Chapter 17 From Gene to Protein
The Flow of Genetic Information The information content of DNA is in the form of specific sequences of nucleotides The DNA inherited by an organism leads to specific traits by dictating the synthesis of proteins Proteins are the links between genotype and phenotype Gene expression, the process by which DNA directs protein synthesis, includes two stages: transcription and translation
Central Dogma of Biology DNA Replication Transcription RNA Translation Protein
Concept 17.1 Genes specify proteins via transcription and translation The process of producing an mrna transcript from a DNA template is known as transcription Facilitated by RNA polymerase The process of producing polypeptides from mrna is known as translation Facilitated by ribosomes To determine the sequence of amino acids based on the DNA sequence, the genetic code can be used to interpret the DNA sequence
Archibald Garrod Studied inherited metabolic conditions. First to suggest that genes dictate phenotypes through enzymes that catalyze specific chemical reactions in the cell. E.g. alkaptonuria Symptom of black urine caused by alkapton Garrod suggested that lack of the enzyme which metabolizes alkapton is the inherited trait Links gene to protein to phenotype
George Beadle and Edward Tatum Worked with the bread mold Neurospora and created mutants with x-rays Mutants could not survive on the minimal medium that was sufficient to support growth of the wildtype Neurospora Beadle and Tatum then hypothesized that the mutants lacked the ability to synthesize certain necessary molecules
George Beadle and Edward Tatum To determine the individual specific defects for each mutant, they selected for mutants by including one nutrient at a time This allowed them to identify mutants based on the nutrient it could not synthesize They hypothesized that these mutants lacked a necessary enzyme for the synthesis of that nutrient One gene one enzyme hypothesis The function of a gene is to dictate the production of a specific enzyme
Condition EXPERIMENT Growth: Wild-type cells growing and dividing No growth: Mutant cells cannot grow and divide Minimal medium RESULTS Minimal medium (MM) (control) Classes of Neurospora crassa Wild type Class I mutants Class II mutants Class III mutants MM + ornithine MM + citrulline MM + arginine (control) CONCLUSION Wild type Class I mutants (mutation in gene A) Class II mutants (mutation in gene B) Class III mutants (mutation in gene C) Gene A Gene B Gene C Precursor Precursor Precursor Precursor Enzyme A Enzyme A Enzyme A Enzyme A Ornithine Ornithine Ornithine Ornithine Enzyme B Enzyme B Enzyme B Enzyme B Citrulline Citrulline Citrulline Citrulline Enzyme C Enzyme C Enzyme C Enzyme C Arginine Arginine Arginine Arginine
Products of Gene Expression One gene one enzyme was a valid hypothesis at the time. But, not all proteins are enzymes. The phrase was then modified to one gene one protein. However, proteins can be composed of multiple polypeptides. The phrase was then again restated as one gene one polypeptide. The processes involved with going from gene to protein are known as transcription and translation
Transcription Genes provide the instructions for protein synthesis in the form of a nucleotide sequence. This sequence is used to generate a single stranded RNA molecule through the process of transcription RNA differs from DNA in the following ways: Single-stranded instead of double-stranded Ribose instead of deoxyribose Uracil (U) instead of thymine (T)
Transcription This RNA is known as messenger RNA (mrna). In eukaryotes, the mrna that is produced contains some information that is not included in the final polypeptide. This initial mrna known as pre-mrna must undergo RNA processing to form a mature mrna that contains only regions that code for a polypeptide sequence. This pre-mrna is also known as a primary transcript
Translation After the production of the mrna from the gene through transcription, a polypetide can be synthesized from the mrna through the process of translation. The instructions held in the sequence of the mrna direct the formation of a polypeptide by ribosomes, which work to link amino acids together in the correct order to form a polypeptide chain. These instructions are given in the sequence of the nucleotide bases which can be deciphered using the genetic code.
Nuclear envelope TRANSCRIPTION DNA TRANSCRIPTION DNA mrna RNA PROCESSING Pre-mRNA TRANSLATION Ribosome mrna Polypeptide TRANSLATION Ribosome (a) Bacterial cell Polypeptide (b) Eukaryotic cell
The Genetic Code There are 4 nucleotide bases that make up DNA sequences. However, there are 20 amino acids for which they provide the code. This is possible through a triplet code. Each possible combination of three nucleotide bases codes for an amino acid. The instructions for the sequence of amino acids in a polypeptide are written in non-overlapping threenucleotide words.
Codons During transcription, one of the two DNA strands called the template strand provides a template for ordering the sequence of nucleotides in an RNA transcript The template strand is read in the to direction During translation, the mrna base triplets, called codons, are read by translation machinery in the to direction Each codon specifies the amino acid to be placed at the corresponding position along a polypeptide Each codon specifies the addition of one of 20 amino acids
DNA molecule Gene 1 Gene 2 Gene DNA template strand TRANSCRIPTION mrna TRANSLATION Codon Protein Amino acid
Cracking the Code All 64 codons were deciphered by the mid-1960s Of the 64 triplets, 61 code for amino acids; triplets are stop signals to end translation The genetic code is redundant but not ambiguous; no codon specifies more than one amino acid Codons must be read in the correct reading frame (correct groupings) in order for the specified polypeptide to be produced
Evolution of the Genetic Code The genetic code is highly conserved. Most organisms from the simplest to the most complex use the same code Gene sequences from one species can be transcribed and translated in another species when transferred. Examples: tobacco plant expressing a firefly gene Insulin production by yeast or E. coli
Concept 17.2 Transcription is the DNA-directed synthesis of RNA: a closer look Transcription involves three phases: initiation, elongation, and termination. The initial transcript that is produced is the premrna which needs RNA processing to produce the final mature mrna which will be used for translation
Synthesis of an RNA Transcript As with DNA replication, there are many enzymes involved with the synthesis of mrna during transcription. RNA polymerase produces the new mrna strand from the template strand of the DNA However, since RNA is being formed, uracil is used instead of thymine There are three stages of transcription: Initiation Elongation Termination
Initiation of Transcription The stretch of DNA that is transcribed is called a transcription unit The DNA sequence where RNA polymerase attaches is called the promoter; in bacteria, the sequence signaling the end of transcription is called the terminator Transcription factors mediate the binding of RNA polymerase and the initiation of transcription The completed assembly of transcription factors and RNA polymerase II bound to a promoter is called a transcription initiation complex A promoter called a TATA box is crucial in forming the initiation complex in eukaryotes
Promoter Transcription unit Start point RNA polymerase DNA 1 Initiation Elongation Nontemplate strand of DNA Unwound DNA RNA transcript Template strand of DNA 2 Elongation RNA polymerase end RNA nucleotides Rewound DNA RNA transcript Termination Completed RNA transcript Newly made RNA Direction of transcription ( downstream ) Template strand of DNA
Elongation of the RNA transcript As RNA polymerase moves along the DNA, it untwists the double helix, 10 to 20 bases at a time Transcription progresses at a rate of 40 nucleotides per second in eukaryotes A gene can be transcribed simultaneously by several RNA polymerases
Termination of Transcription The mechanisms of termination are different in bacteria and eukaryotes In bacteria, the polymerase stops transcription at the end of the terminator In eukaryotes, the polymerase continues transcription after the pre-mrna is cleaved from the growing RNA chain; the polymerase eventually falls off the DNA
Concept 17. Eukaryotic cells modify RNA after transcription RNA processing of pre-rna involves RNA splicing which is the removal of introns and joining of exons of the primary transcript by spliceosomes The ends of the pre-rna are also modified with a cap and a poly-a tail
Ends of the mrna strand Each end of a pre-mrna molecule is modified in a particular way: The end receives a modified nucleotide cap The end gets a poly-a tail These modifications share several functions: They seem to facilitate the export of mrna They protect mrna from hydrolytic enzymes They help ribosomes attach to the end Protein-coding segment Polyadenylation signal G P P P AAUAAA AAA AAA Cap UTR Start codon Stop codon UTR Poly-A tail
RNA splicing Most eukaryotic genes and their RNA transcripts have long noncoding stretches of nucleotides that lie between coding regions These noncoding regions are called intervening sequences, or introns The other regions are called exons because they are eventually expressed, usually translated into amino acid sequences RNA splicing removes introns and joins exons, creating an mrna molecule with a continuous coding sequence
RNA splicing In some cases, RNA splicing is carried out by spliceosomes Spliceosomes consist of a variety of proteins and several small nuclear ribonucleoproteins (snrnps) that recognize the splice sites Pre-mRNA Cap Exon Intron Exon Intron 1 0 1 104 10 Exon 146 Poly-A tail Coding segment Introns cut out and exons spliced together mrna Cap 1 146 UTR UTR Poly-A tail
RNA transcript (pre-mrna) Exon 1 Intron Exon 2 Protein snrna snrnps Other proteins Spliceosome Spliceosome components mrna Exon 1 Exon 2 Cut-out intron
Ribozymes Ribozymes are catalytic RNA molecules that function as enzymes and can splice RNA The discovery of ribozymes rendered obsolete the belief that all biological catalysts were proteins Three properties of RNA enable it to function as an enzyme It can form a three-dimensional structure because of its ability to base pair with itself Some bases in RNA contain functional groups RNA may hydrogen-bond with other nucleic acid molecules
Alternative RNA Splicing Some genes can encode more than one kind of polypeptide, depending on which segments are treated as exons during RNA splicing Such variations are called alternative RNA splicing Because of alternative splicing, the number of different proteins an organism can produce is much greater than its number of genes Proteins often have a modular architecture consisting of discrete regions called domains In many cases, different exons code for the different domains in a protein Exon shuffling may result in the evolution of new proteins
DNA Gene Exon 1 Intron Exon 2 Intron Exon Transcription RNA processing Translation Domain Domain 2 Domain 1 Polypeptide
Concept 17.4 Translation is the RNA-directed synthesis of a polypeptide: a closer look Translation is facilitated by ribosomes and trnas trnas have an anticodon that recognizes the complementary codon of the mrna sequence and directs the addition of amino acids
Molecular Components of Translation A cell translates an mrna message into protein with the help of transfer RNA (trna) Molecules of trna are not identical: Each carries a specific amino acid on one end Each has an anticodon on the other end; the anticodon base-pairs with a complementary codon on mrna
Polypeptide Amino acids Ribosome trna with amino acid attached trna Anticodon Codons mrna
The Structure and Function of Transfer RNA (trna) A trna molecule consists of a single RNA strand that is only about 80 nucleotides long When flattened into one plane, a trna molecule looks like a cloverleaf due to base pairing in regions of the molecule However, due to hydrogen bonds, trna actually twists and folds into a three-dimensional molecule that forms a shape that is more similar to an capital letter L The bottom loop is where the anticodon is located
mino acid ttachment site Amino acid attachment site Hydrogen bonds Hydrogen bonds Anticodon (a) Two-dimensional structure Anticodon (b) Three-dimensional structure Anticodon (c) Symbol used in this book
Translation Accurate translation requires two steps: 1. a correct match between a trna and an amino acid, done by the enzyme aminoacyl-trna synthetase 2. a correct match between the trna anticodon and an mrna codon Flexible pairing at the third base of a codon is called wobble and allows some trnas to bind to more than one codon
Amino acid Aminoacyl-tRNA synthetase (enzyme) P P P Adenosine ATP P P i P Adenosine trna P i P i Aminoacyl-tRNA synthetase trna P Adenosine AMP Computer model Aminoacyl-tRNA ( charged trna )
Ribosomes Ribosomes facilitate specific coupling of trna anticodons with mrna codons in protein synthesis The two ribosomal subunits (large and small) are made of proteins and ribosomal RNA (rrna)
Binding Sites A ribosome has three binding sites for trna: The E site is the exit site, where discharged trnas leave the ribosome The P site holds the trna that carries the growing polypeptide chain The A site holds the trna that carries the next amino acid to be added to the chain
trna molecules Growing polypeptide E P A Exit tunnel Large subunit Small subunit mrna (a) Computer model of functioning ribosome P site (Peptidyl-tRNA binding site) E site (Exit site) mrna binding site A site (AminoacyltRNA binding site) E P A Large subunit Small subunit (b) Schematic model showing binding sites Amino end mrna E Growing polypeptide Next amino acid to be added to polypeptide chain trna Codons (c) Schematic model with mrna and trna
Building a Polypeptide The three stages of translation: Initiation Elongation Termination All three stages require protein factors that aid in the translation process
Initiation of Translation The initiation stage of translation brings together mrna, a trna with the first amino acid, and the two ribosomal subunits First, a small ribosomal subunit binds with mrna and a special initiator trna Then the small subunit moves along the mrna until it reaches the start codon (AUG) Proteins called initiation factors bring in the large subunit that completes the translation initiation complex
U A A U C G P site Large ribosomal subunit Initiator trna mrna GTP GDP E A mrna binding site Start codon Small ribosomal subunit Translation initiation complex
Elongation of a Polypeptide Chain During the elongation stage, amino acids are added one by one to the preceding amino acid Each addition involves proteins called elongation factors and occurs in three steps: codon recognition, peptide bond formation, and translocation
Amino end of polypeptide mrna E Ribosome ready for next aminoacyl trna P site A site GTP GDP E E P A P A GDP GTP E P A
Termination of Translation Termination occurs when a stop codon in the mrna reaches the A site of the ribosome The A site accepts a protein called a release factor The release factor causes the addition of a water molecule instead of an amino acid This reaction releases the polypeptide, and the translation assembly then comes apart
Release factor Free polypeptide Stop codon (UAG, UAA, or UGA) 2 GTP 2 GDP
Polyribosomes A number of ribosomes can translate a single mrna simultaneously, forming a polyribosome (or polysome) Polyribosomes enable a cell to make many copies of a polypeptide very quickly Incoming ribosomal subunits Growing polypeptides Completed polypeptide Ribosomes mrna (a) Start of mrna ( end) End of mrna ( end) (b) 0.1 µm
Post-Translational Modifications Often translation is not sufficient to make a functional protein Polypeptide chains are modified after translation Completed proteins are targeted to specific sites in the cell During and after synthesis, a polypeptide chain spontaneously coils and folds into its three-dimensional shape Proteins may also require post-translational modifications before doing their job Some polypeptides are activated by enzymes that cleave them Other polypeptides come together to form the subunits of a protein
Ribosome Location Two populations of ribosomes are evident in cells: free ribsomes (in the cytosol) and bound ribosomes (attached to the ER) Free ribosomes mostly synthesize proteins that function in the cytosol Bound ribosomes make proteins of the endomembrane system and proteins that are secreted from the cell Ribosomes are identical and can switch from free to bound
Targeting Polypeptides Polypeptide synthesis always begins in the cytosol Synthesis finishes in the cytosol unless the polypeptide signals the ribosome to attach to the ER Polypeptides destined for the ER or for secretion are marked by a signal peptide A signal-recognition particle (SRP) binds to the signal peptide The SRP brings the signal peptide and its ribosome to the ER
Ribosome Signalrecognition particle (SRP) Signal peptide mrna Signal peptide removed ER membrane Protein CYTOSOL ER LUMEN SRP receptor protein Translocation complex
Concept 17. Point mutations can affect protein structure and function Mutations change DNA sequences A mutation in the coding region of DNA can change the resulting protein through changes in in amino acids Different mutations can have differences in severity in terms of the effect on the resulting protein
Mutagens Mutations result in changes in the original DNA sequence Spontaneous mutations can occur during DNA replication, recombination, or repair Mutagens are physical or chemical agents that can cause mutations
Point mutation Substitution A base-pair substitution replaces one nucleotide and its partner with another pair of nucleotides Silent mutations have no effect on the amino acid produced by a codon because of redundancy in the genetic code Missense mutations still code for an amino acid, but not necessarily the right amino acid Nonsense mutations change an amino acid codon into a stop codon, nearly always leading to a nonfunctional protein
Point Mutation Insertions and Deletions Insertions and deletions are additions or losses of nucleotide pairs in a gene These mutations have a disastrous effect on the resulting protein more often than substitutions do Insertion or deletion of nucleotides may alter the reading frame, producing a frameshift mutation
Wild-type DNA template strand mrna Protein Amino end Stop Carboxyl end A instead of G Extra A U instead of C Extra U Stop Stop Silent (no effect on amino acid sequence) Frameshift causing immediate nonsense (1 base-pair insertion) T instead of C missing A instead of G missing Stop Missense Frameshift causing extensive missense (1 base-pair deletion) A instead of T missing U instead of A missing Nonsense Stop Stop No frameshift, but one amino acid missing ( base-pair deletion) (a) Base-pair substitution (b) Base-pair insertion or deletion
Concept 17.6 While gene expression differs among the domains of life, the concept of a gene is universal Gene expression differs between the different domains of life but the general concept remains consistent DNA carries genetic information in the form of genes, which can be transcribed and translated to produce a final product in the form of a polypeptide or a protein
Gene expression in different domains Differences in mechanics of gene expression between bacteria and eukarya: Different RNA polymerases Different methods for termination of transcription Different ribosomes Archaea tend to be more similar to eukarya for these categories Bacteria can simultaneously transcribe and translate the same gene In eukarya, transcription and translation are separated by the nuclear envelope In archaea, transcription and translation are likely coupled
RNA polymerase DNA mrna Polyribosome RNA polymerase Direction of transcription 0.2 µm DNA Polyribosome Polypeptide (amino end) Ribosome mrna ( end)
Genes The idea of the gene itself is a unifying concept of life We have considered a gene as: A discrete unit of inheritance A region of specific nucleotide sequence in a chromosome A DNA sequence that codes for a specific polypeptide chain In summary, a gene can be defined as a region of DNA that can be expressed to produce a final functional product, either a polypeptide or an RNA molecule
TRANSCRIPTION DNA RNA transcript RNA PROCESSING Exon RNA polymerase RNA transcript (pre-mrna) Intron NUCLEUS Aminoacyl-tRNA synthetase CYTOPLASM Amino acid trna AMINO ACID ACTIVATION E P A Ribosomal subunits mrna Growing polypeptide Activated amino acid TRANSLATION E A Anticodon Codon Ribosome
Sense and Antisense TACATCGCCCATAACGAGAAT Template Strand (Antisense) Coding Strand (Sense) mrna polypeptide