From Genes to Protein Transcription and Translation Metabolism Teaches Us About Genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from alkapton a.k.a. homogentisic acid ) PKU (phenylketonuria) each disease is caused by non-functional enzyme A B C D E 1 Gene 1 Enzyme Hypothesis Beadle & Tatum Compared mutants of bread mold, Neurospora fungus created mutations by X-ray treatments X-rays break inactivate a gene wild type grows on minimal media sugars + required precursor nutrient to synthesize essential amino acids mutants require added amino acids each type of mutant lacks a certain enzyme needed to produce a certain amino acid non-functional enzyme = broken gene Beadle & Tatum 1941 1958 Beadle & Tatum s Neurospora Experiment George Beadle Edward Tatum
So What is a Gene? One gene one enzyme all proteins are coded by genes but not all proteins are enzymes One gene one protein each polypeptide has its own gene but many proteins are composed of several polypeptides One gene one polypeptide but many genes only code for One gene one product but many genes code for more than one product Defining a Gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for, two genes can overlap, and there are many other complications. gene gene polypeptide 1 polypeptide 2 polypeptide 3 Elizabeth Pennisi, Science 2003 The Central Dogma How do we move information from to proteins? translation protein From nucleus to cytoplasm Where are the genes? Where are proteins synthesized? How does the information get from nucleus to cytoplasm? replication nucleus ribose sugar N-bases uracil instead of thymine U : A C : G single stranded m, r, t, si. Transcription Transcribed strand = template strand untranscribed strand = coding strand Synthesis of complementary strand bubble Enzyme that facilitates the building of : polymerase
Initiation polymerase binds to promoter sequence on Promoter sequences upstream of gene Role of promoter 1. Where to start reading = starting point 2. Which strand to read = template strand 3. Direction on = always reads 3' 5' polymerase molecules bound to bacterial Elongation polymerase unwinds ~20 base pairs at a time reads 3 5 Transcription builds 5 3 (the energy governs the synthesis!) No proofreading 1 error/10 5 bases many copies short life not worth it! Termination polymerase stops at termination sequence m leaves nucleus through pores GC hairpin turn Transcription in Eukaryotes 3 eukaryotic polymerase enzymes polymerase I only transcribes r genes polymerase I I transcribes genes into m polymerase I I I only transcribes r genes each has a specific promoter sequence it recognizes
Transcription in Eukaryotes Initiation complex factors bind to promoter region upstream of gene proteins which bind to & turn on or off TATA box binding site only then does polymerase bind to Eukaryotic Post-al Processing Primary transcript eukaryotic m needs work after Protect m from -ase enzymes in cytoplasm add 5' G cap add polya tail Edit out introns eukaryotic primary m transcript 5' 5' cap G P P CH 3 exon = coding (expressed) sequence mature m transcript m intron = noncoding (inbetween) sequence A pre-m spliced m 3' Prokaryote vs. Eukaryote Genetics Prokaryotes in cytoplasm circular chromosome naked no introns Eukaryotes in nucleus linear chromosomes wound on histone proteins introns vs. exons Prokaryote vs. Eukaryote Genetics Differences between prokaryotes & eukaryotes time & physical separation between processes processing eukaryotic intron = noncoding (inbetween) sequence exon = coding (expressed) sequence From Gene to Protein m leaves nucleus through nuclear pores nucleus m cytoplasm translation protein ribosome proteins synthesized by ribosomes using instructions on m Translation in Prokaryotes Transcription & translation are simultaneous in bacteria is in cytoplasm no m editing needed
How Does Code for Proteins m TACGCACATTTACGTACGCGG AUGCGUGUAAAUGCAUGCGCC protein Met Arg Val Asn Ala Cys Ala? Cracking the Code Nirenberg & Matthaei determined 1 st codon amino acid match UUU coded for phenylalanine created artificial poly(u) m added m to test tube of ribosomes, t & amino acids m synthesized single amino acid polypeptide chain phe phe phe phe phe phe 1960 1968 Translation Codons blocks of 3 nucleotides decoded into the sequence of amino acids Heinrich Matthaei Marshall Nirenberg m Codes for Proteins in Triplets m protein TACGCACATTTACGTACGCGG codon AUGCGUGUAAAUGCAUGCGCC? Met Arg Val Asn Ala Cys Ala m codes for proteins in triplets CODONS! The Code! For ALL life! strongest support for a common origin for all life Code is redundant several codons for each amino acid Start codon AUG methionine Stop codons UGA, UAA, UAG
m t amino acid How are Codons Matched to Amino Acids? 3' 5' TACGCAC ATTTACGTACGCGG 5' 3' AUGCGUGUAAAUGCAUGCGCC UAC GCA CAU Met Arg Val 3' 5' codon anti-codon nucleus cytoplasm translation protein t Structure Clover leaf structure anticodon on clover leaf end amino acid attached on 3' end Loading t Aminoacyl t synthetase enzyme which bonds amino acid to t endergonic reaction ATP AMP energy stored in t-amino acid bond unstable so it can release amino acid at ribosome Ribosomes Facilitate coupling of t anticodon to m codon organelle or enzyme? Structure ribosomal (r) & proteins 2 subunits large small Ribosomes A site (aminoacyl-t site) holds t carrying next amino acid to be added to chain P site (peptidyl-t site) holds t carrying growing polypeptide chain E site (exit site) empty t leaves ribosome from exit site
Building a Polypeptide Initiation brings together m, ribosome subunits, proteins & initiator t Elongation Termination Elongation: Growing a Polypeptide Termination: Release Polypeptide Release factor release protein bonds to A site bonds water molecule to polypeptide chain Protein Targeting Signal peptide address label ex. start of a secretory pathway Destinations: secretion nucleus mitochondria chloroplasts cell membrane cytoplasm polymerase Can you tell the eukaryotic story? pre-m exon 5' cap intron amino acids t Putting it all together mature m polya tail large subunit ribosome 5' small subunit E P A aminoacyl t synthetase 3' polypeptide t