Supplementary Methods Reverse transcribed Quantitative PCR. Total RNA was isolated from bone marrow derived macrophages using RNeasy Mini Kit (Qiagen), DNase-treated (Promega RQ1), and reverse transcribed (Invitrogen). The resulting cdna was analyzed by quantitative Taqman PCR (See primer sequences below). Levels of ribosomal protein 17 were analyzed by Sybr green quantitative RT-PCR to normalize among cdna samples. Primers for Quantitative Taqman RT PCR. Naip1fwd TTGAAGCCATGCCCTTTGTT Naip1 rev AACGAGCAGTTCCTCCAGGTT Naip1 probe CTTATAAGCCAACAATTCCCAGATAAGGAAACATCA Naip2 fwd GAAAGCAACCATGATGATGCA Naip2 rev AGAGAACAGACACCAAGCTGGAT Naip2 probe CAGCAGTTCATTCTACAGTGGTGGATGTTTCTC Naip6 fwd GTTTCTCTGAAGATACTGAGTCTTAAAGGT Naip6 rev TGGGAACAAGCAGTTCCTCTAA Naip6 probe AACAATTTGCAGATAAGGAAACATCAGAAAAGTTTG Rps17 fwd CGCCATTATCCCCAGCAAG Rps17 rev TGTCGGGATCCACCTCAATG Primers for typing Naip5-deficient mice. Pr.1 TCAAAATTAACAATTGTTCATGCAGC Pr.2 CAGGCAAGGCTATAGAGTAAATCTATCTC
Supplementary Figure 1. Cytosolic expression of flagellin triggers IPAF-dependent pyroptotic cell death. (a) Flow cytometry of bone marrow cells transduced with retroviral constructs expressing the GFP-C35 fusion, as in Fig. 2e, and analyzed at the indicated timepoints after transduction for GFP expression. (b) Immortalized B6-derived bone marrow cells transduced with retroviral constructs expressing the GFP-C35 or GFP-C20 fusions and then stained at the indicated timepoints with 7AAD, a fluorescent dye excluded from viable cells, or counted. (c) Flow cytometry of wild-type (WT), IPAF-deficient (IPAF-KO) and caspase-3- deficient (Casp3-KO) macrophages transduced with retroviral constructs expressing the cytotoxic GFP-C35 or noncytotoxic GFP-C20 fusions.
Supplementary Figure 2. C-terminal leucines in L. pneumophila flagellin are required for caspase-1 activation. Immunoblot analysis for processed p10 of active caspase-1 in supernatants of bone-marrow-derived macrophages infected with L. pneumophila expressing flaa::flaa, flaa or the flaa::flaa-aaa mutant (see Fig. 3c) at an MOI of 1.
Supplementary Figure 3. C-terminal leucines in S. typhimurium flagellin are required for cytotoxicity but not for translocation into host cells. (a) Cell death assayed by release of lactate dehydrogenase (LDH) from wild-type (WT), IPAF-deficient (IPAF-KO) or Naip5- deficient (Naip5-KO) infected with wild-type (WT pflic) or flagellin-deficient (flicfljb), S. typhimurium (strain IR715) were transformed with IPTG-inducible plasmids expressing either wild-type salmonella flagellin (pflic) or flagellin in which the three C-terminal leucines are mutated to alanines (pflic-aaa). Infections were performed as described by Sun et al. 41 and LDH release was measured after 4 hours. An asterisk (*) indicates P < 0.05 (Student s t-test) as compared to the flicfljb pflic sample. (b) Fluorescence microscopy of macrophages infected with S. typhimurium expressing wild-type flagellin fused to β-lactamase 41 (flicfljb pflic::tem) or flagellin in which the three C-terminal leucines are mutated to alanines fused to β-lactamase (flicfljb pflic-aaa::tem) (top panels). Cells in which the β-lactamase fusion is translocated into the cytosol appear blue. A SPI-1 mutant strain (inva) was used (bottom panels) as a control to demonstrate that translocation of flagellin is SPI-1-dependent 41. The percentage of blue cells is indicated (at least 100 cells counted per sample). (c) Immunoblot of the FliC-β lactamase fusion proteins in IR715 were assessed by immunoblotting using an β-lactamase antibody (top panel) or rabbit serum against salmonella H antigen (FliC, bottom panel). An arrow indicates flagellin expressed from the chromosome. Both original and mutated salmonella flagellin-β-lactamase fusions (indicated with an asterisk) were expressed at a similar level.
Supplementary Figure 4. Targeted disruption of the mouse Naip5 gene. (a) Schematic map of the B6 Naip5 locus and gene targeting strategy. Exon11, encoding the entire essential nucleotide-binding domain of Naip5, was replaced with a G418 resistance gene (neo) in Bruce4 B6 ES cells. (b) Southern blot of targeted ES-cells. Digestion of DNA from ES-cells with NheI yields a 25 kb band for the wild-type Naip5 allele and an 11.1 kb band for the targeted allele, when hybridized with an exon16 probe, as indicated in a. (c) Schematic of PCR-based strategy used to type Naip5-deficient mice. The high degree of nucleotide identity between Naip5 and Naip6 was exploited to design primers capable of amplifying a similarly sized fragment from intron 11 of both genes. The binding site for primer 1 (Pr.1) within the Naip5 gene is deleted upon insertion of the targeting vector. The product derived from the wild-type Naip5 gene contains an EcoRV restriction site lacking in the Naip6-derived PCR product, yielding differential patterns upon digestion of the PCR product. (d) Quantitative RT-PCR showing that the disruption of Naip5 does not affect transcription of any other Naip genes expressed in C57BL/6 mice (Naip3 and Naip4 are not expressed in C57BL/6 mice). RNA was harvested from bone marrow-derived macrophages from WT and Naip5-deficient mice. Values are normalized against ribosomal protein gene rps17, and represent mean ± s.d. of triplicate samples. Results are representative of two separate experiments.