lines show time of heat shock treatment. (b) Side scatter distributions of WT and ΔHik34 cells under normal conditions, after 16 h of heat shock and after 16 h of recovery from 24 h of heat stress.

Life 2015, 5 Figure S3. Ultrastructure of wild-type cells under normal (control) conditions (a-c); after 2 h (d f), and after 24 h (g i) of heat stress. c carboxysome, asterisks electron transparent inclusions. All scale bars correspond to 0.5 µm. S4

Life 2015, 5 S5 Figure S4. Ultrastructure of ΔHik34 mutant cells grown under normal (control) conditions (a c); after 2 h (d f), and after 24 h (g i) of heat stress. c carboxysome, asterisks electron transparent inclusions. All scale bars correspond to 0.5 µm. References 1. 2. 3. 4. Giese, K.C.; Vierling E. Changes in oligomerization are essential for the chaperone activity of a small heat shock protein in vivo and in vitro. J. Biol. Chem. 2002, 277, 46310 46318. Nishiyama, Y.; Los, D.A.; Murata, N. PsbU, a protein associated with photosystem II is required for the acquisition of cellular thermotolerance in Synechococcus species PCC 7002. Plant Physiol. 1999, 120, 301 308. Marin, K.; Suzuki, I.; Yamaguchi, K.; Ribbeck, K.; Yamamoto, H.; Kanesaki, Y.; Hagemann, M.; Murata, N. Identification of histidine kinases that act as sensors in the perception of salt stress in Synechocystis sp. PCC 6803. Proc. Natl. Acad. Sci. USA 2003, 100, 9061 9066. Shoumskaya, M.A.; Paithoonrangsarid, K.; Kanesaki, Y.; Los, D.A.; Zinchenko, V.V.; Tanticharoen, M.; Suzuki, I.; Murata, N. Identical Hik-Rre systems are involved in perception and transduction of salt signals and hyperosmotic signals but regulate the expression of individual genes to different extents in Synechocystis. J. Biol. Chem. 2005, 280, 21531 21538.

Life 2015, 5 S6 5. Paithoonrangsarid, K.; Shoumskaya, M.A.; Kanesaki, Y.; Satoh, S.; Tabata, S.; Los, D.A.; Zinchenko, V.V.; Hayashi, H.; Tanticharoen, M.; Suzuki, I.; et al. Five histidine kinases perceive osmotic stress and regulate distinct sets of genes in Synechocystis. J. Biol. Chem. 2004, 279, 53078 53086. 6. Suzuki, I.; Kanesaki, Y.; Hayashi, H.; Hall, J.J.; Simon, W.J.; Slabas, A.R.; Murata, N. The histidine kinase Hik34 is involved in thermotolerance by regulating the expression of heat shock genes in Synechocystis. Plant Physiol. 2005, 138, 1409 1421. 7. Slabas, A.R.; Suzuki, I.; Murata, N.; Simon, W.J.; Hall, J.J. Proteomic analysis of the heat shock response in Synechocystis PCC 6803 and a thermally tolerant knockout strain lacking the histidine kinase 34 gene. Proteomics 2006, 6, 845 864.