Supplemental Table 1 Primers used in study Human Forward primer region(5-3 ) Reverse primer region(5-3 ) RT-PCR GAPDH gagtcaacggatttggtcgt ttgattttggagggatctcg Raftlin atgggttgcggattgaacaagttaga ctgaggtataacaccaacgaatttcaggc Raftlin-2 atggggtgcggacttagaaag ggagaataatgctgtgatatgaatcc Q-PCR GAPDH gagtcaacggatttggtcgt ttgattttggagggatctcg TICAM-1 agcgccttcgacattctaggt aggagaaccatggcatgca LYRIC ggcattgggtctactgctgag gacagaccatttaacccagacc 4F2 gacctcctgctcagcacccag gtaggggaagcggagcagcag Raftlin ctggatggaccggagagcaac gtattgccggcacttctgatggc IFN-β caacttgcttggattcctacaaag tattcaagcctcccattcaattg TLR3 aagacccatatgcaaaagattcaa tccagattttgttcaatagcttgttg MDA5 agagtggctgtttacattgcc gctgttcaacgtagcagtacctt IPS-1 ggtcggagctgagtaagcctg ccctcaagcttatactcattc Mouse Forward primer region(5-3 ) Reverse primer region(5-3 ) RT-PCR GAPDH atcactgccacccagaagac ccctcaagcttatactcattc Raftlin cacgaggttagcctctctgc tctgggatgagcttctggtc Raftlin-2 ggaggaacctcagcatgaaag ctttaggtgtctcccagcac Q-PCR GAPDH gcctggagaaacct tgaagcaggcatctgaggg Raftlin gaaggctgagcttcacgacgaag cggcctcctgcaccttcttaatgaac Raftlin-2 cacaagcaaacgacgctgcaaag ggcaagtagcactgggagac IFN-β ccagctccaagaaaggacga cgccctgtaggtgaggttgat
Supplemental Table 2 Poly(I:C)-binding proteins identified by mass-spectrometric analysis Category Number RNA binding 6 DEAD-box RNA helicase 4 Heat shock 3 Membrane / Cytoskeleton 25 Enzyme (including ATPase) 35 ER / translation 5 Mitochondrial 24 Nuclear 7 Transcription / splicing 4 GTP-binding 6 Other 8 Total 127
Supplemental Table 3 Representative poly(i:c)-binding proteins identified by mass-spectrometric analysis RNA-binding proteins ID Mr (kda) peptide number ELAV-like protein 1 IPI31936 36 1 Isoform 2 of double-stranded RNA-binding protein Staufen homolog 2 IPI164481 (+2) 59 9 Interferon-induced, double-stranded RNA-activated protein kinase IPI19463 (+1) 62 9 DEAD-box RNA helicases Isoform 1 of putative ATP-dependent RNA helicase DHX3 IPI411733 (+1) 134 1 Eukaryotic initiation factor 4A-I (DDX2A) IPI25491 (+2) 46 1 Isoform 1 of probable ATP-dependent RNA helicase DHX36 IPI27415 (+3) 115 9 Putative pre-mrna-splicing factor ATP-dependent RNA helicase DHX15 IPI396435 91 9 Heat shock proteins 6 kda heat shock protein, mitochondrial precursor IPI784154 61 15 Heat shock 7 kda protein 1 IPI34925 (+1) 7 13 Heat shock protein HSP 9-beta IPI414676 83 11 Cytoskeleton proteins Isoform 1 of clathrin heavy chain 1 IPI2467 (+1) 192 19 Tubulin beta chain IPI11654 5 15 Vimentin IPI418471 54 14 Myosin-4 IPI1753 (+5) 223 13 Moesin IPI219365 (+1) 68 13 Tubulin alpha-1b chain IPI387144 (+1) 5 11 Alpha-actinin-1 IPI1358 (+2) 13 9 Membrane proteins 4F2 cell-surface antigen heavy chain IPI27493 (+5) 58 9 Raftlin (lipid raft linker 1, PIG9) IPI749454 (+1) 63 9 Protein LYRIC IPI328715 64 9 Transferrin receptor protein 1 IPI22462 85 9
1 Supplemental Figure Legends Supplemental Fig. 1. Flow cytometric analysis of poly(i:c) binding to human cells and cell lines. Human monocyte-derived immature DCs (MoDC), B cells isolated from peripheral blood mononuclear cells using the MACS system (Miltenyi Biotech), HEK293 cells and several B cell lines were incubated with 25 µg/ml poly(i:c) in culture medium for 3 min at 4 C. After washing, cells were labeled with anti-dsrna mab (solid line) or mouse IgG2a as a control (shaded histograms) for 3 min at 4 C and then incubated with FITC-labeled secondary Ab. The cells were analyzed on a FACS Calibur. Supplemental Fig. 2. Poly(I:C)-induced IFN-β mrna expression was decreased in Raftlin knockdown HeLa cells. HeLa cells were transfected with 2 pmol control sirna or sirna to Raftlin (A, #1, s23219 used in Fig. 2; #2, s23217; #3, s23218), TICAM-1 or LYRIC (B) using Lipofectamine 2. Forty-eight hours after transfection, cells were washed and stimulated with 1 µg/ml poly(i:c) for 4 hours. Total RNA was extracted and IFN-β mrna expression (A, B, left hand panels) and Raftlin, TICAM-1 and LYRIC mrna expressions (A, B, right hand panels) were measured by RT-qPCR. Expression of each gene was normalized to GAPDH mrna expression. Data are shown as the mean ± SD, although the values are too small to represent. Representative data from three independent experiments are shown. *P<.5, ***P<.1 (t-test). Supplemental Fig. 3. TLR3-activating ability of Texas Red-labeled poly(i:c) is comparable to that of unlabeled poly(i:c). HEK293 cells were transfected with the expression vector for human TLR3 or empty vector (pef-bos) together with the IFN-β reporter plasmid. Twenty-four hours after transfection, cells were washed and stimulated
2 stimulated with unlabeled or Texas Red-labeled poly(i:c) (3, 1 µg/ml) or medium alone. After 6 hours, the luciferase reporter activities were measured and expressed as the fold induction relative to the activity of unstimulated vector-transfected cells. Representative data from three independent experiments are shown. Supplemental Fig. 4. Lipid raft disruption with MβCD does not affect poly(i:c) cellular uptake by MoDCs. MoDCs were pretreated with 1mM MβCD for 1 hour at 37 C. After washing with PBS, cells were incubated with 4 µg/ml Texas Red-poly(I:C) for 3 min at 4 C. After washing, cells were incubated for up to 3 min at 37 C. At timed intervals, cells were fixed and visualized by confocal microscopy. Representative images from 2 fields in the indicated time points are shown. Red, Texas Red-poly(I:C) ; blue, nuclei with DAPI. Bar, 5 µm. Poly(I:C) was rapidly internalized in MoDCs obtained from 6-days culture with GM-CSF and IL-4 compared with DCs transfected with control sirna (an additional 2-days culture was required) (Fig. 6D).
Supplemental Fig. 1 poly(i:c) (25 µg/ml) 1 MoDC HEK293 B cell 1 15 number Cell 1 1 1 1 2 1 3 1 4 1 Raji 1 1 1 1 1 2 1 3 1 4 BALL-1 1 1 1 1 1 2 1 3 1 4 Namalwa 1 1 1 1 2 1 3 1 4 1 1 1 1 2 1 3 1 4 Fluorescence intensity 1 1 1 1 2 1 3 1 4
-4 Supplemental Fig. 2 A Fold increase 6 5 4 3 2 1 poly(i:c) (1 µg/ml) sirna IFN-β mrna *** *** *** h 4h h 4h h 4h h 4h control Raftlin #1 Raftlin #2 Raftlin #3 Raftlin sirna #1, #2 of #3 mrna / GAPDH mrna (x1 ) -4 Raftlin sirna #1 sirna #2 sirna #3 18 18 18 12 12 12 6 6 6 control KD control KD control KD B Fold increase 1 8 6 4 IFN-β mrna *** * TICAM-1 or LYRIC mrna / GAPDH mrna (x1 ) TICAM-1 8 4 6 4 3 2 LYRIC 2 2 1 poly(i:c) (1 µg/ml) sirna h 4h h 4h h 4h control TICAM-1 LYRIC control KD control KD
Supplemental Fig. 3 IFN-β-promoter 25 IFN-β luc. fold induction 2 15 1 5 poly(i:c) (µg/ml) 3 1 3 1 3 1 3 1 pef-bos TLR3 pef-bos TLR3 unlabeled poly(i:c) Texas Red-poly(I:C)
Supplemental Fig. 4 Texas Red-poly(I:C) / MoDC 4ºC-3 min MβCD(-) MβCD(+) 37ºC-5 min 15 min 3 min