Ch. 10 From DNA to Protein
Protein Synthesis
Metabolism and Gene Expression n Inheritance of metabolic diseases suggests that genes coded for enzymes n Diseases (phenotypes) caused by non-functional gene product (Tay-sachs, PKU (phenylketonuria), albinism)
The Central Dogma PROTEINS Transcription (nucleus) Translation (cytoplasm)
RNA vs. DNA RNA Single strand Ribose DNA Double strands Deoxyribose Uracil (U) Thymine (T)
Transcription n the formation of a specific RNA sequence from a specific DNA sequence n requires: - a DNA template - nucleoside triphosphates (ATP, GTP, CTP, UTP) as substrates - RNA polymerase
RNA polymerase binds only to promoter. TATA box Transcription factors (proteins) help RNAP to bind.
RNAP moves along the DNA template from 3 to 5 RNAP adds complementary nucleotides to the growing mrna.
RNAP reaches termination site. Transcription stops. mran falls out.
Transcription Transcription Animation http://bcs.whfreeman.com/hillis1e/ #667501 674147
Eukaryotic DNA has junk n Exons (expressed/coding) segment of DNA n Introns in-between (non-coding) sequence
RNA splicing enzymes n snrnps (small nuclear ribonucleoproteins) n Spliceosome - snrnps binds to consensus sequences - cut and paste gene Not smurfs! snurps
Alternative RNA splicing n different segments treated as exons Defining a gene is getting more complicated!
RNA Splicing RNA Splicing http://bcs.whfreeman.com/hillis1e/#667501 674148
More post-transcriptional processing n Adding 5ʹ GTP cap and poly-a tail: - protects mrna on its trip from nucleus to cytoplasm from (hydrolytic) enzymes in cytoplasm - facilitates binding of RNAP n Neither 5 cap and poly-a tailget translated into proteins 3' 5' G P P P mrna A A 50-250 A s
Check Your Understanding
mrna codes for proteins in triplets DNA TACGCACATTTACGTACGCGG! codon mrna AUGCGUGUAAAUGCAUGCGCC!? protein Met Arg Val Asn Ala Cys Ala!
Cracking the Code Animated Tutorial 10.3 Deciphering the Code http://bcs.whfreeman.com/hillis1e/ #667501 674149
The Code n is the code for ALL life! n strongest support for a common origin for all life n redundant (several codons for each amino acid) but not ambiguous (code for the different amino acids) n 3rd base (3 end) wobble
Transfer RNA structure n Clover leaf structure n anticodon on clover leaf end, amino acid attached on 3ʹ end
Charging trna n AminoacyltRNA synthetase bonds amino acid to trna n Energy is required n ATP AMP n bond is unstable so it can release amino acid at ribosome easily
Ribosomes n A site (aminoacyl-trna) holds trna carrying next amino acid to be added to chain n P site (peptidyl-trna) holds trna carrying growing polypeptide chain n E site (exit) empty trna leaves ribosome from exit site
Building a polypeptide n Initiation brings together mrna, ribosome subunits, initiator trna n Elongation adds amino acids based on codon sequence n Termination adds end codon 3 2 1 Met Leu Met Met Met Leu Leu Leu Val Ser Ala Trp release factor trna 5' 5' U A C G A C U A C U A C G A C A A C A A U 5' A U G C U G A A U 5' mrna A U G C U G U A U G U G 3' 3' 3' E P A U A C G A C C A A U A U G U G 3' A C C U G G U A A 3'
Protein Synthesis Animated Tutorial 10.4 Protein Synthesis http://bcs.whfreeman.com/hillis1e/ #667501 674150
Initiation n small ribosomal subunit binds to mrna recognition sequence n Methione-charged trna binds to AUG. n Large subunit joins
Elongation n Second trna enters A site n Bond breaks between trna in P site and its amino acid n peptide bond forms between that amino acid and the amino acid on trna in A site n First trna moves to E site, dissociates from complex
Elongation n Elongation occurs as the steps are repeated, assisted by elongation factors.
Elongation n a stop codon enters A site n Stop codon binds a protein release factor n Polypeptide chain separates from the ribosome
Protein Targeting
Protein Modifications
Check Your Understanding
Check Your Understanding
DNA RNA polymerase Can you tell the story? pre-mrna exon intron 5' GTP cap amino acids trna large ribosomal subunit mature mrna poly-a tail polypeptide aminoacyl trna synthetase 3' 5' small ribosomal subunit E P A trna ribosome
Bacterial chromosome Protein Synthesis in Prokaryotes Transcription mrna Cell membrane Cell wall
Prokaryote vs. Eukaryote genes n Prokaryotes - DNA in cytoplasm - circular chromosome - naked DNA - no introns n Eukaryotes - DNA in nucleus - linear chromosomes - DNA wound on histone proteins - introns vs. exons eukaryotic DNA intron = noncoding (inbetween) sequence exon = coding (expressed) sequence
Translation in Prokaryotes n Transcription and translation are simultaneous in bacteria n DNA is in cytoplasm n no mrna editing n ribosomes read mrna as it is being transcribed
Translation in Eukaryotes