Supporting Information
|
|
- Alvin Fields
- 5 years ago
- Views:
Transcription
1 Supporting Information Transition Metal Dichalcogenide Nanosheets for Visual Monitoring PCR Rivaling a Real-Time PCR Instrument Liu Wang 1,2, Zhicheng Huang 2, Rui Wang 1, Yibo Liu 2, Cheng Qian 1, Jian Wu 1 *, Juewen Liu 2 * 1 College of Biosystems Engineering and Food Science, Zhejiang University, Hangzhou , China wujian69@zju.edu.cn 2 Department of Chemistry, Waterloo Institute for Nanotechnology, University of Waterloo, Waterloo N2L 3G1, Ontario, Canada liujw@uwaterloo.ca S-1
2 Table S1. DNA primers used in this work. DNA name Sequence (5 3 ) Supplier pbr322-fp2 TGTCCAGGCAGGTAGATGA Eurofins Genomics pbr322-rp2 GGAGTGGTGAATCCGTTAG Eurofins Genomics pbr322-fp3 CTCGTCGTTTGGTATGGC Eurofins Genomics pbr322-rp3 CGGTATTATCCCGTGTTGA Eurofins Genomics CaMV 35S-F CaMV 35S-R AGGAAGGTGGCTCCTACAAAT GC GAAGGGTCTTGCGAAGGATAG TG Sangon Biotech (Shanghai) Co., Ltd. Sangon Biotech (Shanghai) Co., Ltd. GTS-FP TGGTTGCGGCCCTGCTTGTT Sangon Biotech (Shanghai) Co., Ltd. GTS-RP GCTCATGGCGATGCGGTGAT Sangon Biotech (Shanghai) Co., Ltd. S-2
3 Figure S1. TEM micrographs of MoS2, WS2 and GO used in this work. S-3
4 Figure S2. Visual detection of the progress of PCR amplification at every 5 cycles with 1 SG (~ 2 µm) as an indicator (A) in the absence of GO; and (B) after adding 12 μg/ml GO to reduce the background fluorescence. Note that GO was added after the PCR reactions. (C) The fluorescent ratio of the positive controls (PTC) to the negative controls (NTC) at every five cycles. All of the reactions were performed with 200 nm pbr322-fp2 and 200 nm pbr322-rp2 primers. S-4
5 Figure S3. (A) Photographs showing the fluorescence emission of PCR products without and with 20 μg/ml GO in the presence of different DNA staining dyes. N: negative control; P: positive control. (B) Fluorescent values of PTC and NTC by using different dyes without GO and with 20 μg/ml GO. (C) The fluorescent ratio of PTC to NTC by using different dyes without GO and with 20 μg/ml GO. All of the reactions were performed for 35 cycles with 200 nm pbr322-fp2 and 200 nm pbr322-rp2 as primers. Note here we used 20 µg/ml of GO, while in Figure S2, only 12 µg/ml GO was used, which yielded a lower ratio of 18. S-5
6 Figure S4. The effect of BSA alone on PCR in the presence of 0.1 U Hot Start Taq polymerase (4-fold of the normal PCR condition). 76 pm pbr 322 plasmid DNA was amplified for 45 cycles with 200 nm pbr322-fp2 and 200 nm pbr322-rp2 as primers on a MyiQ2 PCR cycler (Bio-Rad). PCR condition: denaturing at 94 C for 20 s, annealing at 55 C for 30 s and extension at 72 C for 1 min. Lane M: 50 bp DNA ladder. BSA protein can also increase PCR specificity due to excess of polymerase. S-6
7 Figure S5. Quantification of intensity of the target band and the non-specific band by adding different MoS2 concentration in Figure 6D U Taq polymerase (10-fold of the normal PCR condition) and 0.88 pm pbr 322 plasmid DNA were used for amplification for 35 cycles. All of the reactions were performed for 35 cycles with 200 nm pbr322-fp2 and 200 nm pbr322-rp2 primers. S-7
8 Figure S6. Using MoS2 to enhance the specificity of PCR by adding (A) 0.1 U Hot Start Taq polymerase (4-fold of the normal PCR condition) and (B) 0.15 U Hot Start Taq polymerase (6-fold of the normal PCR condition). 76 pm pbr 322 plasmid DNA was amplified for 45 cycles on a MyiQ2 PCR cycler (Bio-Rad) with denaturing at 94 C for 20 s, annealing at 55 C for 30 s and extension at 72 C for 1 min with 200 nm pbr322-fp2 and 200 nm pbr322-rp2 primers. Lane M: 50 bp DNA ladder. S-8
9 Figure S7. Using MoS2 to enhance the specificity of amplification of the genomic DNA from 1% GTS contaminated soya powder. The 50 μl reaction system contained 400 nm GTS-FP, 400 nm GTS-RP, and 25 μl FastStart Essential DNA Green Master (Roche Diagnostics) reaction mix. The amplification was performed on a QuantStudio TM 3 Real-Time PCR System (Applied Biosystems): a single cycle at 95 C for 10 min and followed by 40 cycles at 95 C for 15 s, 55 C for 20 s and 72 C for 20s. Lane M: 50 bp DNA ladder. MoS2 also improved the specificity of PCR in this system with a different DNA template. S-9
10 Ct Diluted Fold (Lg) Figure S8. The threshold cycle (Ct) of real-time PCR using 10 serial diluted DNA from transgenic soya powder GTS as template. -3 to 0 in the x-axis means 10 3 to fold dilution (log scale). The CaMV 35S gene was amplified for 35 cycles. S-10
E-Supporting Information-1 (ESI-1) Ionic liquids promote PCR amplification of DNA
E-Supporting Information-1 (ESI-1) Ionic liquids promote PCR amplification of DNA Yugang Shi, ab Yen-Liang Liu, a Peng-Yeh Lai, c Ming-Chung Tseng, a Min-Jen Tseng, c Yudong Li, b and Yen-Ho Chu* a a Department
More informationPRODUCT INFORMATION Thermo Scientific Luminaris Probe Low ROX qpcr Master Mix #K0944 For 5000 rxns Lot Expiry Date Store at -20 C in the dark CERTIFICATE OF ANALYSIS The absence of endo-, exodeoxyribonucleases
More information2X Q-PCR Master Mix 1 ml x 2 (SYBR, ROX) Storage Aliquot to avoid multiple freeze-thaw cycles Protect from light -20 C for 12 months
www.smobio.com Product Information ExcelTaq series 2X Q-PCR Master Mix (SYBR, ROX) TQ1110 200 RXN 2X Q-PCR Master Mix 1 ml x 2 (SYBR, ROX) Storage Aliquot to avoid multiple freeze-thaw cycles Protect from
More informationQPCR-S100 (100 rxns) Store -20. Functional analysis RealHelix qpcr Kit was evaluated by real-time PCR using the 10-fold serial-diluted human
RealHelix TM qpcr Kit [Intercalator type] CERTIFICATE OF ANALYSIS (1603-V01R03) Kit contents RealHelix TM qpcr Kit [Intercalator type] Cat. No. QPCR-S100 (100 rxns) QPCR-S500 (500 rxns) 2x qpcr PreMix
More information#K0262 For 1000 reactions of 25 µl Lot Exp.. Store at -20 C in the dark. V
PRODUCT INFORMATION Thermo Scientific Maxima Probe qpcr Master Mix (2X), ROX Solution provided #K0262 For 1000 reactions of 25 µl Lot Exp.. Store at -20 C in the dark. V CERTIFICATE OF ANALYSIS The absence
More informationCat. # RR391A. For Research Use. Probe qpcr Mix. Product Manual. v201610da
Cat. # RR391A For Research Use Probe qpcr Mix Product Manual Table of Contents I. Introduction... 3 II. Principle... 3 III. Components... 5 IV. Materials Required but not Provided... 5 V. Storage... 5
More informationRelative Mouse Telomere Length Quantification qpcr Assay Kit (RMTLQ) Catalog #M reactions
Relative Mouse Telomere Length Quantification qpcr Assay Kit (RMTLQ) Catalog #M8908 100 reactions Product Description Telomeres are repetitive nucleotide elements at the ends of chromosomes that protect
More informationTB Green Premix Ex Taq (Tli RNaseH Plus)
Cat. # RR420A For Research Use TB Green Premix Ex Taq (Tli RNaseH Plus) Product Manual The long-term storage temperature of this product has been changed to -20 since Lot. #AK8101. See section V. Storage.
More informationTHUNDERBIRD SYBR qpcr Mix
Instruction manual THUNDERBIRD SYBR qpcr Mix 1304 A4251K THUNDERBIRD SYBR qpcr Mix QPS-201T 1 ml x 1 QPS-201 1.67 ml x 3 Contents [1] Introduction [2] Components [3] Primer design [4] Template DNA [5]
More informationTB Green Premix Ex Taq II (Tli RNaseH Plus)
Cat. # RR820A For Research Use TB Green Premix Ex Taq II (Tli RNaseH Plus) Product Manual The long-term storage temperature of this product has been changed to -20 since Lot. #AGY1013N. See section IV.
More informationSYBR Premix Ex Taq II (Tli RNaseH Plus), Bulk
Cat. # RR820L For Research Use SYBR Premix Ex Taq II (Tli RNaseH Plus), Bulk Product Manual The long-term storage temperature of this product has been changed to -20 since Lot. AK9104. See section IV.
More informationCat. # RR430S RR430A. For Research Use. SYBR Fast qpcr Mix. Product Manual. v201610da
For Research Use SYBR Fast qpcr Mix Product Manual Table of Contents I. Description... 3 II. Principle... 4 III. Components... 5 IV. Storage... 5 V. Features... 6 VI. Precautions... 6 VII. Protocol...
More informationRelative Rat Telomere Length Quantification qpcr Assay Kit (RRTLQ) Catalog #R reactions
Relative Rat Telomere Length Quantification qpcr Assay Kit (RRTLQ) Catalog #R8908 100 reactions Product Description Telomeres are repetitive nucleotide elements at the ends of chromosomes that protect
More informationTechnical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
More informationTQ RXN 2X Q-PCR Master Mix (SYBR, no ROX) 1 ml x 2 TQ RXN 2X Q-PCR Master Mix (SYBR, no ROX) 1 ml x 5
www.smobio.com Product Information ExcelTaq series 2X Q-PCR Master Mix (SYBR, no ROX) TQ1100 200 RXN 2X Q-PCR Master Mix (SYBR, no ROX) 1 ml x 2 TQ1101 500 RXN 2X Q-PCR Master Mix (SYBR, no ROX) 1 ml x
More informationRealHelix TM qrt-pcr Kit [Intercalator type]
RealHelix TM qrt-pcr Kit [Intercalator type] CERTIFICATE OF ANALYSIS (1603-V01R03) Kit contents RealHelix TM qrt-pcr Kit [Intercalator type] Cat. No. QRT-S100 (100 rxns) QRT-S500 (500 rxns) qrt-pcr Enzyme
More informationGuidelines for Developing Robust and Reliable PCR Assays
Guidelines for Developing Robust and Reliable PCR Assays Leta Steffen, PhD Applications Scientist Promega Corporation Outline 1) PCR reaction components What is in the reaction? How does it affect assay
More informationQUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 2007)
QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 007) Please contact Center for Plant Genomics (CPG) facility manager Hailing Jin (hljin@iastate.edu) regarding questions or corrections.
More informationSupplemental Materials. DNA preparation. Dehalogenimonas lykanthroporepellens strain BL-DC-9 T (=ATCC
Supplemental Materials DNA preparation. Dehalogenimonas lykanthroporepellens strain BL-DC-9 T (=ATCC BAA-1523 = JCM 15061) was grown in defined basal medium amended with 0.5 mm 1,1,2- trichloroethane (1,1,2-TCA)
More informationAbsolute Mouse Telomere Length Quantification qpcr Assay Kit (AMTLQ) Catalog #M reactions
Absolute Mouse Telomere Length Quantification qpcr Assay Kit (AMTLQ) Catalog #M8918 100 reactions Product Description Telomeres are repetitive nucleotide elements at the ends of chromosomes that protect
More informationAbsolute Human Telomere Length Quantification qpcr Assay Kit (AHTLQ) Catalog # reactions
Absolute Human Telomere Length Quantification qpcr Assay Kit (AHTLQ) Catalog #8918 100 reactions Product Description Telomeres are repetitive nucleotide elements at the ends of chromosomes that protect
More informationPlatinum II Taq Hot-Start DNA Polymerase for high-throughput PCR
WHITE PAPER Platinum II Taq Hot-Start DNA Polymerase Platinum II Taq Hot-Start DNA Polymerase for high-throughput PCR Abstract The advances in thermal cycler technology permit a substantial increase in
More informationPremix Ex Taq (Probe qpcr)
For Research Use Premix Ex Taq (Probe qpcr) Product Manual Table of Contents I. Description... 3 II. Principle... 4 III. Components... 5 IV. Materials Required but not Provided... 5 V. Storage... 5 VI.
More informationOn-point Detection of GM Rice in 20 Minutes with Pullulan as CPA
Electronic Supplementary Material (ESI) for Analytical Methods. This journal is The Royal Society of Chemistry 2014 Electronic Supplementary Information for On-point Detection of GM Rice in 20 Minutes
More informationPhosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for resuspending the SingleShot RNA control template
Catalog # Description 172-5090 SingleShot Probes Kit, 100 x 50 µl reactions For research purposes only. Introduction The SingleShot Probes Kit prepares genomic DNA (gdna) free RNA directly from cell culture
More informationSYBR Premix DimerEraser (Perfect Real Time)
Cat. # RR091A or Research Use SYBR Premix DimerEraser (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Principle... 3 III. Components... 4 IV. Storage... 5 V. eatures... 5 VI.
More information3color RT HS-PCR Mix SYBR Ready-to-use mix for real-time Hot Start PCR with SYBR Green. Dedicated for white reaction tubes and plates.
3color RT HS-PCR Mix SYBR Ready-to-use mix for real-time Hot Start PCR with SYBR Green. Dedicated for white reaction tubes and plates. version 0217 250 reactions in 20 μl Cat. # 2000-250S 2500 reactions
More informationElectronic Supplementary Information. Target-induced Intermolecular Hybridization
Electronic Supplementary Information The Real-time PCR for Sensitive Protein Detection by Target-induced Intermolecular Hybridization Cuiping Ma a, Lijie Cao a, Chao Shi a *and Naihao Ye b * a State Key
More information2x PCR LongNova-RED PCR Master Mix
2x PCR LongNova-RED Components RP85L 100 reactions (50 μl) RP85L-10 1000 reactions (50 μl) 2x PCR LongNova-RED 2 x 1.25 ml 20 x 1.25 ml PCR grade water 2 x 1.5 ml 20 x 1.5 ml Storage & Shiing Storage conditions
More informationPRODUCT INFORMATION Thermo Scientific Luminaris Color Probe qpcr Master Mix #K0354 For 5000 rxns Lot Exp. Store at -20 C in the dark CERTIFICATE OF ANALYSIS The absence of endo-, exodeoxyribonucleases
More informationSYBR Premix Ex Taq II (Tli RNaseH Plus), ROX plus
Cat. # RR82LR For Research Use SYBR Premix Ex Taq II (Tli RNaseH Plus), ROX plus Product Manual The long-term storage temperature of this product has been changed to -20 since Lot. A1901A. See section
More informationSYBR Advantage qpcr Premix. User Manual
User Manual SYBR Advantage qpcr Premix User Manual United States/Canada 800.66.566 Asia Pacific +.650.99.7300 Europe +33.(0).3904.6880 Japan +8.(0)77.543.66 Clontech Laboratories, Inc. A Takara Bio Company
More informationHuman TNF qpcr primer pair
Shipping and Storage information Catalog No. Amount Reaction number of 25-μl volume Shipping and Storage Package tube 2 nmol 200 lyophilized powder 1 Information of the target gene and primers Species
More informationSupporting Information Innate Reverse Transcriptase Activity of DNA Polymerase for Isothermal RNA Direct Detection
Supporting Information Innate Reverse Transcriptase Activity of DNA Polymerase for Isothermal RNA Direct Detection Chao Shi, Xiaotong Shen, Shuyan Niu and Cuiping Ma *, Key Laboratory of Sensor Analysis
More informationPhosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for resuspending the SingleShot RNA control template
Catalog # Description 172-5085 SingleShot SYBR Green Kit, 100 x 50 µl reactions For research purposes only. Introduction The SingleShot SYBR Green Kit prepares genomic DNA (gdna) free RNA directly from
More informationQuantitative Real time PCR. Only for teaching purposes - not for reproduction or sale
Quantitative Real time PCR PCR reaction conventional versus real time PCR real time PCR principles threshold cycle C T efficiency relative quantification reference genes primers detection chemistry GLP
More informationSuperReal PreMix Plus (SYBR Green)
SuperReal PreMix Plus (SYBR Green) For fast, quantitative, real-time PCR using SYBR Green www.tiangen.com/en QP120627 SuperReal PreMix Plus (SYBR Green) Cat. no. FP205 Kit Contents Contents 2 SuperReal
More informationSYBR Real-Time PCR Kit
SYBR Real-Time PCR Kit For Amplification and detection of DNA in Quantitative real-time PCR (qpcr). Catalog No. QPG-040/QPG-041/QPG-042/QPG-043 User Manual Table of Contents Kit Contents and Storage...
More informationFactors affecting PCR
Lec. 11 Dr. Ahmed K. Ali Factors affecting PCR The sequences of the primers are critical to the success of the experiment, as are the precise temperatures used in the heating and cooling stages of the
More informationElectronic Supplementary Information
Electronic Supplementary Information Ultrasensitive quantification of mature micrornas by real-time PCR based on ligation of ribonucleotide-modified DNA probe Jiangyan Zhang, Zhengping Li,* Hui Wang, Yucong
More informationPRODUCT INFORMATION Thermo Scientific Luminaris Color HiGreen Low ROX qpcr Master Mix #K0373 For 1250 rxns Lot Exp. Store at -20 C in the dark CERTIFICATE OF ANALYSIS The absence of endo-, exodeoxyribonucleases
More informationGreenMasterMix (2X) b i o s c i e n c e. G E N A X X O N b i o s c i e n c e. High ROX (500nM)
G:\products\productflyer\pcr\polymerasen\hotstart\manu_m3052_green_en.docx GreenMasterMix (2) High RO (500nM) qpcr master mix with fluorescence dye and passive reference dye Contact & Technical support
More informationBrilliant III Ultra-Fast SYBR Green QPCR Master Mix
Brilliant III Ultra-Fast SYBR Green QPCR Master Mix Instruction Manual Catalog #600882 (single kit) #600883 (10-pack kit) Revision D0 Research Use Only. Not for Use in Diagnostic Procedures. 600882-12
More informationExtraction of DNA staining dyes from DNA using hydrophobic ionic liquids
Electronic Supplementary Information Extraction of DNA staining dyes from DNA using hydrophobic ionic liquids Imran Khimji, Krystina Doan, Kiara Bruggeman, Po-Jung Jimmy Huang, Puja Vajha, and Juewen Liu*
More informationFastFire qpcr PreMix (Probe)
FastFire qpcr PreMix (Probe) For fast, quantitative, specific real-time PCR using sequence-specific probe www.tiangen.com/en FP130820 Kit Contents FastFire qpcr PreMix (Probe) Contents 2 FastFire qpcr
More informationTable of contents. I. Description...2. II. Principle...2. III. Kit Components...3. IV. Storage...3. V. Features...4. VI. Precautions for Operation...
Table of contents I. Description...2 II. Principle...2 III. Kit Components...3 IV. Storage...3 V. Features...4 VI. Precautions for Operation...4 VII. Protocol...4 VIII.Experiment Example...6 IX. Appendix...8
More information2 march 06 Seminar on RT-PCR. About Real-time PCR. Aurélie OLIVIER Université Catholique de Louvain Unité de pharmacologie cellulaire et moléculaire
2 march 06 Seminar on RT-PCR About Real-time PCR Aurélie OLIVIER Université Catholique de Louvain Unité de pharmacologie cellulaire et moléculaire Target DNA PCR Applications: Gene Plasmide, phage Diagnostic
More informationAttostar T4 Bacteriophage As a DNA extraction and PCR control
Attostar T4 Bacteriophage As a DNA extraction and PCR control Overview:... 2 Products Catalog No. Quantity... 2 AttoMaster 2X Mix for qpcr AM10 1.25 ml... 2 T4 bacteriophage DNase resistant BAC130 0.5
More informationAbsolute Human Telomere Length and Mitochondrial DNA Copy Number Dual Quantification qpcr Assay Kit (AHDQ) Catalog # reactions
Absolute Human Telomere Length and Mitochondrial DNA Copy Number Dual Quantification qpcr Assay Kit (AHDQ) Catalog #8958 100 reactions Product Description Telomeres are repetitive nucleotide elements at
More informationRoche Molecular Biochemicals Technical Note No. LC 9/2000
Roche Molecular Biochemicals Technical Note No. LC 9/2000 LightCycler Optimization Strategy Introduction Purpose of this Note Table of Contents The LightCycler system provides different detection formats
More informationGENOTYPING BY PCR PROTOCOL FORM MUTANT MOUSE REGIONAL RESOURCE CENTER North America, International
Please provide the following information required for genetic analysis of your mutant mice. Please fill in form electronically by tabbing through the text fields. The first 2 pages are protected with gray
More informationCSS451 Spring 2010 Polymerase Chain Reaction Laboratory
CSS451 Spring 2010 Polymerase Chain Reaction Laboratory The purpose of the polymerase chain reaction (PCR) is to amplify specific segments of DNA. If one knows the DNA sequence of regions of DNA that flank
More informationSYBR Green Realtime PCR Master Mix
Instruction manual SYBR Green Realtime PCR Master Mix 0810 F0924K SYBR Green Realtime PCR Master Mix QPK-201T 1 ml x 1 QPK-201 1 ml x 5 Contents [1] Introduction [2] Components [3] Primer design [4] Detection
More informationOne Step SYBR PrimeScript RT-PCR Kit II (Perfect Real Time)
Cat. # RR086A For Research Use One Step SYBR PrimeScript RT-PCR Kit II Product Manual Table of Contents I. Description...3 II. III. IV. Principle...3 Components...5 Storage...6 V. Features...6 VI. VII.
More informationSUPPORTING INFORMATION. A cleavage-responsive stem-loop hairpin for assaying guide RNA activity
SUPPORTING INFORMATION A cleavage-responsive stem-loop hairpin for assaying guide RNA activity Tara R. deboer 1, Noreen Wauford 1, Jing-Yi Chung, Miguel Salvador Torres Perez, and Niren Murthy* University
More informationGeneQuery Human SMUG1-SMUG1P1 Pseudogene Transcription Analysis qpcr Kit (GQP-SMUG1P1) Catalog #GK811
GeneQuery Human SMUG1-SMUG1P1 Pseudogene Transcription Analysis qpcr Kit (GQP-SMUG1P1) Catalog #GK811 Product Description Pseudogenes are DNA segments introduced into the genome by gene duplication or
More informationTroubleshooting of Real Time PCR Ameer Effat M. Elfarash
Troubleshooting of Real Time PCR Ameer Effat M. Elfarash Dept. of Genetics Fac. of Agriculture, Assiut Univ. aelfarash@aun.edu.eg What is Real-Time PCR used for? Gene expression analysis Disease diagnosis
More informationElectronic Supplementary Information
Electronic Supplementary Information One-step ultrasensitive detection of microrns with loop-mediated isothermal amplification (LMP) Cuiping Li, a Zhengping Li,* a Hongxia Jia a and Jingli Yan a a Key
More informationApplication Note Detecting low copy numbers. Introduction. Methods A08-005B
Application Note Detecting low copy numbers A08-005B Introduction Sensitivity of a qpcr assay is highly dependent on primer efficiency. Not all assays will be capable of detecting a single copy of template
More informationTECHNICAL BULLETIN. SYBR Green JumpStart Taq ReadyMix without MgCl 2. Catalog Number S5193 Storage Temperature 20 C
SYBR Green JumpStart Taq ReadyMix without MgCl 2 Catalog Number S5193 Storage Temperature 20 C TECHNICAL BULLETIN Product Description SYBR Green JumpStart Taq ReadyMix without MgCl 2 combines JumpStart
More informationChlamydia trachomatis PCR reagents Detection with real time PCR reagents
Chlamydia trachomatis PCR reagents Detection with real time PCR reagents Overview:... 1 Products... 2 C.trachomatis FAM-BHQ1 Primer-probe PP1300 0.055ml... 2 AttoMaster 2X Mix for qpcr AM10 1.25 ml...
More informationFunctional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update
Functional Genomics Research Stream Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Updates Alternate Lab Meeting Fridays 11:30-1:00 WEL 4.224 Welcome to attend either one Lab Log thanks
More informationPQL-S200 (200 rxns) Store -20. using the 10-fold serial-diluted human genomic DNA and a set of human gene-specific primer
CERTIFICATE OF ANALYSIS (1603-V01R02) RealHelix TM Premier q Kit [SYBR Green with low ROX] Kit contents RealHelix TM Premier q Kit [SYBR Green with low ROX] Cat. No. PQL-S200 (200 rxns) PQL-S500 (500 rxns)
More informationOnly for teaching purposes - not for reproduction or sale
PCR reaction conventional versus real time PCR real time PCR principles threshold cycle C T efficiency relative quantification reference genes primers detection chemistry GLP in real time PCR Relative
More informationE.Z.N.A. Plant Direct PCR Kit
E.Z.N.A. Plant Direct PCR Kit TQ2800-00 TQ2800-01 20 preps 100 preps June 2013 E.Z.N.A. Plant Direct PCR Kit Table of Contents Introduction and Overview...2 Kit Contents/Storage and Stability...3 Plant
More informationTable of Contents. I. Description...2. Components...2. Storage...2. Features...2. V. General Composition of PCR Reaction Mixture...
Table of Contents I. Description...2 II. Components...2 III. Storage...2 IV. Features...2 V. General Composition of PCR Reaction Mixture...5 VI. PCR Conditions...5 VII. Optimization of Parameters...6 VIII.
More informationSYBR Green Realtime PCR Master Mix -Plus-
Instruction manual SYBR Green Realtime PCR Master Mix -Plus- 0803 F0925K SYBR Green Realtime PCR Master Mix -Plus- Contents QPK-212 1mLx5 Store at -20 C, protected from light [1] Introduction [2] Components
More informationKAPA PROBE FAST qpcr Master Mix (2X) Kit
KR0397_S v1.17 Product Description s are designed for fast-cycling, real-time PCR (qpcr) using sequence-specific fluorogenic probes. These kits are compatible with all fluorogenic probe-based technologies,
More informationHELINI Hepatitis B virus [HBV] Real-time PCR Kit (Genotype A to H)
HELINI Hepatitis B virus [HBV] Real-time PCR Kit (Genotype A to H) Quantitative In vitro diagnostics Instruction manual Cat. No: 8001-25/50/100 tests Compatible with: Agilent, Bio-Rad, Applied Bio systems
More informationUser Manual. Catalog No.: DWSK-V101 (10 rxns), DWSK-V102 (25 rxns) For Research Use Only
DNA Walking SpeedUp TM Kit SpeedUp Sequencing SpeedUp BAC Clone Sequencing SpeedUp Genome Walking SpeedUp Transgene Location Detection SpeedUp Deletion/ Insertion/ Isoform Detection User Manual Version
More informationPowerPlex. Y System Validation
PowerPlex Y System Validation By Patricia M. Fulmer, Dawn Rabbach, Kimberly Huston, Curtis Knox and Cynthia Sprecher, Promega Corporation Abstract We have improved the manufacturing process for the PowerPlex
More informationThermal cycler amplification robustness: a comparison of several models
APPLICATION NOTE Thermal cyclers Thermal cycler amplification robustness: a comparison of several models Introduction The ability of a thermal cycler to amplify difficult targets is a critical factor for
More informationPlantDirect TM Multiplex PCR System
PlantDirect TM Multiplex PCR System Technical Manual No. 0178 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 3 IV Shipping and Storage. 3 V Simplified Procedures. 3 VI Detailed
More informationHELINI White spot Syndrome virus [WSSV] Real-time PCR Kit
HELINI White spot Syndrome virus [WSSV] Real-time PCR Kit Instruction manual Cat. No: 6001-25/50/100 tests Compatible with: Agilent, Bio-Rad, Roche, Applied Bio systems [ABI], Rotor-gene, Cepheid, Bioer,
More informationSYBR Advantage qpcr Premix User Manual
SYBR Advantage qpcr Premix User Manual Cat. No. 639676 PT3883- (PR65850) Published 3 May 006 Table of Contents I. I ntroduction 4 II. List of Components 6 III. Additional Materials Required 6 IV. General
More informationPerfect Master Mix PROBE Kits (with ROX) User Guide
Perfect Master Mix PROBE Kits (with ROX) User Guide For AnyGenes products: Cat # 50 Cat # 100 Cat # 200 Cat # 500 For research use only Store at -20 C & keep away from light 2017 Summary I. Product information...
More informationSYBR Premix Ex Taq II (Tli RNaseH Plus), Bulk
Cat. # RR820L For Research Use SYBR Premix Ex Taq II (Tli RNaseH Plus), Bulk Product Manual Table of Contents I. Description... 3 II. Principle... 3 III. Kit Components... 4 IV. Materials Required but
More informationBauer Core Standard Protocol Title: Guidelines for Designing Real Time PCR Experiments Pages: 5 Revision: 1.1 Date: 4/15/04
Bauer Core Standard Protocol Title: Guidelines for Designing Real Time PCR Experiments Pages: 5 Revision: 1.1 Date: 4/15/04 Author(s): Claire Reardon Reviewers: Christian Daly Contact: claire@cgr.harvard.edu
More informationSupporting Information. Counting DNA Molecules with Visual Segments-based Readouts in Minutes
Electronic Supplementary Material (ESI) for Chemical Communications. This journal is The Royal Society of Chemistry 2018 Supporting Information Counting DNA Molecules with Visual Segments-based Readouts
More informationApplied Biosystems Real-Time PCR Rapid Assay Development Guidelines
Applied Biosystems Real-Time PCR Rapid Assay Development Guidelines Description This tutorial will discuss recommended guidelines for designing and running real-time PCR quantification and SNP Genotyping
More informationA Supersandwich Fluorescence in Situ Hybridization (SFISH) Strategy. for Highly Sensitive and Selective mrna Imaging in Tumor Cells
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Electronic Supplementary Information (ESI) A Supersandwich Fluorescence in Situ Hybridization (SFISH)
More informationThermo Scientific Extensor Long Range PCR Enzyme Mix
Thermo Scientific Etensor Long Range PCR Enzyme Mi Description: Kit Contents: The Etensor Long Range PCR Enzyme Mi is a blend of ThermoPrime Taq DNA Polymerase and a proprietary proofreading enzyme. The
More informationApplication Notes
Application Notes Superior Performance and Flexibility In order to minimize errors in DNA replication during PCR, it is essential to choose a high-fidelity DNA polymerase enzyme. The introduction of errors
More informationSYBR Premix Ex Taq (Tli RNaseH Plus), Bulk
Cat. # RR420L For Research Use SYBR Premix Ex Taq (Tli RNaseH Plus), Bulk Product Manual Table of Contents I. Description... 3 II. Principle... 3 III. Kit Components... 4 IV. Materials Required but not
More informationMightyAmp Genotyping Kit
For Research Use MightyAmp Genotyping Kit Product Manual Table of Contents I. Description... 3 II. Kit Components... 3 III. Storage... 3 IV. Primer Design... 3 V. Protocol... 4 VI. 3'-A Overhang of PCR
More informationQuantitative Real time PCR. Only for teaching purposes - not for reproduction or sale
Quantitative Real time PCR PCR reaction conventional versus real time PCR real time PCR principles threshold cycle C T efficiency relative quantification reference genes primers detection chemistry GLP
More informationSpeedSTAR HS DNA Polymerase
Cat. # RR070A For Research Use SpeedSTAR HS DNA Polymerase Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. Supplied buffers... 3 V. General reaction mixture...
More informationSYBR Premix Ex Taq (Tli RNaseH Plus)
Cat. # RR420A For Research Use SYBR Premix Ex Taq (Tli RNaseH Plus) Product Manual Table of Contents I. Description... 3 II. Principle... 3 III. Kit Components... 4 IV. Materials Required but not Provided...
More informationCat. # R100A. For Research Use. EpiScope MSP Kit. Product Manual. v201712da_2
Cat. # R100A For Research Use EpiScope MSP Kit Product Manual Table of Contents I. Description... 3 II. MSP Principle... 3 III. Components... 4 IV. Storage... 4 V. Materials Required but not Provided...
More informationAsk the Experts: Ensuring a Successful PCR Every Time
Ask the Experts: Ensuring a Successful PCR Every Time Welcome Things to know before we get started Housekeeping Application Widgets Movable and resizable Any issues with console Press F5 to refresh your
More informationTechne qpcr test. Pisum sativum. Ribosomal protein S12 (rps12) gene. 100 tests
Techne qpcr test Pisum sativum Ribosomal protein S12 (rps12) gene 100 tests For general laboratory and research use only Introduction to Pisum sativum 1 2 Specificity The Techne Kit for Pisum sativum (P.sativum)
More informationUser Manual. NGS Library qpcr Quantification Kit (Illumina compatible)
NGS Library qpcr Quantification Kit (Illumina compatible) User Manual 384 Oyster Point Blvd, Suite 15 South San Francisco, CA 94080 Phone: 1 (888) MCLAB-88 Fax: 1 (650) 872-0253 www.mclab.com Contents
More informationElectronic Supporting Information
Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2017 Electronic Supporting Information Highly Sensitive and Multiplexed Quantification of mrna
More informationModule1TheBasicsofRealTimePCR Monday, March 19, 2007
Objectives Slide notes: Page 1 of 41 Module 1: The Basics Of Real Time PCR Slide notes: Module 1: The Basics of real time PCR Page 2 of 41 Polymerase Chain Reaction Slide notes: Here is a review of PCR,
More informationRTS Wheat Germ LinTempGenSet, His 6 -tag Manual
RTS Wheat Germ LinTempGenSet, His 6 -tag Manual For rapid production of linear expression templates using PCR RTS Wheat Germ LinTempGenSet, His6-tag, April, 2015 2015 biotechrabbit, all rights reserved.
More informationExecutive Summary. clinical supply services
clinical supply services case study Development and NDA-level validation of quantitative polymerase chain reaction (qpcr) procedure for detection and quantification of residual E.coli genomic DNA Executive
More informationInstructions for Use Life Science Kits & Assays
Instructions for Use Life Science Kits & Assays Content Content 1 Product and order number...i 2 Storage conditions...i 3 Description...... II 3.1 Quality data... II 3.2 Instruments... II 4 Delivered components...
More informationQuantitation of mrna Using Real-Time Reverse Transcription PCR (RT-PCR)
Quantitation of mrna Using Real-Time Reverse Transcription PCR (RT-PCR) Quantitative Real-Time RT-PCR Versus RT-PCR In Real-Time RT- PCR, DNA amplification monitored at each cycle but RT-PCR measures the
More information