Occurrence of viruses in apple and pear orchards in Latvia.

Similar documents
Lecture 10, 20/2/2002: The process of solution development - The CODEHOP strategy for automatic design of consensus-degenerate primers for PCR

Supporting information for Biochemistry, 1995, 34(34), , DOI: /bi00034a013

Hes6. PPARα. PPARγ HNF4 CD36

Figure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis

Y-chromosomal haplogroup typing Using SBE reaction

Electronic Supplementary Information

Arabidopsis actin depolymerizing factor AtADF4 mediates defense signal transduction triggered by the Pseudomonas syringae effector AvrPphB

Supplementary. Table 1: Oligonucleotides and Plasmids. complementary to positions from 77 of the SRα '- GCT CTA GAG AAC TTG AAG TAC AGA CTG C

Supplemental Data Supplemental Figure 1.

Disease and selection in the human genome 3

Supplementary Figure 1A A404 Cells +/- Retinoic Acid

Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH).

strain devoid of the aox1 gene [1]. Thus, the identification of AOX1 in the intracellular

Supplementary Figures

Supplemental Data. mir156-regulated SPL Transcription. Factors Define an Endogenous Flowering. Pathway in Arabidopsis thaliana

Supplemental Table 1. Primers used for PCR.

ΔPDD1 x ΔPDD1. ΔPDD1 x wild type. 70 kd Pdd1. Pdd3

Supporting Information

Supplemental Data. Bennett et al. (2010). Plant Cell /tpc

Legends for supplementary figures 1-3

Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC

PGRP negatively regulates NOD-mediated cytokine production in rainbow trout liver cells

Converting rabbit hybridoma into recombinant antibodies with effective transient production in an optimized human expression system

Supplementary Materials for

Materials Protein synthesis kit. This kit consists of 24 amino acids, 24 transfer RNAs, four messenger RNAs and one ribosome (see below).

Table S1. Bacterial strains (Related to Results and Experimental Procedures)

II 0.95 DM2 (RPP1) DM3 (At3g61540) b

Supporting Online Information

hcd1tg/hj1tg/ ApoE-/- hcd1tg/hj1tg/ ApoE+/+

PCR-based Markers and Cut Flower Longevity in Carnation

Dierks Supplementary Fig. S1

Supplemental material

Cat. # Product Size DS130 DynaExpress TA PCR Cloning Kit (ptakn-2) 20 reactions Box 1 (-20 ) ptakn-2 Vector, linearized 20 µl (50 ng/µl) 1

NAME:... MODEL ANSWER... STUDENT NUMBER:... Maximum marks: 50. Internal Examiner: Hugh Murrell, Computer Science, UKZN

Supporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2006

Overexpression Normal expression Overexpression Normal expression. 26 (21.1%) N (%) P-value a N (%)

Supplementary Information. Construction of Lasso Peptide Fusion Proteins

ORFs and genes. Please sit in row K or forward

Gene synthesis by circular assembly amplification

MacBlunt PCR Cloning Kit Manual

Supplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR

11th Meeting of the Science Working Group. Lima, Peru, October 2012 SWG-11-JM-11

Search for and Analysis of Single Nucleotide Polymorphisms (SNPs) in Rice (Oryza sativa, Oryza rufipogon) and Establishment of SNP Markers

Multiplexing Genome-scale Engineering

Complexity of the Ruminococcus flavefaciens FD-1 cellulosome reflects an expansion of family-related protein-protein interactions

Supplemental Information. Human Senataxin Resolves RNA/DNA Hybrids. Formed at Transcriptional Pause Sites. to Promote Xrn2-Dependent Termination

PCR analysis was performed to show the presence and the integrity of the var1csa and var-

Supplementary Methods Quantitative RT-PCR. For mrna, total RNA was prepared using TRIzol reagent (Invitrogen) and genomic DNA was eliminated with TURB

SUPPORTING INFORMATION

Supporting Information

SAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer

Project 07/111 Final Report October 31, Project Title: Cloning and expression of porcine complement C3d for enhanced vaccines

S4B fluorescence (AU)

Supplementary Information

RPA-AB RPA-C Supplemental Figure S1: SDS-PAGE stained with Coomassie Blue after protein purification.

Homework. A bit about the nature of the atoms of interest. Project. The role of electronega<vity

G+C content. 1 Introduction. 2 Chromosomes Topology & Counts. 3 Genome size. 4 Replichores and gene orientation. 5 Chirochores.

Lecture 11: Gene Prediction

evaluated with UAS CLB eliciting UAS CIT -N Libraries increase in the

2

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION

Primer Design Workshop. École d'été en géné-que des champignons 2012 Dr. Will Hintz University of Victoria

Quantitative reverse-transcription PCR. Transcript levels of flgs, flgr, flia and flha were

SUPPLEMENTARY INFORMATION. Material and methods

Protein Structure Analysis

Supplemental Information. Target-Mediated Protection of Endogenous. MicroRNAs in C. elegans. Inventory of Supplementary Information

Anti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR

Supplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of

-15 diopter negative lenses in wild-type and homozygous CHRM2-deleted mice, and

Supplemental Data. Jones et al. Plant Cell. (2010) /tpc

Lecture 19A. DNA computing

Supplementary Figure 1. The level of pri-mir-8 gradually decreases while those of BR-C and E74 increase during 3rd instar larval development.

SUPPLEMENTAL MATERIAL GENOTYPING WITH MULTIPLEXING TARGETED RESEQUENCING

Inhibition of Hepatitis C Virus Replication by GS-6620, A Potent C-Nucleoside Monophosphate Prodrug

Supplemental Data. Distinct Pathways for snorna and mrna Termination

The B1 Protein Guides the Biosynthesis of a Lasso Peptide

SUPPLEMENTAL TABLE S1. Additional descriptions of plasmid constructions and the oligonucleotides used Plasmid or Oligonucleotide

Yeast BioBrick Assembly (YBA)

Supporting Information. Trifluoroacetophenone-Linked Nucleotides and DNA for Studying of DNA-protein Interactions by 19 F NMR Spectroscopy

Chapter 13 Chromatin Structure and its Effects on Transcription

Codon Bias with PRISM. 2IM24/25, Fall 2007

Supporting Information

Appendix 1a. Microsatellite analysis of P1-hyg, P2-neo and their. Amplified cdna (base pairs) P1-hyg P2-neo All progeny A A

Dynamic enhancer-gene body contacts during transcription elongation

Supporting Information

Supplementary Material and Methods

DEVELOPMENT OF MOLECULAR TESTS FOR THE DETECTION OF ILAR AND LATENT VIRUSES IN FRUIT TREES

Phosphate and R2D2 Restrict the Substrate Specificity of Dicer-2, an ATP- Driven Ribonuclease

SUPPORTING INFORMATION FILE

Luo et al. Supplemental Figures and Materials and Methods

SUPPLEMENTARY INFORMATION

for Programmed Chemo-enzymatic Synthesis of Antigenic Oligosaccharides

DNA sentences. How are proteins coded for by DNA? Materials. Teacher instructions. Student instructions. Reflection

Supporting Information. Table of Contents

Efficient genome replication of hepatitis B virus using adenovirus vector: a compact pregenomic RNA-expression unit

Det matematisk-naturvitenskapelige fakultet

NESTED Sequence-based Typing (SBT) protocol for epidemiological typing of Legionella pneumophila directly from clinical samples

Supplemental Figure 1 Real-time RT-PCR analysis of 16 genes other than those shown in Fig. 6C.

Wet Lab Tutorial: Genelet Circuits

Transcription:

INTERNATIONAL SCIENTIFIC CONFERENCE Sustainable Fruit Growing: From Plant to Product Occurrence of viruses in apple and pear orchards in Latvia. Neda P pola, Anna K le, Inga Moro ko Bi evska.

The economically important virus diseases of apple and pear trees worldwide are Apple mosaic ilarvirus (ApMV), Apple chlorotic leaf spot trichovirus (ACLSV), Apple stem grooving capillovirus (ASGV) and Apple stem pitting foveavirus (ASPV). The status of occurence of viral diseases in orchards is not clear, since the 80s research has not been carried out on plant viruses and no certification program has been established in Latvia. The aim of this study was to evaluate the distribution of ApMV, ASGV, ACLSV and ASPV in different fruit tree varieties in commercial orchards and to collect virus isolates for further study.

Apple mosaic ilarvirus ApMV is named after the disease it causes in apple, the first host in which it was described. ApMV induces bright yellow patterns on leaves. In previous years pear was known to be susceptible to ApMV, but it was not known as a natural host. ApMV was recently detected in pears. At least 34 other plant species are susceptible host of ApMV, including Fragaria, Prunus, Ribes and Rubus. The virus is graft transmissible and it persists in propagative material, which is probably the main source of virus infection. The mechanism of transmission of ApMV is still unknown. ApMV symptoms on Ausma

Apple clorotic leaf spot trichovirus The ACLSV infect a wide range of fruit trees: apples, pears, plums and cherries. It is the most common virus in apple and pear orchards in other countries. Although most strains are latent, but some strains can cause russet rings on leaves and fruits. Russet rings caused by ACLSV on Mar erts Skujenieks

Apple stem grooving capillovirus ASGV is distributed worldwide in apple but it also infects pear, apricot and cherry trees. Usually ASGV doesn t cause obvious symptoms but in sensitive cultivars it can develop long grooves on the woody stem.

Apple stem pitting foveavirus ASPV is commonly present in commercial apple cultivars worldwide. ASPV frequently occurs in combination with other viruses such as ACLSV and ASGV. ASPV cause xylem pits in the stem of sensitive cultivars. ASPV is also the causal agent of stony pits and vein yellow disease of pear. The green crinkle and star crack diseases of apple are also associated with ASPV. Transmission of ASPV to woody host plants occurs by grafting only because a vector is not yet known. ASPV symptoms on pear cv. Bergamote

Materials and Methods Sample collection The samples were collected randomly from different cultivars from commercial orchards during June July of 2007 for ApMV, ACLSV, ASGV and during August September for ASPV. Totally 818 samples from 122 apple cultivars in 50 commercial orchards and 238 samples from 47 pear cultivars in 35 commercial orchards were collected. All collected leaf samples were analysed with ELISA and around 200 apple samples were also analysed with RT PCR.

Map of surveyed commercial apple orchards

Map of surveyed commercial pear orchards

DAS ELISA enzyme linked immunosorbent assay All samples were tested by DAS ELISA for detection of ApMV, ACLSV, ASGV and ASPV, using commercial kits (Bioreba, Switzerland). The cut off value was determinated by formula: S standart device Cut off = mean OD value +3 S +10%

Pentaplex RT PCR (according Hassan, Myrta and Polak, 2005) 1. Total RNA extraction was carried out using Rneasy Plant Mini Kit, according to the manufacturer s instructions (Qiagen, Germany) 2. Primers: ApMV: 5 CGT AGA GGA GGA CAG CTT GG 3 sense 5 CCG GTG GTA ACT CAC TCG TT 3 antisense ACLSV:5 TTC ATG GAA AGA CAG GGG CAA3 sense 5 AAG TCT ACA GGC TAT TTA TTA TAA GTC TAA 3 antisense ASGV: ASPV: Nad5: 5 GCC ACT TCT AGG CAG AAC TCT TTG AA 3 sense 5 AAC CCC TTT TTG TCC TTC AGT ACG AA 3 antisense 5 ATG TCT GGA ACC TCA TGC TGC AA 3 sense 5 TTG GGA TCA ACT TTA CTA AAA AGC ATA A 3 antisense 5 GAT GCT TCT TGG GGC TTC TTG TT 3 sense 5 CTC CAG TCA CCA ACA TTG GCA TAA 3 antisense 3. The Qiagen One step RT PCR kit (Qiagen, Germany) was used for RT PCR assays 4. PCR products were separated by electrophoresis in 2 % agarose gels in TAE buffer

Results Three viruses (ACLSV, ASGV and ASPV) were detected in apple and pear orchards during the survey, but ApMV was detected only in apple trees. These viral diseases are spread in all apple and pear growing regions in Latvia. Most common virus in apple trees was ACLSV, but in pear trees most common was ASPV.

The occurrence of 4 viruses in apple samples by DAS- ELISA

The occurrence of 4 viruses in pear samples by DAS-ELISA

Pentaplex RT PCR RT PCR is highly specific and sensitive assay for detection of all four viruses in apple trees. Pentaplex RT PCR allows to detect four target viruses in one assay. Pentaplex PCR was chosen to detect particular viruses in order to save time, reagents and to reduce costs. Many samples were infected with more than two viruses in different combinations. Most common combined infection was of three main apple viruses ACLSV, ASGV and ASPV. ACLSV 677 bp ApMV 450bp ASPV 370 bp ASGV 273 bp Nad5 181 bp

RT PCR The occurrence of 4 viruses in apple samples by RT PCR

Occurrence of four viruses in different apple cultivars according to RT PCR data

Occurrence of four viruses in different pear cultivars, according to ELISA data

Comparison of ELISA with RT PCR

Conclusions The ACLSV, ApMV, ASPV and ASGV are very common and wide spread in apple and pear orchards in Latvia and most of the comercially grown cultivars are infected. The production of certified and virus free planting material and its usage for the establishment of new plantings is the only measure to stop spreading of these viral diseases in orchards. ELISA which is comonly used for virus detection is fast and simple assay with relatively low cost, however it becomes unreliable for the detection of woody plant viruses during the summer due to decrease of virus concentration. In several cases it is reliable only during a short period maximum two months after bud break in spring. Pentaplex RT PCR is more effective and reliable for apple virus detection in comparison with ELISA and it is not dependent of time of the year. The internal control in this assay exclude false negatives which could be as a result of RNA degradation or presence of inhibitors, such as, polyphenols and polysaccharides, which can decrease the sensitivity of the detection.