Single cell resolution in vivo imaging of DNA damage following PARP inhibition. Supplementary Data

Similar documents
Supplementary Figure 1. Additional RNAi screen data

Supporting information. Single-cell and subcellular pharmacokinetic imaging allows insight into drug action in vivo

Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and

Supplementary Fig. 1. (A) Working model. The pluripotency transcription factor OCT4

Supplemental Figure 1. HepG2 cells were transfected with GLI luciferase reporter construct

Supplementary Figure 1. Intracellular distribution of the EPE peptide. HeLa cells were serum-starved (16 h, 0.1%), and treated with EPE peptide,

Single cell imaging of Bruton's Tyrosine Kinase using an irreversible inhibitor

Nature Medicine: doi: /nm.4464

Supplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated

Supplementary Figure 1. Confirmation of sirna in PC3 and H1299 cells PC3 (a) and H1299 (b) cells were transfected with sirna oligonucleotides

SUPPLEMENTARY INFORMATION

Second Generation PARP1 Pharmacodynamic Assay

JCB. Supplemental material THE JOURNAL OF CELL BIOLOGY. Hong et al.,

Nature Biotechnology: doi: /nbt Supplementary Figure 1

Supplementary Information

Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas.

Supplementary Information

Supplementary Figure Legend

T H E J O U R N A L O F C E L L B I O L O G Y

Supplementary Figure 1

Supplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators.

SUPPLEMENTARY INFORMATION

Supplementary Figure 1. Antigens generated for mab development (a) K9M1P1-mIgG and hgh-k9m1p1 antigen (~37 kda) expression verified by western blot

Module 2: Systems Engineering (M2D6)

Hossain_Supplemental Figure 1

Supplementary Figure 1. ERK signaling is not activated at early hypertension. a, Western blot analysis for the level of phospho-erk (perk) and total

Nature Structural & Molecular Biology: doi: /nsmb.3308

Supplementary Materials for

SUPPLEMENTARY INFORMATION

Supplementary Figure 1. α-synuclein is truncated in PD and LBD brains. Nature Structural & Molecular Biology: doi: /nsmb.

SUPPLEMENTARY INFORMATION

B. C. Staurosporine BEZ235 DMSO. -actin. Suppl. Fig. 1 BEZ235 and BGT226 inhibit phosphorylation of Akt and downstream targets of PI3K and mtor.

SUPPLEMENTAL EXPERIMENTAL PROCEDURES

A novel mechanism of post-translational modulation of HMGA functions by the histone chaperone nucleophosmin.

Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.

Breast cell lines with Combination Index (CI) and p53 mutation status

Cancer cells that survive radiation therapy acquire HIF-1 activity and translocate toward tumor blood vessels Supplementary Information


gacgacgaggagaccaccgctttg aggcacattgaaggtctcaaacatg

supplementary information

Supplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified

< Supporting Information >

Resveratrol inhibits epithelial-mesenchymal transition of retinal. pigment epithelium and development of proliferative vitreoretinopathy

Figure S1. Optimization of reverse-transfection protocols using GAPDH sirnas. MDA- MB-231 cells were seeded in 96-well plates at a density of 5000

Human Astrocytes. ohsv (MOI)

Supplementary Figure 1. IFN-γ induces TRC dormancy. a, IFN-γ induced dormancy

Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets.

Supplementary Figure legends

Tumor tissues or cells were homogenized and proteins were extracted using

Supplementary Figure 1. Co-localization of GLUT1 and DNAL4 in BeWo cells cultured

Supplemental Materials and Methods

SUPPLEMENTARY INFORMATION. Small molecule activation of the TRAIL receptor DR5 in human cancer cells

Table 1. Primers, annealing temperatures, and product sizes for PCR amplification.

Supporting Information

The Effect of cdna on Tumor Cells Growth on Nude Mice

Lullaby sirna Transfection Reagent - Results

SUPPLEMENTAL MATERIAL. Supplemental Methods:

Tanja Krainz Current Literature July 9 th, 2016

Supplementary Figure 1: Sequence alignment of partial stem region of flaviviruses

Supplementary Figure 1. CryoTEM images of the barcoded nanoparticles (a) and

Supplementary Figure 1. Nature Structural & Molecular Biology: doi: /nsmb.3494

Supplementary information; Mungamuri et al., 2006

Supporting Information

Apoptosis And Anti-tumor Effect Induced By Mtor Inhibitor And Autophagy Inhibitor In Human Osteosarcoma Cells

Spironolactone ameliorates PIT1-dependent vascular osteoinduction in klotho-hypomorphic mice

Measuring Wound Healing and Cell Migration using Celigo Imaging Cytometer

Nature Medicine: doi: /nm.4169

MLN8237 induces proliferation arrest, expression of differentiation markers and

Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days,

SUPPLEMENTARY INFORMATION

Sarker et al. Supplementary Material. Subcellular Fractionation

Supplementary Figure 1 Collision-induced dissociation (CID) mass spectra of peptides from PPK1, PPK2, PPK3 and PPK4 respectively.

BF Fox-3 HLA merge A 3

Supplementary Figure 1

The Need for a PARP Pharmacodynamic Assay

Supplementary Figure 1. Western analysis of p-smad1/5/8 of differentiated hescs.

Journal of Cell Science Supplementary Material

PDIP46 (DNA polymerase δ interacting protein 46) is an activating factor for human DNA polymerase δ

SUPPLEMENTARY INFORMATION Figures. Supplementary Figure 1 a. Page 1 of 30. Nature Chemical Biology: doi: /nchembio.2528

FIGURE S1. Representative images to illustrate RAD51 foci induction in FANCD2 wild-type (wt) and

Multiplex Fluorescence Assays for Adherence Cells without Trypsinization

SUPPLEMENTAL MATERIALS SIRTUIN 1 PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF2 ACTIVATION

ATPlite Assay Performance in Human Primary Cells

Supplementary Information

SUPPLEMENTARY INFORMATION

Supplementary Figure 1.

Supplemental Material

Label-free, real-time live-cell assays for spheroids: IncuCyte bright-field analysis

SUPPLEMENTARY INFORMATION

ab Hypoxic Response Human Flow Cytometry Kit

Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD

Supplementary Figure 1. Immunoprecipitation of synthetic SUMOm-remnant peptides using UMO monoclonal antibody. (a) LC-MS analyses of tryptic

JCB. Supplemental material THE JOURNAL OF CELL BIOLOGY. Paul et al.,

Supplementary Figure 1 Activated B cells are subdivided into three groups

produced in this study characterized using 3-8 % gradient SDS-PAGE under reducing

Flag-Rac Vector V12 V12 N17 C40. Vector C40 pakt (T308) Akt1. Myc-DN-PAK1 (N-SP)

Supplementary Figure 1. Adipogenic protein expression in WT and KO MEFs after 7 days of adipogenic differentiation.

Supplemental Figure 1: CIP2A and SET levels are increased in some. primary human pancreatic cancer samples. (A) CIP2A mrna levels were

Supplementary Figure 1 Structural modeling and purification of V. cholerae ABH. (a) The migration of the purified rabh and catalytically inactive

Supplementary Fig. 1. Schematic structure of TRAIP and RAP80. The prey line below TRAIP indicates bait and the two lines above RAP80 highlight the

Transcription:

Single cell resolution in vivo imaging of DNA damage following PARP inhibition Katherine S. Yang, Rainer H. Kohler, Matthieu Landon, Randy Giedt, and Ralph Weissleder Supplementary Data Supplementary Figures Figure S1. 53BP1trunc-Apple reporter colocalizes with a canonical marker of DNA double-strand breaks, phospho-s139 ƔH2A.X. HCC1937 cells were treated with 0.1% DMSO (control), 100 µm olaparib or 1 µm etoposide for 24 hrs, or 10 µm cisplatin for 1 hr, followed by a 24 hr recovery. Following treatment, cells expressing 53BP1trunc-Apple (red) were fixed and stained with an antibody against S139 phosphorylated ƔH2A.X (green, abcam, ab26350) to observe colocalization (merge) of sites of double-strand breaks. Scale bar = 20 µm.

Table S1. Panel of breast, ovarian, and Ewing s sarcoma cell lines used to examine relationship between BRCA status and PARP inhibitor efficacy. The wildtype or mutant BRCA1 and BRCA2 status is shown for each cell line (compiled from the COSMIC database and literature, ND = not determined). Relative PARP expression is compared from the Western blot in Supplementary Fig. S2. The EC50 value from viability assays in cell culture is also shown (Supplementary Fig. S3). The PD50 value (halfmaximal pharmacodynamic response) was determined from imaging the increase in foci formation following olaparib treatment. The in vivo maximum fold change is the increase in the number of foci from daily olaparib IP injection (NG = no growth, NB = reporter not bright enough in these cell lines for in vivo use). Type Model BRCA1 BRCA2 PARP EC50 (µm) in vitro PD50 (µm) in vitro max fold change in vivo UWB1.289 -/- WT Med 0.26 0.17 NG Ovary A2780 WT WT Hi 4.7 0.03 NB OVCAR429 WT WT Low 29.4 0.63 NG MDA-MB-436 -/- WT Hi 0.032 0.15 3.9 Breast HCC1937 -/- WT Low 3.7 0.6 1.7 MDA-MB-231 WT WT Med 4.1 0.13 NG TC-252 ND ND Hi 1.03 0.02 NB Ewing s MHH-ES1 WT WT Hi 0.16 0.02 2.5 SK-PN-DW WT WT Low 2.4 21.7 NB

Figure S2. PARP1 protein expression in a panel of breast, ovarian, and Ewing s sarcoma cell lines. Cells were grown to confluence, lysed, and equal total protein was loaded and run on SDS-PAGE. PARP1 expression is shown for ovarian (left three lanes), breast (middle three lanes) or Ewing s sarcoma cell lines (right three lanes). PARP1 expression was quantified by densitometry using ImageJ (NIH) and normalized to a total protein membrane stain (bottom left, using the ~80kDa band outlined). Normalized PARP1 expression was plotted as a fold increase from the lowest expressing cell line (right). Error bars represent standard error of the mean from two independent experiments.

Figure S3. Measurement of cell viability in ovarian (top row), breast (middle row) and Ewing s sarcoma cells (bottom row). Cells were plated at low density 24 hrs prior to addition of increasing concentrations of olaparib (0 to 100 µm). After six days of treatment with olaparib, cell viability was measured using the PrestoBlue cell viability reagent (Life Technologies). The percentage of viable cells versus the concentration of olaparib was fit to a sigmoidal dose response curve using GraphPad (Prism). Error bars represent the standard error of the mean from at least two independent experiments.

Figure S4. Validation of the 53BP1trunc-Apple reporter in vivo. HT1080 cells expressing the 53BP1trunc-Apple reporter were implanted in the window chamber of nu/nu mice and grown for approximately two weeks before imaging. Mice were either in the vehicle (red, n = 3) or cisplatin treatment (blue, n = 3) group and were imaged before treatment and 24 and 48 hrs after a single bolus dose of drug (9 mg cisplatin/kg or 10% solutol in saline). The mean number of foci per nucleus at each time point and for each group is shown. At least 100 nuclei were analyzed for each mouse on each day of imaging. For the vehicle mice, no significant difference between each time point was observed (p-value > 0.05, two-tailed t-test). For the cisplatin treated mice, a significant difference between pre-treatment and 24 and 48 hrs after dosing was observed (p-value < 0.0001, two-tailed t-test). Error bars represent the standard error of the mean.

Figure S5. p21 and p53 protein expression in a panel of ovarian (left three lanes), breast (middle three lanes), and Ewing s sarcoma (right three lanes) cell lines. Cells were grown to confluence, lysed, and equal total protein was loaded and run on SDS-PAGE. Total protein membrane stain (Pierce) was used as a loading control. Blots are representative of at least two independent experiments.