Supporting Information

Size: px

Start display at page:

Download "Supporting Information"

Alvin Fields
5 years ago
Views:

1 Supporting Information Transition Metal Dichalcogenide Nanosheets for Visual Monitoring PCR Rivaling a Real-Time PCR Instrument Liu Wang 1,2, Zhicheng Huang 2, Rui Wang 1, Yibo Liu 2, Cheng Qian 1, Jian Wu 1 *, Juewen Liu 2 * 1 College of Biosystems Engineering and Food Science, Zhejiang University, Hangzhou , China wujian69@zju.edu.cn 2 Department of Chemistry, Waterloo Institute for Nanotechnology, University of Waterloo, Waterloo N2L 3G1, Ontario, Canada liujw@uwaterloo.ca S-1

2 Table S1. DNA primers used in this work. DNA name Sequence (5 3 ) Supplier pbr322-fp2 TGTCCAGGCAGGTAGATGA Eurofins Genomics pbr322-rp2 GGAGTGGTGAATCCGTTAG Eurofins Genomics pbr322-fp3 CTCGTCGTTTGGTATGGC Eurofins Genomics pbr322-rp3 CGGTATTATCCCGTGTTGA Eurofins Genomics CaMV 35S-F CaMV 35S-R AGGAAGGTGGCTCCTACAAAT GC GAAGGGTCTTGCGAAGGATAG TG Sangon Biotech (Shanghai) Co., Ltd. Sangon Biotech (Shanghai) Co., Ltd. GTS-FP TGGTTGCGGCCCTGCTTGTT Sangon Biotech (Shanghai) Co., Ltd. GTS-RP GCTCATGGCGATGCGGTGAT Sangon Biotech (Shanghai) Co., Ltd. S-2

3 Figure S1. TEM micrographs of MoS2, WS2 and GO used in this work. S-3

4 Figure S2. Visual detection of the progress of PCR amplification at every 5 cycles with 1 SG (~ 2 µm) as an indicator (A) in the absence of GO; and (B) after adding 12 μg/ml GO to reduce the background fluorescence. Note that GO was added after the PCR reactions. (C) The fluorescent ratio of the positive controls (PTC) to the negative controls (NTC) at every five cycles. All of the reactions were performed with 200 nm pbr322-fp2 and 200 nm pbr322-rp2 primers. S-4

Figure S3. (A) Photographs showing the fluorescence emission of PCR products without and with 20 μg/ml GO in the presence of different DNA staining dyes. N: negative control; P: positive control.

5 Figure S3. (A) Photographs showing the fluorescence emission of PCR products without and with 20 μg/ml GO in the presence of different DNA staining dyes. N: negative control; P: positive control. (B) Fluorescent values of PTC and NTC by using different dyes without GO and with 20 μg/ml GO. (C) The fluorescent ratio of PTC to NTC by using different dyes without GO and with 20 μg/ml GO. All of the reactions were performed for 35 cycles with 200 nm pbr322-fp2 and 200 nm pbr322-rp2 as primers. Note here we used 20 µg/ml of GO, while in Figure S2, only 12 µg/ml GO was used, which yielded a lower ratio of 18. S-5

6 Figure S4. The effect of BSA alone on PCR in the presence of 0.1 U Hot Start Taq polymerase (4-fold of the normal PCR condition). 76 pm pbr 322 plasmid DNA was amplified for 45 cycles with 200 nm pbr322-fp2 and 200 nm pbr322-rp2 as primers on a MyiQ2 PCR cycler (Bio-Rad). PCR condition: denaturing at 94 C for 20 s, annealing at 55 C for 30 s and extension at 72 C for 1 min. Lane M: 50 bp DNA ladder. BSA protein can also increase PCR specificity due to excess of polymerase. S-6

Figure S5. Quantification of intensity of the target band and the non-specific band by adding different MoS2 concentration in Figure 6D. 0.

7 Figure S5. Quantification of intensity of the target band and the non-specific band by adding different MoS2 concentration in Figure 6D U Taq polymerase (10-fold of the normal PCR condition) and 0.88 pm pbr 322 plasmid DNA were used for amplification for 35 cycles. All of the reactions were performed for 35 cycles with 200 nm pbr322-fp2 and 200 nm pbr322-rp2 primers. S-7

8 Figure S6. Using MoS2 to enhance the specificity of PCR by adding (A) 0.1 U Hot Start Taq polymerase (4-fold of the normal PCR condition) and (B) 0.15 U Hot Start Taq polymerase (6-fold of the normal PCR condition). 76 pm pbr 322 plasmid DNA was amplified for 45 cycles on a MyiQ2 PCR cycler (Bio-Rad) with denaturing at 94 C for 20 s, annealing at 55 C for 30 s and extension at 72 C for 1 min with 200 nm pbr322-fp2 and 200 nm pbr322-rp2 primers. Lane M: 50 bp DNA ladder. S-8

Figure S7. Using MoS2 to enhance the specificity of amplification of the genomic DNA from 1% GTS 40-3-2 contaminated soya powder.

9 Figure S7. Using MoS2 to enhance the specificity of amplification of the genomic DNA from 1% GTS contaminated soya powder. The 50 μl reaction system contained 400 nm GTS-FP, 400 nm GTS-RP, and 25 μl FastStart Essential DNA Green Master (Roche Diagnostics) reaction mix. The amplification was performed on a QuantStudio TM 3 Real-Time PCR System (Applied Biosystems): a single cycle at 95 C for 10 min and followed by 40 cycles at 95 C for 15 s, 55 C for 20 s and 72 C for 20s. Lane M: 50 bp DNA ladder. MoS2 also improved the specificity of PCR in this system with a different DNA template. S-9

10 Ct Diluted Fold (Lg) Figure S8. The threshold cycle (Ct) of real-time PCR using 10 serial diluted DNA from transgenic soya powder GTS as template. -3 to 0 in the x-axis means 10 3 to fold dilution (log scale). The CaMV 35S gene was amplified for 35 cycles. S-10

E-Supporting Information-1 (ESI-1) Ionic liquids promote PCR amplification of DNA

E-Supporting Information-1 (ESI-1) Ionic liquids promote PCR amplification of DNA Yugang Shi, ab Yen-Liang Liu, a Peng-Yeh Lai, c Ming-Chung Tseng, a Min-Jen Tseng, c Yudong Li, b and Yen-Ho Chu* a a Department