Sequencing a North American yak genome Presentation for the annual meeting of the International Yak association Denver Colorado, January 24, 2014 Mike Heaton, Ph.D. USDA Meat Animal Research Center (USMARC), Clay Center, Nebraska An equal opportunity provider and employer Topics Introduction to USMARC, aims, and role Answering cattle questions with Yak DNA Publication of the Chinese yak genome sequence Opportunities to improve herds with DNA testing 1
USDA Meat Animal Research Center 35,000 acres 250 employees 54 scientists 6300 cows 5000 calves 720 litters 4000 ewes 7000 lambs USDA Meat Animal Research Center Federal appropriation: Sale of animals: $18.1 M $6.5 M 2013 operating budget: $24.6 M We host about 1700 visitors from 40 states and 28 countries per year Federally approved 6000-head capacity feedlot 2
M. Heaton USMARC Aim To deliver timely research for solving problems facing our stakeholders Michael P. Heaton, PhD Interest: reducing the impact of infectious disease Bacteria cell wall assembly: targets for antibiotics University of Nebraska-Lincoln, NE Northwestern University, Evanston, IL Super bugs antibiotic resistance Rockefeller University, New York, NY mating and gene transfer Donor (Vancomycin resistant) Recipient (Vancomycin susceptible) 3
Michael P. Heaton, PhD USMARC Animal Health Research (since 1996) Identify genetic resistance to infectious disease Bovine respiratory disease complex Ovine progressive pneumonia in sheep Genetics of prion disease Failure of passive transfer in neonatal calves Develop efficient DNA marker systems for cattle and sheep: disease traceback and animal identification parentage testing disease testing in sheep What is the goal? To read an animal s DNA sequence and predict its risk for disease. Outcome: DNA tests to improve herds 4
Who benefits from the research? DNA testing companies Agencies that use or perform DNA testing services Livestock breed associations and producers Researchers USDA firewall Mention of trade names or commercial products in this publication is solely for the purpose of providing specific information and does not imply recommendation or endorsement by the U.S. Department of Agriculture. What is DNA and how can we use it? A calf has about 10 trillion cells A allele from one parent, T allele from other from sire A T Phoebe, Grunniens Ranch nucleus from dam 30 chromosome pairs Bovine pulmonary endothelial cell-invitrogen 5
Two important concepts for understanding the genome Genes have DNA sequences encoding proteins. Proteins do the work in cells and regulate the body s tissues and organs. For more information, click to play short videos: http://www.dnatube.com/video/2933/the-human-genome-project-video--3d-animation-introduction https://www.23andme.com/gen101/genes/ Genes are encoded by sequences of DNA exon 1 exon 2 exon 3 exon 4 intron 1 Intron 2 intron 3 nucleotides: A, C, G, T Most of the genetic diversity in livestock occurs at this level 6
What are SNPs? Single Nucleotide Polymorphisms Sites in the genome where two different nucleotides occur DNA trace file individual #1: maternal chromosome paternal chromosome aatggtataaattaatgctt aatggtatatattaatgctt A/T individual #2: maternal chromosome paternal chromosome individual #3: maternal chromosome paternal chromosome aatggtataaattaatgctt aatggtataaattaatgctt aatggtatatattaatgctt aatggtatatattaatgctt A/A T/T DNA markers in cattle for parentage aatggtatcatattaatgctt aatggtatcatattaatgctt aatggtatcaaattaatgctt aatggtatcaaattaatgctt T/T A/A The calf must share an allele with each parent A/T aatggtatcaaattaatgctt aatggtatcaattaatgctt aatggtatctattaatgctt With 50 informative SNPs, the probability that a randomly chosen sire will be excluded from paternity >99% 7
Why not use microsatellite markers instead? (also known as variable number tandem repeats: VNTRs) A good microsatellite marker is five times more powerful than a good SNP allele. Tradition (legacy data), genotyping infrastructure However, SNP platforms now routinely use 50 to 700,000 markers SNPs 10-50 50-100 3,000 8,000 50,000 700,000 Whole genome Use Traits/Traceback Parentage/Inbreeding Genomic Selection Genomic Selection Gene Mapping Gene Mapping Causative Mutations Genomic advances in yak research 8
History of USMARC with IYAK research 2006 2007 2008 2009 2010 2011 2012 2013 2014 2006, Sep: The late Jerry McRoberts visited USMARC in 2006 to discuss yaks. 2007, Mar: IYAK board contacted for help in getting yak tissues for DNA. 2007, May: Received 2 yak steer livers from Mike Swartz. 2008, Jan: Planned for collecting 24 yaks across N. American population. 2008, Apr: Received 2 yak livers from Jim Watson. 2008, Dec: Received hair follicles from 11 yak from Jim Watson. 2009, Jan: 15 IYAK samples run on bovine 50k SNP chip by collaborator. 2009, Apr: Received 2 yak livers from Jim Watson (cattle genome published) 2009, Jul: Received 9 blood samples from Jim Watson Bulls 2009, Oct: IYAK DNA used in National Academy of Sciences paper (PNAS) 2010, Jan: Queen Allante passes away, tissue saved, sent to USMARC 2011, Jan: Received about 10 blood samples from Lawrence Richards 2012, Jan: IYAK DNA used in PLOS Genetics paper (sheep research) 2012, Jul: Chinese yak genome sequence published 2013, Dec: USMARC extracts good quality DNA from Queen Allante 2013, Dec: USMARC-Intrepid map Chinese yak genome to cattle genome--makes public 2014, Jan: Present results at annual IYAK meeting in Denver Research articles published with IYAK DNA 9
Research articles published with IYAK DNA Why am I here today? http://server1.intrepidbio.com/featurebrowser/customlist/record?listid=7646266992 Minke whale There is an opportunity to sequence the genome of a North American yak 10
Genome Sequencing costs cattle pig sheep yak anything Today: any animal sequenced (10X) for <$3000 What can you do with 10x whole genome sequence of a N. American yak? Design custom N. American yak-specific DNA tests for: Parentage determination and pedigree analysis Estimating percent Bos taurus DNA in an animal Manage inbreeding (conservation genetics) Traceback (forensics) Animal identification Genotype yak for newly discovered genes Map royal, trim solid coat color Disease resistance Wool Monogenic traits Learn how to use genomics to advance the IYAK mission 11
How does it work? Map 350M Chinese yak reads to cattle reference genome A G G L1 Dominette 01449 C C G,A nucleotide difference compared to cattle Yak SNP Chinese yak Huangyuan County of Qinghai Province Dr. Ted Kalbfleisch http://server1.intrepidbio.com/featurebrowser/customlist/record?listid=7646266992 Yak reads mapped to cattle red-black gene (MC1R) 12
Yak sequence differences in MC1R gene Yak-specific SNPs in the MC1R gene C/G yak SNP C = yak T = cattle nucleotide difference compared to cattle 13
Mapping a N. American yak genome Map 350M Chinese yak reads to cattle reference genome A G G C Map 350M Queen Allante reads to cattle reference genome L1 Dominette 01449 Chinese yak Huangyuan County of Qinghai Province C C G,A G,T IYAK SNP Queen Allante D171 How to turn IYAK DNA into IYAK tests IYAK DNA Contract sequencing outfit Bioinformatics, storage and web access outfit Identify > 100,000 SNPs Validation and use SNP tests in sets of 50 markers each ~300 SNPs For each test design Commercial genotyping outfit Genetic test design 14
What can you do with 10x whole genome sequence of a N. American yak? Design custom N. American yak-specific DNA tests for: Parentage determination and pedigree analysis Estimating percent Bos taurus DNA in an animal Manage inbreeding (conservation genetics) Traceback (forensics) Animal identification Genotype yak for new genes discovered in cattle or sheep: Map royal, trim solid coat color Disease resistance Wool Monogenic traits 15