Supporting Information
|
|
- Hector Bishop
- 5 years ago
- Views:
Transcription
1 Supporting Information Gemcitabine and Antisense-microRNA Co-encapsulated PLGA-PEG Polymer Nanoparticles for Hepatocellular Carcinoma Therapy Rammohan Devulapally, Kira Foygel, Thillai V Sekar, Juergen K. Willmann, and Ramasamy Paulmurugan* Molecular Imaging Program at Stanford (MIPS), Canary Center at Stanford for Cancer Early Detection, Bio-X Program, School of Medicine, Stanford University Stanford, California, U.S.A. * paulmur8@stanford.edu S- 1
2 Contents 1. Supplementary figure S1 S-3 2. Materials S-4 3. Methods S-4 4. References S-7 S- 2
3 1. Supplementary Figure S1 Figure S1: PI-Staining based FACS analysis of (a) Hep3B and (b) HepG2 cell lines treated with Gemcitabine (3 µm) and antisense-mir-21 (15 nm) loaded PLGA-PEG-NPs. FACS data was analyzed in a Flowjo linear scale mode. S- 3
4 2. Materials GEM hydrochloride salt (>99% purity) was purchased from LC labs (Woburn, MA, USA). Poly(D,L-lactide-co-glycolide) (Resomer RG 502 H, PLGA-COOH, 50:50, MW 7,000-17,000), N-Hydroxysuccinimide (NHS, 98% pure), N-Ethyl-N -(3- dimethylaminopropyl)carbodiimide hydrochloride (EDC, 99.0% pure) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Hetero-bi-functional PEG polymer NH 2 -PEG- COOH (MW 3400) was purchased from JenKem Technology (Allen, TX, USA). Anti-miR- 21 or antisense-mir-21 (>95% purity) was custom synthesized by PAN facility at Stanford University. Dulbecco's Modified Eagle Medium (DMEM) cell culture media, fetal bovine serum (FBS), streptomycin and penicillin antibiotics were purchased from Invitrogen (Carlsbad, CA, USA). HCC (Hep3B and HepG2) cell lines were purchased from American Type Culture Collection (ATCC) (Manassas, VA, USA). 3. Methods: 3.1 Dynamic Light Scattering (DLS) measurements NPs zeta potential and size measurements were acquired by DLS (Zetasizer Nano ZS90, Malvern Instruments, U.K.). The z-average was determined using cumulant analysis. Zeta potential measurements were obtained using an aqueous dip cell by Smoluchowski model. 3.2 Transmission Electron Microscopy (TEM) We have used FEI TITAN kV environmental transmission electron microscope (ETEM) at Stanford Nano Shared facilities for obtaining TEM images of NPs. Because of PLGA-PEG NPs are not showing contrast for TEM, we have negatively stained the NPs with 1% phosphotungstic acid (PTA, ph 7.5) by mixing a drop of NPs. After 3 min of S- 4
5 incubation, a drop of PTA-stained NPs was carefully added on a carbon film-coated copper grid. After 3 min of incubation, the excess solution was drained off, air-dried and images of the NPs were obtained by operating TEM at 80 kv. ImageJ software was used for size analysis. 3.3 Entrapment efficiency estimation for anti-mir-21 Entrapment efficiency was estimated using similar procedure described in our previous work 1. Briefly, antisense-mir-21 encapsulated PLGA-PEG NPs were lyophilized by freeze drier at 80 o C, and dried NPs were disintegrated by addition of CH 2 Cl 2. The antisense-mir-21 was isolated using DNAse/RNase free water. The isolated antisensemir-21 was quantified after resolving in agarose gel. The co-encapsulated Cy5- antisense-mir-21 fluorescence image was obtained using IVIS-Lumina imaging system by imaging at the 570 nm excitation and Cy5 emission filter. The agarose gel images were quantified using densitometry, and the Cy5-fluorescence images were calculated using IVIS-Lumina imaging software. The entrapment efficiency of antisense-mir-21 loaded in the NPs was calculated using the following formula published previously by us Entrapment efficiency estimation for GEM Similar extraction procedure as stated above for antisense-mir-21 was adopted for extracting GEM from PLGA-PEG NPs. Entrapment efficiency was calculated by using the UV absorbance (Agilent Cary 60 UV-Vis Spectrophotometer) at 268 nm, indicative of GEM concentrations. The Entrapment efficiency of GEM loaded in NPs was estimated using the following formula: Entrapment efficiency (%) = Mass of GEM dried NPs (W) / Mass of total GEM used (M) x 100. S- 5
6 3.5 Protein extraction and immunoblot analysis For immunoblot assay, we have used the protocol described in our previous work 1. Briefly, for assessing the level of Bcl2, BAX, PTEN, and GAPDH expression, cells (Hep3b and HepG2) after respective treatment conditions (with GEM and antisensemir-21 loaded and co-loaded NPs) for 48 h were collected lysed in RIPA buffer containing protease inhibitor cocktail. The lysates were incubated for 1 h in an ice bath and vortex mixed for every 15 min for 5 sec and centrifuged at rpm at 4 C for 15 min. The proteins collected from the supernatant were measured using Bradford assay kit (Bio-Rad). All proteins samples (50 µg each) were incubated in loading-dye at 95 o C for 5 min for cleavage of disulfides linkages. Freshly prepared proteins sample along with pre-stained protein marker (New England Biolabs, Ipswich, MA) were resolved by 4-12% gradient SDS/PAGE (Invitrogen) at 80V and transferred onto a nitrocellulose membrane (0.45 µm pore size, Schleicher & Schuell) by electro blotting at 45V. The membrane was carefully removed from electro blot and washed three times (5 min each) with Tris-buffered saline-tween 20 (TBS-T buffer) and blocked in 5% of non-fat dry milk in TBS-T buffer for 1 h and incubated with respective antibody on a rocking shaker for overnight at 4 C. Next day, the membrane was washed with TBS-T buffer as above and incubated with HRP-conjugated anti-rabbit antibody (1:4000) in TBS-T buffer for 1 h at RT and washed with TBS-T buffer as above. Chemiluminescent HRP substrate LuminoGlo (Cell Signaling, Beverly, MA) was added to the membrane and imaged with IVIS-Lumina imaging system. Images were analyzed by IVIS-Lumina Image software. The same membrane was stripped using stripping buffer and used for another antibody and finally with GAPDH to control for protein loading. S- 6
7 References: 1. Devulapally, R.; Sekar, N. M.; Sekar, T. V.; Foygel, K.; Massoud, T. F.; Willmann, J. K.; Paulmurugan, R., Polymer Nanoparticles Mediated Codelivery of AntimiR-10b and AntimiR-21 for Achieving Triple Negative Breast Cancer Therapy. ACS Nano 2015, 9 (3), Devulapally, R.; Sekar, T. V.; Paulmurugan, R., Formulation of Anti-miR-21 and 4-Hydroxytamoxifen Co-loaded Biodegradable Polymer Nanoparticles and Their Antiproliferative Effect on Breast Cancer Cells. Mol. Pharmaceutics 2015, 12 (6), S- 7
PRODUCT DATA SHEET. Carboxylated Fluorescent Gold Nanoparticles. Description. Characteristics
PRODUCT DATA SHEET Carboxylated Fluorescent Gold Nanoparticles Description Cytodiagnostics carboxylated fluorescent gold nanoparticles is a unique product that combines our Cyto fluorescent dyes and gold
More informationPRODUCT DATA SHEET. Carboxylated Gold Nanoparticles. Description. Features. Storage. Applications. Handling. Characteristics
PRODUCT DATA SHEET Carboxylated Gold Nanoparticles Description Cytodiagnostics carboxylated gold nanoparticles are available with two different lengths of PEG surface spacers, i.e. 3000Da and 5000Da offering
More informationIgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only
IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only Introduction The IgG TrueBlot for mouse, rabbit, or goat-derived antibodies represents unique series of respective
More informationWestern Blot Tool Box
Western Blot Tool Box BOX12/BOX12-03 V1.1 Store at 2-8 C For research use only Introduction The Western Blot Tool Box is designed to conveniently provide reagents/buffers needed for Western blotting, from
More informationSegments of the obstructed intestinal loops were fixed in 4% paraformaldehyde
Supplementary text Supplementary materials and methods Histopathological examination Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin wax with
More informationSupplementary Information Temperature-responsive Gene Silencing by a Smart Polymer
Supplementary Information Temperature-responsive Gene Silencing by a Smart Polymer Mingming Wang, Yiyun Cheng * Shanghai Key Laboratory of Regulatory Biology, School of Life Sciences, East China Normal
More informationAntibody was principally purchased from Santa Cruz (EGFR sc-03), Cetuximab (Bristol
Materials and Methods Reagents Antibody was principally purchased from Santa Cruz (EGFR sc-03), Cetuximab (Bristol Mayer Squib), IgG (Jacson Laboratory), Carboplatin (Bristol Mayer Squib), Para formaldehyde
More informationApoptosis And Anti-tumor Effect Induced By Mtor Inhibitor And Autophagy Inhibitor In Human Osteosarcoma Cells
Apoptosis And Anti-tumor Effect Induced By Mtor Inhibitor And Autophagy Inhibitor In Human Osteosarcoma Cells Ryosuke Horie. Kagawa University of medecine, Kita-gun, Japan. Disclosures: R. Horie: None.
More informationRheB Activation Assay Kit
A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based RheB Activation Assay Kit Catalog Number: 81201 20 assays NewEast Biosciences 1 FAX: 610-945-2008 Table
More informationRab5 Activation Assay Kit
A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Rab5 Activation Assay Kit Catalog Number: 83701 20 assays 24 Whitewoods Lane 1 Table of Content Product
More informationArf6 Activation Assay Kit
A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Arf6 Activation Assay Kit Catalog Number: 82401 20 assays NewEast Biosciences 1 Table of Content Product
More informationONE-HOUR Western TM Multiplex Kit II
ONE-HOUR Western TM Multiplex Kit II Technical Manual No. 0256 Version 06192009 I Description... 1 II Kit Contents.. 2 III Related Products 2 IV Key Features. 2 V Storage... 2 VI ONE-HOUR Multiplex Western
More information< Supporting Information >
SUPPORTING INFORMATION 1 < Supporting Information > Discovery of autophagy modulators through the construction of high-content screening platform via monitoring of lipid droplets Sanghee Lee, Eunha Kim,
More informationCdc42 Activation Assay Kit
A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Cdc42 Activation Assay Kit Catalog Number: 80701 20 assays 1 Table of Content Product Description 3 Assay
More informationFunctionalization of Carbon Nanotubes Via Cleavable Bonds for. Efficient Intracellular Delivery of sirna and Potent Gene Silencing
S 1 Functionalization of Carbon Nanotubes Via Cleavable Bonds for Efficient Intracellular Delivery of sirna and Potent Gene Silencing Nadine Wong Shi Kam, Zhuang Liu and Hongjie Dai* Department of Chemistry
More informationQi Peng, Fujie Chen, Zhenlin Zhong,* Renxi Zhuo
Electronic Supplementary Information Enhanced Gene Transfection Capability of Polyethylenimine by Incorporating Boronic Acid Groups Qi Peng, Fujie Chen, Zhenlin Zhong,* Renxi Zhuo Key Laboratory of Biomedical
More informationReliaBLOT TM. IP/Western Blot Reagents Cat. No. WB120, rabbit
ReliaBLOT TM Introduction: IP/Western Blot Reagents Cat. No. WB120, rabbit ReliaBLOT TM IP/Western Blot Reagents and Procedures (patent pending) provide an improved method for the detection of immunoprecipitated
More informationElectronic Supplementary Information
Electronic Supplementary Material (ESI) for Biomaterials Science. This journal is The Royal Society of Chemistry 2016 Electronic Supplementary Information Multifunctional PEI-entrapped gold nanoparticles
More informationhfab Rhodamine Housekeeping Antibodies
hfab Rhodamine Housekeeping Antibodies Catalog # Description 12004163 Anti-Actin hfab Rhodamine Antibody, 200 µl 12004164 Anti-Actin hfab Rhodamine Antibody, 40 µl 12004165 Anti-Tubulin hfab Rhodamine
More informationProtein Translation Study Label Protein with S35 Methionine in Cells Salma Hasan and Isabelle Plo *
Protein Translation Study Label Protein with S35 Methionine in Cells Salma Hasan and Isabelle Plo * INSERM U1009, Gustave Roussy, Villejuif, France *For correspondence: isabelle.plo@gustaveroussy.fr [Abstract]
More informationA Supramolecular Approach to Improve the Gene Transfection Efficacy of Dendrimers
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 A Supramolecular Approach to Improve the Gene Transfection Efficacy of Dendrimers Naimin Shao,
More informationStar poly(β-amino esters) obtained from the combination of linear poly(β-amino esters) and polyethyleneimine
Supporting information Star poly(β-amino esters) obtained from the combination of linear poly(β-amino esters) and polyethyleneimine Xiaobei Huang,, Dezhong Zhou,,* Ming Zeng, Fatma Alshehri, Xiaolin Li,
More informationConventional isoelectric focusing with the Agilent 3100 OFFGEL Fractionator
Conventional isoelectric focusing with the Agilent 3100 OFFGEL Fractionator Technical Overview Introduction This Technical Overview demonstrates the ability of the Agilent 3100 OFFGEL Fractionator to fractionate
More informationKinase Reaction and Alkylation Protocol
Kinase Reaction and Alkylation Protocol Protocol for the treatment of substrates prior to detection by Thiophosphate Ester antibodies This product is for research use only and is not intended for diagnostic
More informationFig. S1 TGF RI inhibitor SB effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of
Fig. S1 TGF RI inhibitor SB525334 effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of different concentrations of SB525334. Cells were lysed and
More informationSupporting Information. Quantum Dot NanoLuc Bioluminescence. Resonance Energy Transfer Enables Tumor Imaging
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2016 Supporting Information Quantum Dot NanoLuc Bioluminescence Resonance Energy Transfer Enables Tumor
More informationab Ran Activation Assay Kit
ab173247 Ran Activation Assay Kit Instructions for Use For the simple and fast measurement of Ran activation. This product is for research use only and is not intended for diagnostic use. Version 1 Last
More informationWestern blotting technique: principle, procedure and application
Western blotting technique: principle, procedure and application The term blotting refers to the transfer of biological samples from a gel to a membrane and their subsequent detection on the surface of
More informationDBZ and Notch-1 Therapy for Triple Negative Breast Cancer
Aaron Kager Day Lab 10 August 2017 Introduction DBZ and Notch-1 Therapy for Triple Negative Breast Cancer Triple Negative Breast Cancer (TNBC) accounts for 15-20% of all types of breast cancer. 1 TNBC
More informationSupplementary Material
Supplementary Material Supplementary Methods Cell synchronization. For synchronized cell growth, thymidine was added to 30% confluent U2OS cells to a final concentration of 2.5mM. Cells were incubated
More informationMultiplex Fluorescent Western Blot Starter Kit for the Bio- Rad ChemiDoc MP
Page 1 of 7 INSTRUCTIONS: Z-310 Multiplex Fluorescent Western Blot Starter Kit for the Bio- Rad ChemiDoc MP Rockland Immunochemicals and Bio-Rad Laboratories have jointly developed an easy to use multiplex
More informationOptiblot ECL Ultra Detect Kit (1.2pg 2ng)
ab133409 Optiblot ECL Ultra Detect Kit (1.2pg 2ng) Instructions for Use For enhanced chemiluminescent Western blotting. This product is for research use only and is not intended for diagnostic use. 1 Table
More informationElectronic Supplementary Information. and purified according to previously published procedures(1). GlcNAc and Phos-FLAG were
Electronic Supplementary Information Experimental details: Synthesis and purification of sugars. GlcN, 4 GlcN, and 4 GlcN were synthesized and purified according to previously published procedures(1).
More informationEasy-WESTERN-II Super
Easy-WESTERN-II Super Primary Antibody Detection Reagent for Western Blots User Manual for High Sensitivity and Strong Signal Detection Immediately after receiving the kit, read the section titled COMPONENTS
More informationSchedule and Basic techniques for protein expression
Schedule and Basic techniques for protein expression Coordinator: Akihiro Morikawa Assistant: Hiroki Yasuda, Takashi Hirakawa and Yasuko Kobayashi Hirokazu Arakawa, Kazushi Tamura, Kazuhiro Muramatu and
More informationWestern blot: proteins separating technique, protocol, theory and trouble shooting
Journal of Bacteriology & Mycology: Open Access Conceptual Paper Open Access Western blot: proteins separating technique, protocol, theory and trouble shooting Abstract Western blotting is used to visualize
More informationStarBright Blue Fluorescent Secondary Antibodies
StarBright Blue Fluorescent Secondary Antibodies Instruction Manual Catalog # Description 12005866 Goat Anti-Mouse IgG StarBright Blue 520, 400 µl 12005869 Goat Anti-Rabbit IgG StarBright Blue 520, 400
More informationEasy-WESTERN-II Super
Easy-WESTERN-II Super Primary Antibody Detection Reagent for Western Blots User Manual for High Sensitivity and Strong Signal Detection Immediately after receiving the kit, read the section titled COMPONENTS
More informationGα 13 Activation Assay Kit
A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Gα 13 Activation Assay Kit Catalog Number: 80401 20 assays NewEast Biosciences 1 Table of Content Product
More informationPD-1 [Biotinylated] : PD-L1 Inhibitor Screening ELISA Assay Pair
PD-1 [Biotinylated] : PD-L1 Inhibitor Screening ELISA Assay Pair Pack Size: 96 tests / 480 tests Catalog Number:EP-101 IMPORTANT: Please carefully read this manual before performing your experiment. For
More informationElectronic Supplementary Information Sensitive detection of polynucleotide kinase using rolling circle amplification-induced chemiluminescence
Electronic Supplementary Material (ESI) for Chemical Communications. This journal is The Royal Society of Chemistry 2014 Electronic Supplementary Information Sensitive detection of polynucleotide kinase
More informationSupplementary Information
Supplementary Information A Sensitive and Reliable Detection of Thrombin via Enzyme-Precipitate- Coating-Linked Aptamer Assay Hye-Jin Lee a, Byoung Chan Kim b, Min-Kyu Oh a,*, Jungbae Kim a,* a Department
More informationIntroduction. Important Product Information. Number Description. Table of Contents
Super Signal Western ECL Substrate Number Description Super Signal Western ECL Substrate, Sufficient for 1000cm2 of membrane Kit Contents: Super Signal Western Solution A, 50mL Super Signal Western Solution
More informationData Sheet Histone H3 Dimethyl-K27 ELISA Detection Kit Catalog # 53030
Data Sheet Histone H3 Dimethyl-K27 ELISA Detection Kit Catalog # 53030 DESCRIPTION: The Histone H3 Dimethyl-K27 Detection Kit is designed to detect dimethylation of lysine 27 of Histone H3 (H3K27me2) in
More informationSupporting Information Facile Synthesis of Robust and Biocompatible Gold Nanoparticles
Supporting Information Facile Synthesis of Robust and Biocompatible Gold Nanoparticles Hongje Jang, Young-Kwan Kim, Soo-Ryoon Ryoo, Mi-Hee Kim, Dal-Hee Min* Department of Chemistry, Institute for the BioCentury,
More informationCheckpoint Kinase Activity Immunoblot Kit
Product Manual Checkpoint Kinase Activity Immunoblot Kit Catalog Number STA- 413 20 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Cdc25C is a protein phosphatase responsible
More informationGα i Activation Assay Kit
A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Gα i Activation Assay Kit Catalog Number 80301 20 assays NewEast Biosciences, Inc 1 Table of Content Product
More informationSupporting Information
Supporting Information One-step, Multiplexed Fluorescence Detection of micrornas Based on Duplex-Specific Nuclease Signal Amplification Bin-Cheng Yin, Yu-Qiang Liu, and Bang-Ce Ye* Lab of Biosystems and
More informationSUPPLEMENTAL INFROMATION
SUPPLEMENTAL INFROMATION SUPPLEMENTAL EXPERIMENTAL PROCEDURES IP 1 accumulation - IP 1 accumulation was quantified using the HTRF IP-One kit (Cisbio Bioassys, Bedford, MA, USA) according to the manufacturer
More informationSupporting Information. Alkylated branched poly(β-amino esters) demonstrate strong DNA
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry B. This journal is The Royal Society of Chemistry 2017 Supporting Information Alkylated branched poly(β-amino esters) demonstrate
More informationTechnical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD
Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD Developed for: Aerius, Odyssey Classic, Odyssey CLx and Odyssey Sa Imaging Systems
More informationSupplementary Information
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry B. This journal is The Royal Society of Chemistry 2016 Supplementary Information Efficient Delivery of Chlorin e6 into Ovarian
More informationSupporting Information. Physiological ph-dependent gelation for 3D printing based on the. phase separation of gelatin and oxidized dextran
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2017 Supporting Information Physiological ph-dependent gelation for 3D printing based on the phase separation
More informationJanus Iron Semiconducting Polymer Nanoparticle Tracer for
Supporting Information Janus Iron Oxides @ Semiconducting Polymer Nanoparticle Tracer for Cell Tracking by Magnetic Particle Imaging Guosheng Song, Min Chen, Yanrong Zhang, Liyang Cui, Haibo Qu, Xianchuang
More informationA Supersandwich Fluorescence in Situ Hybridization (SFISH) Strategy. for Highly Sensitive and Selective mrna Imaging in Tumor Cells
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Electronic Supplementary Information (ESI) A Supersandwich Fluorescence in Situ Hybridization (SFISH)
More informationSupplemental Information
Supplemental Information Intrinsic protein-protein interaction mediated and chaperonin assisted sequential assembly of a stable Bardet Biedl syndome protein complex, the BBSome * Qihong Zhang 1#, Dahai
More informationLong-Acting Release Formulation of Exendin-4 Based on Biomimetic Mineralization for Type 2 Diabetes Therapy
Supporting Information Long-Acting Release Formulation of Exendin-4 Based on Biomimetic Mineralization for Type 2 Diabetes Therapy Wei Chen,, Guohao Wang, Bryant C. Yung, Gang Liu, Zhiyong Qian*, and Xiaoyuan
More informationElectronic Supporting Information
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry B. This journal is The Royal Society of Chemistry 2016 Electronic Supporting Information Cellular Endocytosis and Trafficking
More informationPACKAGE INSERT Applied BioCode, Inc. - Beads. CARBOXYL BARCODED MAGNETIC BEADS (BMBs) 128-Plex - Part Number 44-B Plex - Part Number 44-B0302
For Coupling Nucleic Acids: PACKAGE INSERT Applied BioCode, Inc. - Beads CARBOXYL BARCODED MAGNETIC BEADS (BMBs) 128-Plex - Part Number 44-B0102 4096-Plex - Part Number 44-B0302 For Coupling Proteins:
More informationSupporting Information
Supporting Information Nuclear-Targeted Photothermal Therapy Prevents Cancer Recurrence with Near-Infrared Triggered Copper Sulfide Nanoparticles Na Li, Qiaoqiao Sun, Zhengze Yu, Xiaonan Gao, Wei Pan,
More informationVDL102.3 Production of Adenovirus in 293 Cells
1. Purpose CENTER FOR CELL & GENE THERAPY 1.1. The purpose of this protocol is to produce adenoviral vectors from transfected plasmid DNA. 1.2. This procedure is routinely performed in the Vector Development
More informationDepartment of Mechanical Engineering, University of Washington, Seattle, WA, 98195
Supplementary information Contact Angle Changes Induced by Immunocomplex Formation Jong-Hoon Kim, a Amy Q. Shen, a Kyong-Hoon Lee, b Gerard A. Cangelosi c and Jae-Hyun Chung* a a Department of Mechanical
More informationSupporting Information
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2015 Supporting Information Materials BSA (bovine serum albumin, 99%), fluorescein isothiocyanate
More informationSupporting Information
Supporting Information Ultra-robust Biochips with Metal-Organic Framework Coating for Point-of-Care Diagnosis Congzhou Wang, Lu Wang, Sirimuvva Tadepalli, Jeremiah J. Morrissey, Evan D. Kharasch, Rajesh
More informationPlasmonic-driven Thermal Sensing: Ultralow Detection of Cancer Markers. Supporting Information
Plasmonic-driven Thermal Sensing: Ultralow Detection of Cancer Markers Ester Polo, a, Pablo del Pino, a, Beatriz Pelaz, a,± Valeria Grazu, a and Jesús M. de la Fuente*,a a Instituto de Nanociencia de Aragon
More informationProtocol for induction of expression and cell lysate production
Protocol for induction of expression and cell lysate production AV-04 Doxycyclin induction and cell lysate 1.0 Introduction / Description This method is intended for the treatment of the previously transfected
More informationSupplementary information for. An Ultrasensitive Biosensor for DNA Detection Based on. Hybridization Chain Reaction Coupled with the Efficient
Supplementary information for An Ultrasensitive Biosensor for DNA Detection Based on Hybridization Chain Reaction Coupled with the Efficient Quenching of Ruthenium Complex to CdTe Quantum Dot Yufei Liu,
More informationOrexin A (HUMAN, MOUSE, RAT, PORCINE, OVINE,
Orexin A (HUMAN, MOUSE, RAT, PORCINE, OVINE, BOVINE) Western Blot Kit Protocol (Catalog #WBK-003-30) PHOENIX PHARMACEUTICALS, INC. TABLE OF CONTENTS 1. Kit Contents...2 2. Storage...2 3. Introduction...3
More informationOligonucleotide Loading Determines Cellular Uptake of DNA- Modified Gold Nanoparticles
Supporting Information for: Oligonucleotide Loading Determines Cellular Uptake of DNA- Modified Gold Nanoparticles David A. Giljohann, Dwight S. Seferos, Pinal C. Patel, Jill E. Millstone, Nathaniel L.
More information3T3-L1 Differentiation Protocol
3T3-L1 Differentiation Protocol Written by Eisuke Kato on 2013/10/09 MATERIALS Dulbecco's Modified Eagles Medium (D-MEM) (High Glucose) with L-Glutamine and Phenol Red High glucose (Wako Chem 044-29765,
More information1. Goat Anti-Caspase-3 (CPP32) Antibody, R&D systems (cat #AF-605-NA), 0.5ug/ml
Western Blot Antibodies: 1. Goat Anti-Caspase-3 (CPP32) Antibody, R&D systems (cat #AF-605-NA), 0.5ug/ml 2. Goat Anti-human LAP (TGF-b1) Antibody, R&D Systems (cat #AF-246-NA), 0.1-0.2 ug/ml 3. Rabbit
More informationLINGO-1, A TRANSMEMBRANE SIGNALING PROTEIN, INHIBITS OLIGODENDROCYTE DIFFERENTIATION AND MYELINATION THROUGH INTERCELLULAR SELF- INTERACTIONS.
Supplemental Data: LINGO-1, A TRANSMEMBRANE SIGNALING PROTEIN, INHIBITS OLIGODENDROCYTE DIFFERENTIATION AND MYELINATION THROUGH INTERCELLULAR SELF- INTERACTIONS. Scott Jepson, Bryan Vought, Christian H.
More informationSupporting Information
Supporting Information Photosensitizer-conjugated polymeric nanoparticles for redox-responsive fluorescence imaging and photodynamic therapy Hyunjin Kim, a Saehun Mun b and Yongdoo Choi* a a Molecular
More informationA Versatile Method for Generating Semiconducting Polymer Dot Nanocomposites
A Versatile Method for Generating Semiconducting Polymer Dot Nanocomposites Wei Sun, Sarah Hayden, Yuhui Jin, Yu Rong, Jiangbo Yu, Fangmao Ye, Yang-Hsiang Chan, Max Zeigler, Changfeng Wu, Daniel T. Chiu*
More informationA dual-readout chemiluminescent gold lateral flow test for multiplex. and ultrasensitive detection of disease biomarkers in real samples
Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2016 Supporting Information for A dual-readout chemiluminescent gold lateral flow test for multiplex
More informationSupplementary Materials and Methods
Supplementary Materials and Methods Reagents Supplementary Material (ESI) for Lab on a Chip RPMI medium, FBS, HEPES buffer solution, sodium pyruvate, penicillin, and streptomycin were obtained from Biological
More informationLumazine synthase protein cage nanoparticles as modular delivery platforms for targeted drug delivery
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2014 Supporting Information for Lumazine synthase protein cage nanoparticles as modular delivery
More informationSERVALight EosUltra Western Blot Chemiluminescence HRP Substrate Kit
INSTRUCTION MANUAL SERVALight EosUltra Western Blot Chemiluminescence HRP Substrate Kit (Cat. No. 42586) SERVA Electrophoresis GmbH Carl-Benz-Str. 7 D-69115 Heidelberg Phone +49-6221-138400, Fax +49-6221-1384010
More informationRNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the
Supplementary Methods RT-PCR and real-time PCR analysis RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the manufacturer s protocol and quantified by measuring the
More informationBACTERIAL PRODUCTION EXPRESSION METHOD OVERVIEW: PEF # GENE NAME EXPRESSION VECTOR MOLECULAR WEIGHT kda (full-length) 34.
BACTERIAL PRODUCTION PEF # GENE NAME EXPRESSION VECTOR MOLECULAR WEIGHT 2015-XXXX XXXX pet-32a 50.9 kda (full-length) 34.0 kda (cleaved) EXPRESSION METHOD OVERVIEW: Plasmid DNA was transformed into BL21
More informationYeast Nuclei Isolation Kit
Yeast Nuclei Isolation Kit Catalog Number KA3951 50 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 General Information...
More informationAnti-MOUSE IgG (H&L) (GOAT) Antibody DyLight 488 Conjugated (Min X Bv Ch Gt GP Ham Hs Hu Rb Rt & Sh Serum Proteins)
Anti-MOUSE IgG (H&L) (GOAT) Antibody DyLight 488 Conjugated (Min X Bv Ch Gt GP Ham Hs Hu Rb Rt & Sh Serum Proteins) - 610-141-121 Code: 610-141-121 Size: 100 µg Product Description: Anti-MOUSE IgG (H&L)
More informationHigh throughput screening: Huh-7 cells were seeded into 96-well plate (2000
1 SUPPLEMENTARY INFORMATION METHODS 6 7 8 9 1 11 1 1 1 1 16 17 18 19 High throughput screening: Huh-7 cells were seeded into 96-well plate ( cells/well) and infected with MOI of DENV-. One hour post-infection
More informationSupporting Information
Supporting Information Combined Photodynamic and Photothermal Therapy Using Cross-Linked Polyphosphazene Nanospheres Decorated with Gold Nanoparticles Xuan Wei,, Hongzhong Chen, Huijun Phoebe Tham, Nan
More informationSensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric*
Catalog # Kit Size SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric* AS-55550 One 96-well strip plate This kit is optimized to detect human/mouse/rat alpha-synuclein
More informationSupplementary Information
Supplementary Information Cascade Promoted Photo-Chemotherapy against Resistant Cancers by Enzyme-Responsive Polyprodrug Nanoplatforms Wenhui Wang,, Guohai Liang,, Wenjia Zhang,, Da Xing,*,, and Xianglong
More informationDynamic light scattering (DLS)-based immunoassay for. ultrasensitive detection of tumor marker protein
Electronic Supplementary Material (ESI) for Chemical Communications. This journal is The Royal Society of Chemistry 2016 Dynamic light scattering (DLS)-based immunoassay for ultrasensitive detection of
More informationProduct Guide SPL Red Kit for 40 Western Blots
Additional materials required: Smart Protein Layers Product Guide SPL Red Kit for 40 Western Blots Product No.: PR911-M, PR911-R, PR911-G; PR912-M, PR912-R, PR912-G Recommended combination product for
More informationWestern Blot Protocol
Western Blot Protocol Western blotting (WB) is the most widely performed immunoassay and is the best initial validation technique used to identify proteins of interest within a tissue homogenate or cell
More informationProtocols for Neural Progenitor Cell Expansion and Dopaminergic Neuron Differentiation
Protocols for Neural Progenitor Cell Expansion and Dopaminergic Neuron Differentiation In vitro neurological research presents many challenges due to the difficulty in establishing high-yield neuronal
More informationLumiGOLD ECL Western Blotting Detection Kit
LumiGOLD ECL Western Blotting Detection Kit An Enhanced Chemiluminescence Western Blotting Detection Kit for HRP Cat. No.: SL100309-L Store at: 4 C for 18 months Kit Contents Cat. No.: SL100309-L, Reagent
More informationRhoC Activation Assay Kit
Product Manual RhoC Activation Assay Kit Catalog Number STA-403-C 20 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Small GTP-binding proteins (or GTPases) are a family
More informationTable S1. Sequences of the DNA used in this study. Sequence (5' 3')
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Supplementary Information Portable and Quantitative Monitoring of Mercury Ions Using DNA-capped
More informationIn Vitro Monitoring of the Formation of Pentamers from the Monomer of GST Fused HPV 16 L1
This journal is The Royal Society of Chemistry 213 In Vitro Monitoring of the Formation of Pentamers from the Monomer of GST Fused HPV 16 L1 Dong-Dong Zheng, a Dong Pan, a Xiao Zha, ac Yuqing Wu,* a Chunlai
More informationEnzyme-mediated preparation of hydrogels composed of poly(ethylene glycol) and gelatin as cell culture platforms
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2014 Supplementary Material (ESI) for RSC Advances Enzyme-mediated preparation of hydrogels composed
More informationMATERIAL DATA SHEET. Reagents Provided in Kit
Lot # XXXXX CHIP/Luciferase Ubiquitination Kit Cat. # K-280 MATERIAL DATA SHEET CHIP (Carboxy terminus of HSP70-Interacting Protein) is a U-Box ubiquitin E3 ligase that ubiquitinates and mediates the proteasomal
More informationab Optiblot Fluorescent Western Blot Kit
ab133410 Optiblot Fluorescent Western Blot Kit Instructions for Use For quantitative, multi-color fluorescent Western blotting. This product is for research use only and is not intended for diagnostic
More informationExploration of Nanoparticle-Mediated Photothermal Effect of. Quantitative Photothermal Immunoassay
Analytical Chemistry Supporting Information Exploration of Nanoparticle-Mediated Photothermal Effect of TMB-H 2 O 2 Colorimetric System and Its Application in a Visual Quantitative Photothermal Immunoassay
More informationIR-Blot Secondary antibodies Rev01
0 About us Cyanagen is a biotech company located in Bologna, dedicated to research, development and production of reagents for molecular diagnostic since 2003 and one of the leading companies in the field
More informationRNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,
Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5
More information