PCR-based Markers and Cut Flower Longevity in Carnation

Similar documents
Electronic Supplementary Information

Supplemental Data Supplemental Figure 1.

Figure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis

Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC

Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH).

Supplemental Data. mir156-regulated SPL Transcription. Factors Define an Endogenous Flowering. Pathway in Arabidopsis thaliana

II 0.95 DM2 (RPP1) DM3 (At3g61540) b

Search for and Analysis of Single Nucleotide Polymorphisms (SNPs) in Rice (Oryza sativa, Oryza rufipogon) and Establishment of SNP Markers

Table S1. Bacterial strains (Related to Results and Experimental Procedures)

Supporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2006

Supporting Online Information

Disease and selection in the human genome 3

strain devoid of the aox1 gene [1]. Thus, the identification of AOX1 in the intracellular

Supplementary Information. Construction of Lasso Peptide Fusion Proteins

Supplementary Materials for

SAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer

Lecture 11: Gene Prediction

G+C content. 1 Introduction. 2 Chromosomes Topology & Counts. 3 Genome size. 4 Replichores and gene orientation. 5 Chirochores.

Supplemental Information. Human Senataxin Resolves RNA/DNA Hybrids. Formed at Transcriptional Pause Sites. to Promote Xrn2-Dependent Termination

Supplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR

DNA sentences. How are proteins coded for by DNA? Materials. Teacher instructions. Student instructions. Reflection

Complexity of the Ruminococcus flavefaciens FD-1 cellulosome reflects an expansion of family-related protein-protein interactions

Supporting Information. Trifluoroacetophenone-Linked Nucleotides and DNA for Studying of DNA-protein Interactions by 19 F NMR Spectroscopy

The B1 Protein Guides the Biosynthesis of a Lasso Peptide

Codon Bias with PRISM. 2IM24/25, Fall 2007

Supplementary Information

Supplemental Information. Target-Mediated Protection of Endogenous. MicroRNAs in C. elegans. Inventory of Supplementary Information

Supplemental Data. Distinct Pathways for snorna and mrna Termination

A green method of staining DNA in polyacrylamide gel electrophoresis based on fluorescent copper nanoclusters synthesized in situ

Supplementary Material and Methods

Supporting Information

Wet Lab Tutorial: Genelet Circuits

Supporting Information. Table of Contents

Engineering Escherichia coli for production of functionalized terpenoids using plant P450s

A netlike rolling circle nucleic acid amplification technique

Chapter 13 Chromatin Structure and its Effects on Transcription

FROM DNA TO GENETIC GENEALOGY Stephen P. Morse

Genomics and Gene Recognition Genes and Blue Genes

MCB421 FALL2005 EXAM#3 ANSWERS Page 1 of 12. ANSWER: Both transposon types form small duplications of adjacent host DNA sequences.

Supporting Information

PROTEIN SYNTHESIS Study Guide

Chapter 3: Information Storage and Transfer in Life

1.) Draw the structure of guanine. Indicate where the hydrogen bonds form with cytosine. (4pts)

PILRα Is a Herpes Simplex Virus-1 Entry Coreceptor That Associates with Glycoprotein B

Amplified Analysis of DNA by the Autonomous Assembly of Polymers Consisting of DNAzyme Wires

Lezione 10. Bioinformatica. Mauro Ceccanti e Alberto Paoluzzi

Sadaf Haghiri PhD student at Environmental engineering faculty Middle East Technical University. Supervisor: Assoc. Prof. Dr.

Circular bivalent aptamers enable in vivo stability and recognition

Supplementary Appendix

Supplemental Data. Lin28 Mediates the Terminal Uridylation. of let-7 Precursor MicroRNA. Molecular Cell, Volume 32

Supplementary Fig. 1. Isolation and in vitro expansion of EpCAM + cholangiocytes. For collagenase perfusion, enzyme solution was injected from the

Engineering D66N mutant using quick change site directed mutagenesis. Harkewal Singh 09/01/2010

Sequence Design for DNA Computing

Interpretation of sequence results

DNA extraction. ITS amplication and sequencing. ACT, CAL, COI, TEF or TUB2 required for species level. ITS identifies to species level

A high efficient electrochemiluminescence resonance energy. transfer system in one nanostructure: its application for

Best practices for Variant Calling with Pacific Biosciences data

Int J Clin Exp Med 2014;7(9): /ISSN: /IJCEM Jin Ah Ryuk *, Young Seon Kim *, Hye Won Lee, Byoung Seob Ko

Meixia Li, Chao Cai, Juan Chen, Changwei Cheng, Guofu Cheng, Xueying Hu and Cuiping Liu

Cloning and characterization of a cdna encoding phytoene synthase (PSY) in tea

MOLECULAR CLONING AND SEQUENCING OF FISH MPR 46

High-throughput cloning and expression in recalcitrant bacteria

Nucleic Acids Research

Supplemental Data. Polymorphic Members of the lag Gene. Family Mediate Kin Discrimination. in Dictyostelium. Current Biology, Volume 19


Supplemental Data. Short Article. Transcriptional Regulation of Adipogenesis by KLF4. Kıvanç Birsoy, Zhu Chen, and Jeffrey Friedman

The HLA system. The Application of NGS to HLA Typing. Challenges in Data Interpretation

SUPPLEMENTARY INFORMATION. doi: /nature08559

Codon bias and gene expression of mitochondrial ND2 gene in chordates

(10) Patent No.: US 7,070,959 B1

Supplemental Data. Sheerin et al. (2015). Plant Cell /tpc h FR lifetime (ns)

Phenotypic response conferred by the Lr22a leaf rust resistance gene against ten Swiss P. triticina isolates.

INTRODUCTION TO THE MOLECULAR GENETICS OF THE COLOR MUTATIONS IN ROCK POCKET MICE

Electronic Supplementary Information

CHAPTER II MATERIALS AND METHODS. Cell Culture and Plasmids. Cos-7 cells were maintained in Dulbecco s modified Eagle medium (DMEM,

Catalog nos , , , ,

Supplemental Data. The Survival Advantage of Olfaction. in a Competitive Environment. Supplemental Experimental Procedures

Protocol T45 Community Reference Laboratory for GM Food and Feed

2.1 Calculate basic statistics

Thr Gly Tyr. Gly Lys Asn

Programmable RNA microstructures for coordinated delivery of sirnas

Olerup SSP KIR Genotyping

Supplementary Appendix

Modular Design of Ultrahigh-Intensity Nanoparticle Probe for Cancer Cell Imaging and Rapid Visual Detection of Nucleic Acid

2.5. Equipment and materials supplied by user Template preparation by cloning into plexsy_invitro-2 vector 4. 6.

Universal Split Spinach Aptamer (USSA) for Nucleic Acid Analysis and DNA Computation

Research Note. Evaluation of PCR-based approach for serotype determination of Streptococcus pneumoniae

Antigenic Variation of Ehrlichia chaffeensis Resulting from Differential Expression of the 28-Kilodalton Protein Gene Family

Supporting Online Material for

Event-specific Method for the Quantification of Soybean Line A Using Real-time PCR. Protocol

Sexing Bovine Preimplantation Embryos by PCR

US 7,074,904 B2. Wong et al. Jul. 11, (45) Date of Patent: (10) Patent No.: (12) United States Patent (54) (75)

DRACULA2 is a dynamic nucleoporin with a role in regulating the shade. Marçal Gallemí, Anahit Galstyan, Sandi Paulišić, Christiane Then, Almudena

Application of DNA machine in amplified DNA detection

Supplementary Materials for

In-Fusion Advantage PCR Cloning Kit

Supplementary Information. A chloroplast envelope bound PHD transcription factor mediates. chloroplast signals to the nucleus

Supplementary information. USE1 is a bispecific conjugating enzyme for ubiquitin and FAT10. which FAT10ylates itself in cis

Supporting Information

Mutations in the Human ATP-Binding Cassette Transporters ABCG5 and ABCG8 in Sitosterolemia

Transcription:

PCRbased Markers and Cut Flower Longevity in Carnation Laura De Benedetti, Luca Braglia, Simona Bruna, Gianluca Burchi *, Antonio Mercuri and Tito Schiva Istituto Sperimentale per la Floricoltura, Corso Inglesi 508, 18038 Sanremo (IM), Italy * Istituto Sperimentale per la Floricoltura, Pescia (PT), Italy Keywords: Dianthus caryophyllus, postharvest, RAPD analysis, ethylene, polymorphism, assisted selection Abstract In carnation, the identification of molecular markers linked to flower vase life character could be an important tool to improve the efficiency of breeding programs, considering that this is one of the most important traits selected by breeders. Longevity is probably a complex quantitative trait, involving several genes showing predominantly additive effects. A previous study carried out on cv. Roland, cv. Milady, and their progenies showed that some RAPD bands significantly discriminated a population with longer vase life. With the aim to verify the general use of these markers for assisted selection, 12 commercial varieties of carnation were collected and analyzed with the RAPD technique. The 23 fragments produced with ten decamers were not able to discriminate the genotypes with greater vase life. In order to identify more effective markers, preliminary analyses were also conducted on four genotypes, using 30 primer sets designed to amplify internal sequences from ethylene biosynthesis and response pathway genespcr products were obtained with 22 primer pairs, and some polymorphic fragments were observed even in the agarose gels. INTRODUCTION The postharvest longevity of flowers is of crucial importance in determining the value of an ornamental crop. Carnation (Dianthus caryophyllus L.) is one of the leading commodities in the ornamental industry worldwide. In this species, vase life is one of the most important traits considered by breeders. Research on postharvest physiology in carnation has been carried out in our Institute since 1992: the role of ethylene in flower senescence was investigated and several genotypes with different postharvest life and climateric behaviours, were identified (Burchi et al., 1993). Analysis of the segregation of flower vase life indicated that this character is probably a complex quantitative trait, involving more than a single gene or mechanism, and that these genes show predominantly additive effects (Burchi et al., 1999). Molecular markers associated with this character were previously identified in the progenies of a cross between two cultivars with different longevity ( Roland and Milady ), using the RAPD technique (De Benedetti et al., 2003). The aim of this study was to evaluate if these markers, tested on other collected genotypes, could be proposed as a general model for the assisted selection of vase life in carnation. Another approach, in order to identify other useful and effective markers, was the use of specific primers to obtain amplification of ethylene biosynthesis and response pathway genes. MATERIALS AND METHODS Plant Material and DNA Extraction Twelve Dianthus caryophyllus genotypes, obtained from the private breeder Hybrida, SanremoItaly, and 2 cultivars ( Roland and Milady ), belonging to the Experimental Institute of Floriculture collections, were analysed. Roland had the longest vase life with late and very low ethylene production in comparison with other cultivars, Proc. V th IS on New Flor. Crops Eds.: A.F.C. Tombolato and G.M. DiasTagliacozzo Acta Hort. 683, ISHS 2005 437

such as Milady, in which ethylene released by the flower promoted and accelerated senescence (Burchi et al. 1999). The commercial varieties included standard and spray Mediterranean ecotypes. Six varieties ( 200013, 200020, 200046, 98076, 200101 and 200147 ) were characterized by extended longevity (>16 days; trials conducted in March 2003, at 23 C with 75% relativity humidity); the remaining individuals ( 99109, 96118, 200108, 92027, 97116 and 97142 ) showed lower values ( 12 days). DNA was extracted from 100 mg of young leaves using a commercial kit (DNAeasy Plant Mini Kit, Qiagen), according to the manufacturer s instructions. RAPD Analysis RAPD markers previously identified were analyzed in all genotypes using ten random decamers (De Benedetti et al., 2003). Conditions for PCR (Polymerase Chain Reaction) and electrophoresis separation were previously described (De Benedetti et al., 2001). Specific Primer Amplifications Sequences of carnation ethylene biosynthesis and regulation genes were downloaded from the NCBI database. Nine different accessions were selected and used for designing primers using the PRIMER 3 software. Primers were designed to be between 1824 bases long and to amplify internal regions of 400800 base pairs. Thirty primer sets were tested on four individuals ( Roland, Milady, 200013 and 96118 ). PCR was carried out in 50 μl reaction mixture containing 100 ng of template DNA, 1X buffer, 1.5 mm MgCl 2, 200 μm each of dctp, dgtp, datp and dttp, 10 picomoles of each primer, and 1.5 units of Taqpolymerase (Gibco B.R.L.) A thermal cycler PCR Express (Hybaid) was programmed for 30 cycles with the denaturation temperature at 94 C for 1 min and the extension temperature at 72 C for 1 min. The annealing temperature was calculated for each primer pairs using PRIMER 3. Amplification products were separated by electrophoresis on 1.2% agarose gels using TAE buffer (40 mm Trisacetate, 1mM EDTA) and visualized by ethidium bromide staining. RESULTS AND DISCUSSION A previous study carried out on Roland, Milady and their progenies showed that some RAPD bands significantly discriminated a population with greater flower longevity (De Benedetti et al., 2003). The amplification patterns of the commercial varieties were compared to Roland and Milady fragments (Table 1). A score was calculated based on the similarity of each of 23 bands analyzed with Roland (1) or Milady (0). The individuals with longer vase life did not show higher scores compared to the genotypes with shorter longevity. These RAPD bands were not able to discriminate the two groups. This could be explained by the high genetic similarity of this material, coming from the same breeder and selected since 1950 for longevity. More effective markers should be identified for the assisted selection of vase life characters in carnation genotypes. Molecular markers for candidate gene analysis can be identified, looking for polymorphisms in the genes involved in the expression of the character of interest and analyzing their cosegregation with the trait in a set of individuals with different phenotypes (Arus, 2000). With this aim, we started to analyze ethylene biosynthesis and regulation gene sequences using specific primer sets. Amplification products were obtained in four individuals using 22 primer pairs (Table 2). For three primer pairs (n. 8, 11 and 19) the agarose gel separation showed polymorphic fragments in cv. Roland (data not shown). The amplification of all individuals with these primers sets, showed polymorphic fragments for one combination in one of the varieties ( 20020 ) with greater vase life (Fig. 1). Further analyses, such as restriction site and SSCP (Single Stranded Conformation Polymorphism) analyses, will be performed on all samples to detect more polymorphism 438

and to find a possible correlation between different alleles and the cut flower longevity. The identification of markers linked to longevity could allow the early screening of a population with a long flower vase life and could make the selection procedure more effective. ACKNOWLEDGEMENTS Thanks to Dr. Flavio Sapia (Hybrida, Sanremo, Italy) for providing plant material. Literature Cited Arus, P. 2000. Molecular Markers for Ornamental Breeding. Acta Hort. 508:9197. Burchi, G., MensualiSodi, A., Panizza, M. and Bianchini, C. 1993. Preliminary results of molecular studies on senescence in carnation flowers ageing on plant or in vase: 1. Role of ethylene. Proc. XVIIth EUCARPIA Symposium, Sanremo, Italy, 15 March, p.199206. Burchi, G., Bianchini, C., Mercuri, A., Foglia, G., Rosellini, D. and Schiva, T. 1999. Analysis of postharvest flower life in a cross between carnation cultivars with different ethylene responses. Journal of Genetics and Breeding 53: 301306. De Benedetti, L., Mercuri A., Bruna, S., Burchi, G. and Schiva, T. 2001. Genotype Identification of Ornamental Species by RAPD Analysis. Acta Hort. 546: 391393. De Benedetti, L., Burchi, G., Bruna, S., Mercuri A. and Schiva, T. 2003. Molecular Markers and Cut Flower Longevity in Carnation. Acta Hort. 624: 343348. 439

Tables Table 1. RAPD markers obtained in 14 genotypes with different vase life. RAPD Marker More Longeve Roland 200147 200101 98076 200046 200020 200013 Less Longeve 97142 97116 92027 200108 96118 99109 Milady 591 592 592.0 602 603 605 615 616 664 703 709 722 913 914 919 982 983 985 1032 1033 1042 1043 1044 Score 6 4 4 6 6 7 13 0 5 5 5 6 6 6 / : presence or absence of an RAPD band. 440

Table 2. Primer pairs used to amplify carnation ethylene biosynthesis and regulation genes. Primer set Primer sequences (5 3 ) Gene Accession 1 ttc agg gag caa aag ttc aaa cgg tgc atc aca ctc ttg ta 2 3 4 cct ggg cct tca ttt tga aa gtg ctc tcc caa tca atg tca t aac aat tat tcc gca gtt atg a ata caa ata ctg cgg gtg gg act ccg aaa tta gaa gcc gc ttg taa ttt gaa tga ata ctc cg DCACO1 (ACC oxidase) AB042320 5 6 ttc agg gag caa aag ttc aaa cgt tat tta tag ttc att tga tta g atg atg gcg acc ttt gtg tt ttt gaa ctt ttg ctc cct gaa Similar to DCACO1 AB042321 7 caa acc cgt caa atc cct ta taa ggt cgc att gtc cat gt CARACC (ACC synthase) M66619 8 9 aat taa cga aca tgg caa aca aca atg gag tgt ttc atg gga cag ctc ctc aag gat ggt ca att gta att tga atg aat act ccg t Senescence related protein M62380 10 11 12 gct ttt tga aac ttg att ttt ctt tt ttt cgg ctt att gca gct aaa ttc aac tcc aac aaa tcc acc ttt gtt cac gct tca ttt cg tct tga tat tgt tgt aga acc gtc tt cca gtc atg cac att tcc ag gcsdc 9 (SAM decarboxylase) U94786 441

Table 2. (Continued) Primer set 13 gaa atg gca cgt tta ctc gg gaa aca atc aat tat tcc aaa cca Primer sequences (5 3 ) Gene Accession gcsdc 9 (SAM decarboxylase) U94786 14 cgc aaa ctt ctg aag ctg ct cca acc gat aag ctg cca a CTR1 (Putative proteine kinase) AF261147 15 aaa ctg cta agc tgc ttc tgc ctt tta att tgg cat cac tac gac CTR2 (Putative proteine kinase) AF261148 16 17 18 19 gat ttg gct tag aac gct gc tcg agg gtg ctt ctg atc tt aac aga acg aca tgt aag aat gc ata act gac aag aat tcg tta cga g cac aat gtc gct tta gat tta gca ttg agc tca caa acc tgc ac ccg tct taa gcg atg gct att cag ggg aac ctt caa aaa gt DCERS (putative ethylene receptor) U83237 20 21 22 tca tca tca tct atg atc acc gt gca ctt tct ttg gca gtc atc gta cgt cag tca aag tgc ttg c cct ggt tat tgt ttt tcc cg tcg cag ttt caa atc gac aa tgc ata ctg ttt act aac gga ttt EIL1(ethyleneinsensitive3like protein 1) AF261654 442

Figures Fig. 1. Amplification of an internal region of the senescence related protein gene. (primer pair number 8). M: PCR marker (SigmaAldrich). 443