Supporting Online Material for

www.sciencemag.org/cgi/content/full/315/5819/1709/dc1 Supporting Online Material for RISPR Provides Acquired Resistance Against Viruses in Prokaryotes Rodolphe Barrangou, Christophe Fremaux, Hélène Deveau, Melissa Richards, Patrick Boyaval, Sylvain Moineau, Dennis A. Romero, Philippe Horvath* *To whom correspondence should be addressed. E-mail: philippe.horvath@danisco.com This PDF file includes Materials and Methods Figs. S1 to S5 References Published 23 March 2007, Science 315, 1709 (2007) DOI: 10.1126/science.1138140

MATERIALS AND METHODS Isolation of phage-resistant mutants and confirmation of CRISPR sequences Streptococcus thermophilus phage-resistant mutants were obtained by challenging the wild-type host strain DGCC7710 (also called RD534) with phage 2972 and/or phage 858 (1). The host strain was grown at 42ºC in 10 ml of M17 broth supplemented with 0.5% lactose (LM17). When the optical density (600 nm) reached 0.3, phages and calcium chloride 10mM were added at a final concentration of 10 7 pfu/ml and 50 mm, respectively. The phage-containing culture was incubated at 42ºC for 24 hours and monitored for lysis. Then, 100 µl of the lysate were inoculated into 10 ml of fresh LM17. The remaining lysate was centrifuged and the pellet was inoculated into another tube containing 10 ml of fresh LM17. These two cultures were incubated at 42ºC for 16 hours. Finally, these cultures were diluted and plated on LM17. Isolated colonies were tested for phage sensitivity as previously described (2). The CRISPR loci of the resistant isolates were verified by sequencing PCR products, and using relevant phage genome information (1). CRISPR spacer engineering Enzymes used to carry out restriction digests and PCR were purchased from Invitrogen and used according to the manufacturer s instructions. PCRs were carried out on an Eppendorf Mastercycler Gradient thermocycler. Gene inactivation and site-specific plasmid insertion via homologous recombination in the S. thermophilus chromosome were carried out by sub-cloning into the pcr2.1-topo system (Invitrogen), by subsequent cloning in the pori system using Escherichia coli as a host, and the constructs were ultimately purified and transformed into S. thermophilus as previously described (3). DNA from mutant WT Φ858 +S1 was used as a template to amplify two distinct PCR fragments using P1 (5'-acaaacaacagagaagtatctcattg-3') and P2 (5'-aacgagtacactcactatttgtacg-3') in one reaction, and P3 (5'-tccactcacgtacaaatagtgagtgtactcgtttttgtattctcaagatttaagtaactgtacagtttgattcaacataaaaag-3') and P4 (5'-ctttccttcatcctcgctttggtt-3') in another reaction. Both PCR products were subsequently used as templates in another PCR reaction using primers P1 and P4 to generate the S1 construct (fig. S4). The S1 construct was sub-cloned into the Invitrogen pcr2.1-topo system. This construct was digested with NotI and HindIII and subsequently cloned into pori at the NotI and HindIII sites, providing the ps1 construct. Integration of ps1 into the CRISPR1 locus of strain WT Φ2972 +S4 occurred via homologous recombination at the 3' end of cas7, to generate WT Φ2972 +S4 ::ps1. The pr construct was generated using the ps1 construct as a template. Specifically, the S1 construct sub-cloned into pcr2.1-topo was digested using BsrGI, which cuts within the CRISPR repeat. Then, the digest was religated and a plasmid containing a single repeat and no spacer was used subsequently for cloning into pori using NotI and HindIII, generating pr. Integration of pr into the chromosome of strain WT Φ858 +S1 at the 3' end of cas7 via homologous recombination generated WT Φ858 +S1 ::pr, a mutant where the CRISPR1 locus is displaced and a unique repeat is inserted in its place. The mutant WT Φ858 +S1 ::pr was subsequently grown in the absence of erythromycin, and antibiotic-sensitive variants were analyzed to find a mutant that had a complete deletion of the CRISPR1 locus. The deletion was derived from homologous recombination occurring at the 3' end of ORF (as opposed to a recombination event occurring at the 3' end of cas7, which would have resulted

in restoration of the strain WT Φ858 +S1 ), generating WT Φ858 +S1 CRISPR1, a mutant where the CRISPR1 locus is deleted (fig. S5). Inactivation of cas genes For cas5 inactivation, a 801-bp internal piece of cas5 was amplified by PCR using primers 5'-caaatggatagagaaacgc-3' and 5'-ctgataaggtgttcgttgtcc-3' and sub-cloned into Escherichia coli pcr2.1- TOPO (Invitrogen). This construct was digested with EcoRV and HindIII and subsequently cloned into pori at the EcoRV and HindIII sites. Integration of this construct into the cas5 gene of strain WT Φ858 +S1 occurred via homologous recombination of the internal piece of the gene, resulting into WT Φ858 +S1 ::pcas5-. Similarly, a 672-bp internal piece of cas7 was amplified by PCR using primers 5'-ggagcagatggaatacaagaaagg-3' and 5'-gagagactaggttgtctcagca-3' and sub-cloned into Escherichia coli pcr2.1-topo (Invitrogen). This construct was digested with EcoRV and HindIII and subsequently cloned into pori at the EcoRV and HindIII sites. Integration of this construct into the cas7 gene of strain WT Φ858 +S1 occurred via homologous recombination of the internal piece of the gene, resulting into WT Φ858 +S1 ::pcas7-.

SUPPORTING FIGURES Strain GenBank Accession Lysotype Comment LMD-9 CP000419 A L DGCC7689 EF434458 A L DGCC778 EF434459 A1 BIM of LMD-9 L 120-9 EF434460 A2 BIM of LMD-9 L DGCC8769 EF434461 A3 BIM of LMD-9 L DGCC1086 EF434462 A L SMQ-301 EF434463 B L DGCC855 EF434464 B1 L DGCC1443 EF434465 B2 L DGCC8234 EF434466 C L DGCC7973 EF434467 C1 L 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 CNRZ703 DQ072990 n.d. L DGCC7796 EF434468 E L DGCC7710 EF434469 F L WTΦ858+S1 (= DGCC7778) EF434470 F1 BIM of DGCC7710 L WTΦ858+S3 EF434471 F2 BIM of DGCC7710 L WTΦ2972+S4 EF434472 F3 BIM of DGCC7710 L WTΦ2972+S5 EF434473 F4 BIM of DGCC7710 L WTΦ2972+S6 EF434474 F5 BIM of DGCC7710 L WTΦ2972+S7 EF434475 F6 BIM of DGCC7710 L WTΦ2972+S8 EF434476 F7 BIM of DGCC7710 L WTΦ858Φ2972+S9S10S11S12 EF434477 F8 BIM of DGCC7710 L WTΦ858Φ2972+S13S14 EF434478 F9 BIM of DGCC7710 L DGCC7699 EF434479 G L DGCC86 EF434480 G1 L DGCC8170 EF434481 G2 L DGCC8168 EF434482 G3 L DGCC48 EF434483 G3 L JIM1518 DQ073008 n.d. L JIM1560 DQ072996 n.d. L JIM1575 DQ072997 n.d. L JIM1588 DQ072999 n.d. L 4035 DQ073006 n.d. L DGCC7790 EF434484 H L DGCC7852 EF434485 H L DGCC7873 EF434486 H L CNRZ385 DQ072992 n.d. L DGCC7809 EF434487 J L DGCC103 EF434488 K L CNRZ1202 DQ072989 n.d. L 1205.3 DQ073005 n.d. L CNRZ1205 DQ073004 n.d. L DGCC7842 EF434489 M L JIM1567 DQ072995 n.d. L JIM76 DQ073003 n.d. L CNRZ1066 CP000024 N L DGCC6297 EF434490 N L DGCC944 EF434491 N L DGCC766 EF434492 N L DGCC7967 EF434493 Q L DGCC938 EF434494 Q1 L CNRZ389 DQ072987 n.d. L LMG18311 CP000023 n.d. L CNRZ1100 DQ072988 n.d. L DGCC7785 EF434495 Q2 L CNRZ388 DQ072986 n.d. L DGCC292 EF434496 Q3 L DGCC47 EF434497 R L DGCC7806 EF434498 R L JIM70 DQ073000 n.d. L DGCC7981 EF434499 R1 L DGCC66 EF434500 R2 L JIM72 DQ073002 n.d. L DGCC7984 EF434501 S L DGCC8191 EF434502 T L DGCC5472 EF434503 T L DGCC3367 EF434504 U L JIM71 DQ073001 n.d. L JIM1584 DQ072998 n.d. L CNRZ302 DQ072985 n.d. L JIM1293 DQ073007 n.d. L CNRZ1575 DQ072997 n.d. L Fig. S1. Graphic representation of CRISPR1 spacers across a variety of S. thermophilus strains. Repeats are not included, only spacers are represented. Each spacer is represented by a combination of one select character in a particular font color, on a particular background color. The color combination allows unique representation of a particular spacer, whereby squares with similar color schemes (combination of character color and background color) represent identical spacers, whereas different color combinations represent distinguishable spacers. Missing spacers are represented by crossed squares. L (blue): CRISPR leader sequence. In the third column, a letter indicates strain lysotype, whereby the lysotype is defined as the spectrum of sensitivity of the strain to a set of phages; lysotypes that show minor differences for specific phages are distinguished by an additional number. n.d.: not determined. BIM: bacteriophage insensitive mutant.

S1 CAACACATTCAACAGATTAATGAAGAATAC Φ858... 31381-31410 (+) Φ2972...GAT.GATTTC...T.AC...GA.. 30702-30731 (+) TCCACTCACGTACAAATAGTGAGTGTACTC Φ858...C... 25442-25471 (-) Φ2972...C... 25432-25461 (-) S3 TTACGTTTGAAAAGAATATCAAATCAATGA Φ858... 17215-17244 (+) Φ2972... 17202-17231 (+) S4 CTCAGTCGTTACTGGTGAACCAGTTTCAAT Φ858...T...T..G.TGG. 32292-32321 (+) Φ2972... 31582-31611 (+) S5 AGTTTCTTTGTCAGACTCTAACACAGCCGC Φ858 G...T... 22124-22153 (+) Φ2972... 22075-22104 (+) S6 GCCCTTCTAATTGGATTACCTTCCGAGGTG Φ858... 35334-35363 (-) Φ2972... 34492-34521 (-) S7 AAGCAAGTTGATATATTTCTCTTTCTTTAT Φ858... 10280-10309 (-) Φ2972... 10270-10299 (-) S8 CGTTTTCAGTCATTGGTGGTTTGTCAGCG Φ858.T.C...CTCAC.AAA..T...TTTA 30680-30708 (-) Φ2972... 29988-30016 (-) S9 TTACTAGAGCGTGTCGTTAACCACTTTAAA Φ858... 7882-7911 (+) Φ2972... 7874-7903 (+) S10 TTCGTTAAAGTCACCTCGTGCTAGCGTTGC Φ858... 20670-20699 (-) Φ2972... 20621-20650 (-) S11 ATAACGGTAGCAAATATAAACCTGTTACTG Φ858... 8368-8397 (+) Φ2972... 8360-8389 (+) S12 GAAGTAGCCATACAAGAAGATGGATCAGCA Φ858... 19047-19076 (+) Φ2972... 18998-19027 (+) S13 GATGTCACTGAGTGTCTAAGCATTGCGTAC Φ858... 34444-34473 (+) Φ2972... 33602-33631 (+) S14 TGAATAAGCAGTTCTTGACGACCAACCGAC Φ858... 4809-4838 (-) Φ2972... 4801-4830 (-) Fig.. Alignment of the acquired CRISPR spacers with the corresponding genomic region of phage 858 and phage 2972. Identical bases are indicated by a dot, whereas nucleotide polymorphisms are specified. Positions (bp) and DNA strand relative to the phage genomes are indicated on the right.

S1 CAACACATTCAACAGATTAATGAAGAATAC Φ858... Φ858-A...A... Φ858-B...C. Fig. S3. Alignment of CRISPR spacer S1 with the corresponding genomic region of phage 858 and the two mutant phages that have circumvented the CRISPR resistance of strain WT Φ858 +S1. WT +S1 Φ858 cas5 cas1 cas6 cas7 repeat/spacer region ORF L S1 T P1 P2 P3 P4 L S1 T P1 P4 S1 construct: L S1 T Fig. S4. Schematic representation of the PCR strategy followed to generate the S1 construct. Genomic DNA of strain WT Φ858 +S1 was used as a template in two distinct PCR reactions with primer pairs P1-P2, and P3-P4, respectively. The two PCR products were mixed and subjected to a third PCR reaction in the presence of primers P1 and P4.

WT +S1 Φ858 cas5 cas1 cas6 cas7 repeat/spacer region ORF pori Integration of the pr plasmid via homologous recombination WT +S1 Φ858 ::pr cas5 cas1 cas6 cas7 pori repeat/spacer region ORF cas5 cas1 cas6 cas7 pori repeat/spacer region Plasmid excision with deletion of CRISPR1 WT +S1 Φ858 CRISPR1 cas5 cas1 cas6 cas7 ORF Fig. S5. Diagram representing the homologous recombination events that led to mutants WT Φ858 +S1 ::pr and WT Φ858 +S1 CRISPR1. Strain WT Φ858 +S1 ::pr was generated through integration of the pr plasmid into cas7. Subsequently strain WT Φ858 +S1 CRISPR1 was obtained after plasmid excision via homologous recombination at the 3' end of ORF. SUPPORTING REFERENCES 1. C. Lévesque et al., Appl. Environ. Microbiol. 71, 4057 (2005). 2. S. Moineau, J. Fortier, H.-W. Ackermann, S. Pandian. Can J. Microbiol. 38, 875 (1992). 3. W. M. Russell, T. R. Klaenhammer, Appl. Environ. Microbiol. 67, 4361 (2001). Supporting Online Material www.sciencemag.org Materials and Methods Figs. S1 to S5 References and Notes