I. Nucleic Acid Structure nucleic acids are an organic (contains Deoxyribonucleic Acid genetic material C and H) polymer; remember the other CH OH organic molecules: genes blueprint for new cells blueprint for next generation blueprint for building proteins RNA protein 2 carbohydrates lipids O H H OH H OH HO H H OH glucose C6H12O6 proteins proteins I. Nucleic Acid Structure controls the activity of cells I. Nucleic Acid Structure by holding the code for proteins as pepsin organic catalysts that speed up nucleotide nucleotide nucleotide nucleotide nucleotide nucleo reactions growth hormone organic chemical messengers light chains each nucleotide as 3 parts: (like ATP) dexoyribose for ribose for RNA bind with antigens in our immune response antigen-binding site heavy chains A, T, C, G in A, U, C, G in RNA
I. Nucleic Acid Structure each phosphate connects to a sugar in a chain that makes the backbone of the nucleic acid molecule has 2 separate chains; called phosphate phosphate phosphate phosphate sugar N base sugar N base strong bonds sugar N base sugar N base I. Nucleic Acid Structure in, the nitrogenous bases that make up the steps of the ladder are held together by I. Nucleic Acid Structure Adenine (A) Cytosine (C) Thymine (T) Guanine (G) they are matched by complementary base pairing I. Nucleic Acid Structure when these complementary chains link together, the whole molecule twists, forming a the double helix model was discovered by James Watson and Francis Crick along with many other contributors in 1953
I. Nucleic Acid Structure this model explains two important characteristics of how genes work: a) replication (duplication) b) protein production II. How is Copied maintains continuity (composition and order of bases) by a process called occurs during interphase of cell cycle, when chromosomes double II. How is Copied here s how: 1) an enzyme unwinds or unzips the double helix between the base pairs, where the weak hydrogen bonds hold the strands together II. How is Copied here s how: 2) free nucleotides found in the cell (nucleus) match up to the opened strands, according to the complementary base pair pattern: Adenine (A) Cytosine (C) Thymine (T) Guanine (G)
II. How is Copied helicase II. How is Copied Another enzyme, polymerase, adds the bases to the opened chain, according to the pattern! bases in nucleus An enzyme, helicase, opens up the double helix, so one side can act as a the template for the other side. polymerase II. How is Copied One the entire side of is matched up, we now have two identical double helices. We made our copy! polymerase polymerase III. The Genetic Code is the genetic information proteins proteins run living organisms: enzymes all chemical reactions in living organisms are controlled by enzymes (proteins) structure all living organisms are built out of proteins
III. The Genetic Code Proteins Cells Tissues and so on proteins cells bodies III. The Genetic Code each strand of has about 3 billion base-pairs of nucleotides that code for proteins the building blocks for proteins are ; this is called a different combinations of nucleotides code for different amino acids! III. The Genetic Code is found in the nucleus too big to leave through pores protected in membrane bound nucleus proteins are made in cytoplasm made at the ribosomes III. The Genetic Code RNA Ribonucleic Acid RNA is a lot like (it is made up of 3-part nucleotides)...but there are 3 differences nucleus
III. The Genetic Code RNA Ribonucleic Acid 1) 2) 3) III. The Genetic Code RNA Ribonucleic Acid there are also 3 types of RNA 1) (messenger RNA) (the recipe) 2) rrna (ribosomal RNA) (the chef) 3) trna (transfer RNA) (the ingredients) protein nucleus trait
A. TRANSCRIPTION is a template for the production of 1) first, the must be unzipped (just like replication) T G G T A C A G C T A G T C A T C G T A C C G T 2) then, in the nucleus, free RNA nucleotides link up with the template in this pattern: Adenine (A) Uracil (U) No T in U Cytosine (C) Guanine (G) RNA! Guanine (G) Thymine (T) Cytosine (C) Adenine (A) A C C RNA polymerase A G C U A G C G G C A U G A U G T G G T A C A G C T A G T C A T C G T A C C G T A U A C A U C When transcribing RNA, U is matched with A instead of T TACGCACATTTACGTACGCGG AUGCGUGUAAAUGCAUGCGCC 3) the now formed single strand of now carries just a small part of the genetic code from the nucleus into the cytoplasm; the re-zips back up
The code must now be changed into a protein it must be TRANSLATED from nucleic acid code to amino acid sequence! transcription is transcribed and leaves nucleus through nuclear pores nucleus cytoplasm A C C A U G U C G A U C A G U A G C A U G G C A proteins are then synthesized by ribosomes using instructions on translation B. TRANSLATION 1) the from transcription in the nucleus moves out into the cytoplasm 2) meets up with the ribosomes (rrna) to transcription cytoplasm is transcribed and ribosome C C C U C U leaves nucleus through nuclear pores proteins are then synthesized by ribosomes using nucleus instructions on translation protein A A U G U G A A G A G C A U G G C A trait
3) trna brings amino acids to the ribosome from the cytoplasm the trna matches up with the : the trna binds complementary to the codon! trna 4) each new amino acid is bonded to the others by dehydration synthesis, forming a chain of peptides a! Remember, the peptide bond is formed between amino acids. amino acid amino acid amino acid amino acid amino acid So how does the code for the correct amino acid sequence in a protein? TACGCACATTTACGTACGCGG transcription AUGCGUGUAAAUGCAUGCGCC A C C A U G U C G A U C A G U A G C A U G G C A protein? translation Met Arg Val Asn Ala Cys Ala
TACGCACATTTACGTACGCGG protein codon AUGCGUGUAAAUGCAUGCGCC ribosome? Met Arg Val Asn Ala Cys Ala codes for proteins in triplets CODONS! This is the genetic code for ALL LIFE! It is evidence that supports that all life has a common ancestor. Is redundant: (amino acids can have mulitple codons) trna amino acid TACGCACATTTACGTACGCGG AUGCGUGUAAAUGCAUGCGCC UAC codon GCA CAU Met Arg Val anti-codon ribosome A C C A U G U C G A U C A G U A G C A U G G C A U G G U A C trna trna A G C trna U A G trna There are 61 different trna molecules carrying the 20 different amino acids! (3 for stop codons)
transcription cytoplasm translation ribosome protein A C C A U G U C G A U C A G U A G C A U G G C A V. One Gene One Polypeptide gene (revisited): if a certain protein is needed by the organism, the stretch of that holds the code for the polypeptides gets switched on; when not needed, it gets switched off gene chips green means gene active in only cell type 1 red means gene active in only cell type 2 yellow means gene active in both samples nucleus trait black means gene NOT active in both samples V. One Gene One Polypeptide gene (revisited): a section of that has the code for one polypeptide (amino acid chain) proteins are made up of one or more of these chains (hemoglobin has 4 chains) V. One Gene One Polypeptide gene mutation (revisited): a gene mutation is when the base sequence (A, T, C, G) of a stretch of is altered!
V. One Gene One Polypeptide gene mutation (revisited): V. One Gene One Polypeptide gene mutation (revisited): Here, a substitution of one nucleotide causes the transcript to change, which results in a new amino acid being placed in the protein. This is called a. V. One Gene One Polypeptide gene mutation (revisited): When you add or remove a nucleotide, this can upset the reading frame of bases. This can change the rest of the protein from that spot on. These are called. VI. & Individuality codes for proteins respiration enzymes (cytochrome C) digestive enzymes (lipase, amylase) rrna blue vs. brown eyes blood antigens (A, B, or none) structural proteins pigments
Because the genetic code is the same for all organisms, the of one organism can be cut and pasted into the of another organism. The organism that received this sequence of will follow this code and make the new molecules! recombinant the new recombined will produce the product that it codes for By using this technique, human have been able to modify agricultural products for consumption, make important hormones in massive quantities, and maybe one day be able to correct genetic disorders! Genetically Modified Organisms (GMO) Protect crops from insects: Bt corn corn produces a bacterial toxin that kills corn borer (caterpillar pest of corn) organisms that contain recombinant Extend growing season: fishberries strawberries with an anti-freezing gene from a species of Arctic fish are called Improve quality of food: golden rice rice producing vitamin A improves nutritional value
Genetically Modified Organisms (GMO) allowing organisms to produce new proteins bacteria producing human insulin bacteria producing human growth hormone here s how we do it find gene cut in both organisms paste gene from one creature into other creature s insert recombined sequence into organism organism copies and reads new gene as if it were its own organism produces NEW protein! this forms sticky ends, which other enzymes can paste back together restriction enzyme cut site GTAACGAATTCACGCTT CATTGCTTAAGTGCGAA EcoRI cuts at G AATTC restriction enzyme cut site GTAACG AATTCACGCTT CATTGCTTAA GTGCGAA you can cut different samples with the same restriction enzyme and get similar sticky ends that GTAACG AATTCACGCTT CATTGCTTAA GTGCGAA GGACCTG AATTCCGGA CCTGGACTTAA GGCCTA GGACCTG AATTCACGCTT CCTGGACTTAA GTGCGAA
cut sites gene you want cut sites TTGTAACGAATTCTACGAATGGTTACATCGCCGAATTCACGCTT AACATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGTGCGAA sticky ends AATTCTACGAATGGTTACATCGCCG GATGCTTACCAATGTAGCGGCTTAA isolated gene using bacteria only one chromosome = haploid! no nucleus (prokaryote) has lots of PLASMIDS! (small rings) cut sites chromosome want to add gene to AATGGTTACTTGTAACG AATTCTACGATCGCCGATTCAACGCTT TTACCAATGAACATTGCTTAA G ATGCTAGCGGCTAAGTTGCGAA ligase joins the strands Recombinant molecule sticky ends stick together chromosome with new gene added TAACG AATTCTACGAATGGTTACATCGCCG AATTCTACGATC ATTGCTTAA GATGCTTACCAATGTAGCGGCTTAA GATGCTAG plasmids bacteria chromosome using plasmids as a way to get genes into bacteria insert new gene into plasmid insert plasmid into bacteria = bacteria now expresses new gene cut bacteria make new protein gene from other organism + recombinant plasmid vector transformed bacteria human insulin gene in bacteria TAACG AATTCTACGAATGGTTACATCGCCGAATTCTACGATC CATTGCTTAA GATGCTTACCAATGTAGCGGCTTAAGATGCTAGC new protein from organism bacteria ex: human insulin from bacteria human insulin plasmid
gene from other organism plasmid + grow bacteria in mass quantities recombinant plasmid vector harvest (purify) protein transformed bacteria VIII. Population Genetics the study of factors which affect how often different alleles are present in sexually reproducing populations population: gene pool: gene frequency: VIII. Population Genetics Hardy-Weinberg Principle the gene frequency of a population stays stable (unchanged) as long as certain conditions are met G.H. Hardy mathematician W. Weinberg physician VIII. Population Genetics Hardy-Weinberg Principle the gene frequency of a population stays stable (unchanged) as long as certain conditions are met 1) 2) 3) 4) 5) HOWEVER: In nature, these conditions do not hold true (you can NEVER stop mutations), so the gene pool does change over each generation