G+C content. 1 Introduction. 2 Chromosomes Topology & Counts. 3 Genome size. 4 Replichores and gene orientation. 5 Chirochores.
|
|
- Bertram Goodman
- 6 years ago
- Views:
Transcription
1 1 Introduction 2 Chromosomes Topology & Counts 3 Genome size 4 Replichores and gene orientation 5 Chirochores 6 7 Codon usage 121 marc.bailly-bechet@univ-lyon1.fr Bacterial genome structures
2 Introduction [G+C] Is calculated in percentage of G+C : 100[A+T+C+G] First nucleic acid technology applied to bacterial systematics One of the genomic characteritics recommended for the description of species and genera 5% and 10% are the common range found within a species and a genera, respectively Modulates the aminoacid content of proteins 122 marc.bailly-bechet@univ-lyon1.fr Bacterial genome structures
3 Introduction DNA double helix Watson and Crick, Nature, Bacterial genome structures
4 Introduction The original figure 124 Bacterial genome structures
5 Introduction is the same for both strands Let ACGT the primary formula on one strand. Then, its complementary strand composition is given by : A t C g G c T a The is not affected : g+c a+c+g+t = c+g t+g+c+a 125 marc.bailly-bechet@univ-lyon1.fr Bacterial genome structures
6 Introduction DNA denaturation Quizz: How do you know if a sample of DNA is double-stranded or single-stranded? 126 marc.bailly-bechet@univ-lyon1.fr Bacterial genome structures
7 Introduction Single strand or double strand? 127 Bacterial genome structures
8 Introduction T m is the temperature at midpoint of transition 128 marc.bailly-bechet@univ-lyon1.fr Bacterial genome structures
9 Introduction T m increases with DNA AT pairs: 2 hydrogen bonds GC pairs: 3 hydrogen bonds 129 marc.bailly-bechet@univ-lyon1.fr Bacterial genome structures
10 Between species variability What is the distribution of in bacteria? Study this yourself: 1 Extract G+C data from GOLD ( use the goldtable.txt dataset as previously) and study its distribution. 2 Study data from mbailly/amig/data/gctopt.rdata. What is the relationship with optimum growth temperature T opt? With the class of organism? 130 marc.bailly-bechet@univ-lyon1.fr Bacterial genome structures
11 Between species variability from GOLD 131 Bacterial genome structures
12 Between species variability and T opt 132 marc.bailly-bechet@univ-lyon1.fr Bacterial genome structures
13 Between species variability and T opt (n = 739) 133 marc.bailly-bechet@univ-lyon1.fr Bacterial genome structures
14 Between species variability and T opt (n = 739) > shapiro.test(gctopt$topt) Shapiro-Wilk normality test data: gctopt$topt W = , p-value < 2.2e-16 > shapiro.test(gctopt$gc) Shapiro-Wilk normality test data: gctopt$gc W = 0.957, p-value = 6.941e marc.bailly-bechet@univ-lyon1.fr Bacterial genome structures
15 Between species variability and T opt (n = 739) 135 marc.bailly-bechet@univ-lyon1.fr Bacterial genome structures
16 Between species variability and T opt 136 marc.bailly-bechet@univ-lyon1.fr Bacterial genome structures
17 Between species variability and aerobiosis Study this yourself: Study data from What is the relationship with (an)aerobiosis? How does it compare with the relation to T opt? 137 marc.bailly-bechet@univ-lyon1.fr Bacterial genome structures
18 Between species variability and aerobiosis 138 Bacterial genome structures
19 Between species variability The distribution of in bacteria Results from your study: 139 Bacterial genome structures
20 Between species variability Underlying mechanism: why no 100% G+C genomes? Symmetric Directional Mutation Pressure : Mutation rate v Noboru Sueoka AT pair GC pair u Sueoka, N. (1962) On the genetic basis of variation and heterogeneity of DNA base composition. Proc. Natl. Acad. Sci. USA, 48: marc.bailly-bechet@univ-lyon1.fr Bacterial genome structures
21 Between species variability Underlying mechanism : theory θ(t) = dθ dt ( θ 0 at equilibrium : = v(1 θ) uθ v ) e (u+v)t + v u +v u +v θ = θ(+ ) = v u +v 141 marc.bailly-bechet@univ-lyon1.fr Bacterial genome structures
22 Between species variability Underlying mechanism : predictions 60 Mutation pressure Negative selection 50 Number of species % u = 3v u = v 3u = v 142 marc.bailly-bechet@univ-lyon1.fr Bacterial genome structures
23 Between species variability Underlying mechanism : experiment Direct experimental evidence : Cox, E.C., Yanofsky, C. (1967) Altered base ratios in the DNA of an Escherichia coli mutator strain. Proc. Natl. Acad. Sci. USA, 58: Accelerated evolution experiment with a mutator strain: G+C content variation visible at a lab time scale. 143 marc.bailly-bechet@univ-lyon1.fr Bacterial genome structures
24 and amino-acid content in proteins GC and the genetic code 144 Bacterial genome structures
25 and amino-acid content in proteins and aa content The impact of on the amino-acid composition of proteins was known even before the deciphering of the genetic code : Sueoka, N. (1961) Correlation between base composition of deoxyribonucleic acid and amino acid composition of protein. Proc. Natl. Acad. Sci. USA, 48: Was used as a clue to crack the genetic code (e.g. here Ala codons are expected to be G+C rich, and yes indeed GCN codons are G+C rich!). First evidence that the genetic code is (almost) universal. 145 marc.bailly-bechet@univ-lyon1.fr Bacterial genome structures
26 and amino-acid content in proteins A null hypothesis for the aa content of proteins CDS are built by random sampling from an urn with a given θ. We assume for the sake of simplicity that C = G = θ 2 and A = T = 1 θ 2. What would be the amino-acid composition of proteins under this simplistic model? 146 marc.bailly-bechet@univ-lyon1.fr Bacterial genome structures
27 and amino-acid content in proteins A null hypothesis for the aa content of proteins Let X i {A,C,G,T} a random variable for the result of outcome number i. Note P A = P(X i = A), P C = P(X i = C), P G = P(X i = G), P T = P(X i = T) the probabilities for the four bases. We have assumed that P C = P G = θ 2 and P A = P T = 1 θ 2. The probability for codon GAA is for instance : P(GAA) = P(X 1 = G X 2 = A X 3 = A) = P G P A P A In coding sequences there are no stop codons (TAA, TAG or TGA) so that: P(GAA not stop) = P(GAA) P(not stop) = P G P A P A 1 (P T P A P A +P T P A P G +P T P G P A ) 147 marc.bailly-bechet@univ-lyon1.fr Bacterial genome structures
28 and amino-acid content in proteins A null hypothesis for the aa content of proteins At the amino-acid level, Glu is encoded by GAA or GAG, so that: P(Glu) = P(GAA GAG not stop) = P(GAA not stop)+p(gag not stop) In a similar way, we can deduce of the expected frequencies for all amino-acids under the model. 148 marc.bailly-bechet@univ-lyon1.fr Bacterial genome structures
29 and amino-acid content in proteins A null hypothesis for the aa content of proteins f(θ) = f(θ) P(θ,aa) = 8 (1 θ) 2 (1+θ) (1 θ) 2 (2 θ) if aa {Ile} (1 θ) 2 if aa {Phe, Lys, Tyr, Asn} 1 θ 2 if aa {Leu} (1 θ) 2 θ if aa {Met} (1 θ)θ if aa {Asp, Glu, His, Gln, Cys} 2(1 θ)θ if aa {Val, Thr} 3(1 θ)θ if aa {Ser} (1 θ)θ 2 if aa {Trp} θ(θ+1) if aa {Arg} 2θ 2 if aa {Gly, Pro, Ala} 149 marc.bailly-bechet@univ-lyon1.fr Bacterial genome structures
30 and amino-acid content in proteins What is the impact of G+C on the aa content? Study this yourself: > load(" > dim(uco739) [1] > uco739[1:5,1:5] aaa aac aag aat aca ACHROMOBACTER DENITRIFICANS ACHROMOBACTER XYLOSOXIDANS ACIDIANUS AMBIVALENS ACIDITHIOBACILLUS FERROOXIDANS ACINETOBACTER BAUMANNII This is a dataset of codon counts in 739 bacterial species. 150 marc.bailly-bechet@univ-lyon1.fr Bacterial genome structures
31 and amino-acid content in proteins What is the impact of G+C on the aa content? Compute the from codon counts. From colnames(uco739), make a vector of in each codon: aaa aac aag aat aca acc acg act aga agc agg agt ata atc atg att caa cac cag cat cca ccc ccg cct cga cgc cgg cgt cta ctc ctg ctt gaa gac gag gat gca gcc gcg gct gga ggc ggg ggt gta gtc gtg gtt tac tat tca tcc tcg tct tgc tgg tgt tta ttc ttg ttt There are multiple ways to do that: using strsplit or s2c in library seqinr, using %in% or looping ==, using explicit loops or sapply. 151 marc.bailly-bechet@univ-lyon1.fr Bacterial genome structures
32 and amino-acid content in proteins What is the impact of G+C on the aa content? Now, thanks to matrix multiplication (%*%), compute the G+C content in percent: [,1] ACHROMOBACTER DENITRIFICANS ACHROMOBACTER XYLOSOXIDANS ACIDIANUS AMBIVALENS ACIDITHIOBACILLUS FERROOXIDANS ACINETOBACTER BAUMANNII ACINETOBACTER CALCOACETICUS Bacterial genome structures
33 and amino-acid content in proteins What is the impact of G+C on the aa content? Compute the amino-acid content from codon counts. From colnames(uco739), make a vector of the corresponding amino-acid: aaa aac aag aat aca acc acg act aga agc "Lys" "Asn" "Lys" "Asn" "Thr" "Thr" "Thr" "Thr" "Arg" "Ser" agg agt ata atc atg att caa cac cag cat "Arg" "Ser" "Ile" "Ile" "Met" "Ile" "Gln" "His" "Gln" "His" cca ccc ccg cct cga cgc cgg cgt cta ctc "Pro" "Pro" "Pro" "Pro" "Arg" "Arg" "Arg" "Arg" "Leu" "Leu" ctg ctt gaa gac gag gat gca gcc gcg gct "Leu" "Leu" "Glu" "Asp" "Glu" "Asp" "Ala" "Ala" "Ala" "Ala" gga ggc ggg ggt gta gtc gtg gtt tac tat "Gly" "Gly" "Gly" "Gly" "Val" "Val" "Val" "Val" "Tyr" "Tyr" tca tcc tcg tct tgc tgg tgt tta ttc ttg "Ser" "Ser" "Ser" "Ser" "Cys" "Trp" "Cys" "Leu" "Phe" "Leu" ttt "Phe" Useful functions are s2c(), translate() and aaa() in the seqinr package. 153 marc.bailly-bechet@univ-lyon1.fr Bacterial genome structures
34 and amino-acid content in proteins What is the impact of G+C on the aa content? Now, in one line 2, thanks to apply() and tapply(), compute the amino-acid content in each proteome: Ala Arg Asn Asp Cys ACHROMOBACTER DENITRIFICANS ACHROMOBACTER XYLOSOXIDANS ACIDIANUS AMBIVALENS ACIDITHIOBACILLUS FERROOXIDANS ACINETOBACTER BAUMANNII or more if you do not feel that geeky 154 marc.bailly-bechet@univ-lyon1.fr Bacterial genome structures
35 and amino-acid content in proteins What is the impact of G+C on the aa content? Plot the results : Show the influence of for Ala, Lys, and Glu (at least). Add the linear fit Add the neutral model as a line. 155 marc.bailly-bechet@univ-lyon1.fr Bacterial genome structures
36 and amino-acid content in proteins What should be obtained for Ala: Ala frequency evolution with G+C Ala content [%] Linear fit Neutral model [%] 156 marc.bailly-bechet@univ-lyon1.fr Bacterial genome structures
37 and amino-acid content in proteins What should be obtained for Lys: Lys frequency evolution with G+C [%] Lys content [%] Linear fit Neutral model 157 marc.bailly-bechet@univ-lyon1.fr Bacterial genome structures
38 and amino-acid content in proteins What should be obtained for Glu: Glu frequency evolution with G+C Glu content [%] Linear fit Neutral model [%] 158 marc.bailly-bechet@univ-lyon1.fr Bacterial genome structures
39 and amino-acid content in proteins How to do these graphs? 159 Bacterial genome structures
Disease and selection in the human genome 3
Disease and selection in the human genome 3 Ka/Ks revisited Please sit in row K or forward RBFD: human populations, adaptation and immunity Neandertal Museum, Mettman Germany Sequence genome Measure expression
More informationMaterials Protein synthesis kit. This kit consists of 24 amino acids, 24 transfer RNAs, four messenger RNAs and one ribosome (see below).
Protein Synthesis Instructions The purpose of today s lab is to: Understand how a cell manufactures proteins from amino acids, using information stored in the genetic code. Assemble models of four very
More informationNAME:... MODEL ANSWER... STUDENT NUMBER:... Maximum marks: 50. Internal Examiner: Hugh Murrell, Computer Science, UKZN
COMP710, Bioinformatics with Julia, Test One, Thursday the 20 th of April, 2017, 09h30-11h30 1 NAME:...... MODEL ANSWER... STUDENT NUMBER:...... Maximum marks: 50 Internal Examiner: Hugh Murrell, Computer
More informationORFs and genes. Please sit in row K or forward
ORFs and genes Please sit in row K or forward https://www.flickr.com/photos/teseum/3231682806/in/photostream/ Question: why do some strains of Vibrio cause cholera and others don t? Methods Mechanisms
More informationLecture 10, 20/2/2002: The process of solution development - The CODEHOP strategy for automatic design of consensus-degenerate primers for PCR
Lecture 10, 20/2/2002: The process of solution development - The CODEHOP strategy for automatic design of consensus-degenerate primers for PCR 1 The problem We wish to clone a yet unknown gene from a known
More informationLecture 11: Gene Prediction
Lecture 11: Gene Prediction Study Chapter 6.11-6.14 1 Gene: A sequence of nucleotides coding for protein Gene Prediction Problem: Determine the beginning and end positions of genes in a genome Where are
More informationLecture 19A. DNA computing
Lecture 19A. DNA computing What exactly is DNA (deoxyribonucleic acid)? DNA is the material that contains codes for the many physical characteristics of every living creature. Your cells use different
More informationHomework. A bit about the nature of the atoms of interest. Project. The role of electronega<vity
Homework Why cited articles are especially useful. citeulike science citation index When cutting and pasting less is more. Project Your protein: I will mail these out this weekend If you haven t gotten
More informationCodon Bias with PRISM. 2IM24/25, Fall 2007
Codon Bias with PRISM 2IM24/25, Fall 2007 from RNA to protein mrna vs. trna aminoacid trna anticodon mrna codon codon-anticodon matching Watson-Crick base pairing A U and C G binding first two nucleotide
More informationProtein Structure Analysis
BINF 731 Protein Structure Analysis http://binf.gmu.edu/vaisman/binf731/ Iosif Vaisman COMPUTATIONAL BIOLOGY COMPUTATIONAL STRUCTURAL BIOLOGY COMPUTATIONAL MOLECULAR BIOLOGY BIOINFORMATICS STRUCTURAL BIOINFORMATICS
More informationProject 07/111 Final Report October 31, Project Title: Cloning and expression of porcine complement C3d for enhanced vaccines
Project 07/111 Final Report October 31, 2007. Project Title: Cloning and expression of porcine complement C3d for enhanced vaccines Project Leader: Dr Douglas C. Hodgins (519-824-4120 Ex 54758, fax 519-824-5930)
More informationPrimer Design Workshop. École d'été en géné-que des champignons 2012 Dr. Will Hintz University of Victoria
Primer Design Workshop École d'été en géné-que des champignons 2012 Dr. Will Hintz University of Victoria Scenario You have discovered the presence of a novel endophy5c organism living inside the cells
More informationSupporting information for Biochemistry, 1995, 34(34), , DOI: /bi00034a013
Supporting information for Biochemistry, 1995, 34(34), 10807 10815, DOI: 10.1021/bi00034a013 LESNIK 10807-1081 Terms & Conditions Electronic Supporting Information files are available without a subscription
More informationElectronic Supplementary Information
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Dissecting binding of a β-barrel outer membrane
More informationDet matematisk-naturvitenskapelige fakultet
UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam: Friday
More informationFigure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis
1 2 3 4 5 6 7 8 9 10 11 12 Figure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis Information Research). Exons
More informationArabidopsis actin depolymerizing factor AtADF4 mediates defense signal transduction triggered by the Pseudomonas syringae effector AvrPphB
Arabidopsis actin depolymerizing factor mediates defense signal transduction triggered by the Pseudomonas syringae effector AvrPphB Files in this Data Supplement: Supplemental Table S1 Supplemental Table
More informationNational PHL TB DST Reference Center PSQ Reporting Language Table of Contents
PSQ Reporting Language Table of Contents Document Page Number PSQ for Rifampin 2-6 Comparison table for rpob Codon Numbering 2 rpob mutation list (new numbering system) 3-5 rpob interpretations 6 PSQ for
More informationSupplementary. Table 1: Oligonucleotides and Plasmids. complementary to positions from 77 of the SRα '- GCT CTA GAG AAC TTG AAG TAC AGA CTG C
Supplementary Table 1: Oligonucleotides and Plasmids 913954 5'- GCT CTA GAG AAC TTG AAG TAC AGA CTG C 913955 5'- CCC AAG CTT ACA GTG TGG CCA TTC TGC TG 223396 5'- CGA CGC GTA CAG TGT GGC CAT TCT GCT G
More informationHes6. PPARα. PPARγ HNF4 CD36
SUPPLEMENTARY INFORMATION Supplementary Table Positions and Sequences of ChIP primers -63 AGGTCACTGCCA -79 AGGTCTGCTGTG Hes6-0067 GGGCAaAGTTCA ACOT -395 GGGGCAgAGTTCA PPARα -309 GGCTCAaAGTTCAaGTTCA CPTa
More informationwww.lessonplansinc.com Topic: Gene Mutations WS Summary: Students will learn about frame shift mutations and base substitution mutations. Goals & Objectives: Students will be able to demonstrate how mutations
More informationSupplemental Data Supplemental Figure 1.
Supplemental Data Supplemental Figure 1. Silique arrangement in the wild-type, jhs, and complemented lines. Wild-type (WT) (A), the jhs1 mutant (B,C), and the jhs1 mutant complemented with JHS1 (Com) (D)
More informationY-chromosomal haplogroup typing Using SBE reaction
Schematic of multiplex PCR followed by SBE reaction Multiplex PCR Exo SAP purification SBE reaction 5 A 3 ddatp ddgtp 3 T 5 A G 3 T 5 3 5 G C 5 3 3 C 5 ddttp ddctp 5 T 3 T C 3 A 5 3 A 5 5 C 3 3 G 5 3 G
More informationMultiplexing Genome-scale Engineering
Multiplexing Genome-scale Engineering Harris Wang, Ph.D. Department of Systems Biology Department of Pathology & Cell Biology http://wanglab.c2b2.columbia.edu Rise of Genomics An Expanding Toolbox Esvelt
More informationGenomic Sequence Analysis using Electron-Ion Interaction
University of Aizu, Graduation Thesis. March, 25 s1985 1 Genomic Sequence Analysis using Electron-Ion Interaction Potential Masumi Kobayashi s1985 Supervised by Hiroshi Toyoizumi Abstract This paper proposes
More informationfor Programmed Chemo-enzymatic Synthesis of Antigenic Oligosaccharides
Supporting Information Design of α-transglucosidases of Controlled Specificity for Programmed Chemo-enzymatic Synthesis of Antigenic Oligosaccharides Elise Champion ±,,,, Isabelle André ±,,, Claire Moulis
More informationΔPDD1 x ΔPDD1. ΔPDD1 x wild type. 70 kd Pdd1. Pdd3
Supplemental Fig. S1 ΔPDD1 x wild type ΔPDD1 x ΔPDD1 70 kd Pdd1 50 kd 37 kd Pdd3 Supplemental Fig. S1. ΔPDD1 strains express no detectable Pdd1 protein. Western blot analysis of whole-protein extracts
More informationSAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer
TEACHER S GUIDE SAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer SYNOPSIS This activity uses the metaphor of decoding a secret message for the Protein Synthesis process. Students teach themselves
More informationPROTEIN SYNTHESIS Study Guide
PART A. Read the following: PROTEIN SYNTHESIS Study Guide Protein synthesis is the process used by the body to make proteins. The first step of protein synthesis is called Transcription. It occurs in the
More informationSupplementary Figure 1A A404 Cells +/- Retinoic Acid
Supplementary Figure 1A A44 Cells +/- Retinoic Acid 1 1 H3 Lys4 di-methylation SM-actin VEC cfos (-) RA (+) RA 14 1 1 8 6 4 H3 Lys79 di-methylation SM-actin VEC cfos (-) RA (+) RA Supplementary Figure
More informationPGRP negatively regulates NOD-mediated cytokine production in rainbow trout liver cells
Supplementary Information for: PGRP negatively regulates NOD-mediated cytokine production in rainbow trout liver cells Ju Hye Jang 1, Hyun Kim 2, Mi Jung Jang 2, Ju Hyun Cho 1,2,* 1 Research Institute
More informationLezione 10. Bioinformatica. Mauro Ceccanti e Alberto Paoluzzi
Lezione 10 Bioinformatica Mauro Ceccanti e Alberto Paoluzzi Dip. Informatica e Automazione Università Roma Tre Dip. Medicina Clinica Università La Sapienza Lezione 10: Sintesi proteica Synthesis of proteins
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/10/494/eaan6284/dc1 Supplementary Materials for Activation of master virulence regulator PhoP in acidic ph requires the Salmonella-specific protein UgtL Jeongjoon
More informationSupplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC
Supplementary Appendixes Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC ACG TAG CTC CGG CTG GA-3 for vimentin, /5AmMC6/TCC CTC GCG CGT GGC TTC CGC
More informationFROM DNA TO GENETIC GENEALOGY Stephen P. Morse
1. GENES, CHROMOSOMES, AND DNA Chromosomes FROM DNA TO GENETIC GENEALOGY Stephen P. Morse (steve@stevemorse.org) Every human cell = 46 chromosomes (1 to 22 in pairs, 2 sex chromosomes) Male: sex chromosomes
More informationTable S1. Bacterial strains (Related to Results and Experimental Procedures)
Table S1. Bacterial strains (Related to Results and Experimental Procedures) Strain number Relevant genotype Source or reference 1045 AB1157 Graham Walker (Donnelly and Walker, 1989) 2458 3084 (MG1655)
More informationSupporting Information
Supporting Information Table S1. Oligonucleotide sequences used in this work Oligo DNA A B C D CpG-A CpG-B CpG-C CpG-D Sequence 5 ACA TTC CTA AGT CTG AAA CAT TAC AGC TTG CTA CAC GAG AAG AGC CGC CAT AGT
More informationExpression of Recombinant Proteins
Expression of Recombinant Proteins Uses of Cloned Genes sequencing reagents (eg, probes) protein production insufficient natural quantities modify/mutagenesis library screening Expression Vector Features
More informationSupplemental Data. mir156-regulated SPL Transcription. Factors Define an Endogenous Flowering. Pathway in Arabidopsis thaliana
Cell, Volume 138 Supplemental Data mir156-regulated SPL Transcription Factors Define an Endogenous Flowering Pathway in Arabidopsis thaliana Jia-Wei Wang, Benjamin Czech, and Detlef Weigel Table S1. Interaction
More informationCreation of A Caspese-3 Sensing System Using A Combination of Split- GFP and Split-Intein
Supplementary Information Creation of A Caspese-3 Sensing System Using A Combination of Split- GFP and Split-Intein Seiji Sakamoto,* Mika Terauchi, Anna Hugo, Tanner Kim, Yasuyuki Araki and Takehiko Wada*
More informationDierks Supplementary Fig. S1
Dierks Supplementary Fig. S1 ITK SYK PH TH K42R wt K42R (kinase deficient) R29C E42K Y323F R29C E42K Y323F (reduced phospholipid binding) (enhanced phospholipid binding) (reduced Cbl binding) E42K Y323F
More informationSupplementary Information. Construction of Lasso Peptide Fusion Proteins
Supplementary Information Construction of Lasso Peptide Fusion Proteins Chuhan Zong 1, Mikhail O. Maksimov 2, A. James Link 2,3 * Departments of 1 Chemistry, 2 Chemical and Biological Engineering, and
More informationSupporting Information
Supporting Information Barderas et al. 10.1073/pnas.0801221105 SI Text: Docking of gastrin to Constructed scfv Models Interactive predocking of the 4-WL-5 motif into the central pocket observed in the
More informationIntroduction to Bioinformatics Dr. Robert Moss
Introduction to Bioinformatics Dr. Robert Moss Bioinformatics is about searching biological databases, comparing sequences, looking at protein structures, and more generally, asking biological questions
More informationOverexpression Normal expression Overexpression Normal expression. 26 (21.1%) N (%) P-value a N (%)
SUPPLEMENTARY TABLES Table S1. Alteration of ZNF322A protein expression levels in relation to clinicopathological parameters in 123 Asian and 74 Caucasian lung cancer patients. Asian patients Caucasian
More informationDNA sentences. How are proteins coded for by DNA? Materials. Teacher instructions. Student instructions. Reflection
DNA sentences How are proteins coded for by DNA? Deoxyribonucleic acid (DNA) is the molecule of life. DNA is one of the most recognizable nucleic acids, a double-stranded helix. The process by which DNA
More informationA Circular Code in the Protein Coding Genes of Mitochondria
J. theor. Biol. (1997) 189, 273 290 A Circular Code in the Protein Coding Genes of Mitochondria DIDIER G. ARQUE` S* AND CHRISTIAN J. MICHEL *Equipe de Biologie The orique, Universite de Marne la Valle
More informationRPA-AB RPA-C Supplemental Figure S1: SDS-PAGE stained with Coomassie Blue after protein purification.
RPA-AB RPA-C (a) (b) (c) (d) (e) (f) Supplemental Figure S: SDS-PAGE stained with Coomassie Blue after protein purification. (a) RPA; (b) RPA-AB; (c) RPA-CDE; (d) RPA-CDE core; (e) RPA-DE; and (f) RPA-C
More informationSampling Random Bioinformatics Puzzles using Adaptive Probability Distributions
Sampling Random Bioinformatics Puzzles using Adaptive Probability Distributions Christian Theil Have 1, Emil Vincent Appel 1, Jette Bork-Jensen 1, and Ole Torp Lassen 2 1 Novo Nordisk Foundation Center
More informationSupplemental Data. Bennett et al. (2010). Plant Cell /tpc
BRN1 ---------MSSSNGGVPPGFRFHPTDEELLHYYLKKKISYEKFEMEVIKEVDLNKIEPWDLQDRCKIGSTPQNEWYFFSHKDRKYPTGS 81 BRN2 --------MGSSSNGGVPPGFRFHPTDEELLHYYLKKKISYQKFEMEVIREVDLNKLEPWDLQERCKIGSTPQNEWYFFSHKDRKYPTGS 82 SMB
More informationSupplemental material
Supplemental material Diversity of O-antigen repeat-unit structures can account for the substantial sequence variation of Wzx translocases Yaoqin Hong and Peter R. Reeves School of Molecular Bioscience,
More informationII 0.95 DM2 (RPP1) DM3 (At3g61540) b
Table S2. F 2 Segregation Ratios at 16 C, Related to Figure 2 Cross n c Phenotype Model e 2 Locus A Locus B Normal F 1 -like Enhanced d Uk-1/Uk-3 149 64 36 49 DM2 (RPP1) DM1 (SSI4) a Bla-1/Hh-0 F 3 111
More informationSupporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2006
Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2006 Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2006 Supporting Information for Expanding the Genetic
More informationThr Gly Tyr. Gly Lys Asn
Your unique body characteristics (traits), such as hair color or blood type, are determined by the proteins your body produces. Proteins are the building blocks of life - in fact, about 45% of the human
More informationstrain devoid of the aox1 gene [1]. Thus, the identification of AOX1 in the intracellular
Additional file 2 Identification of AOX1 in P. pastoris GS115 with a Mut s phenotype Results and Discussion The HBsAg producing strain was originally identified as a Mut s (methanol utilization slow) strain
More informationSUPPORTING INFORMATION
SUPPORTING INFORMATION Investigation of the Biosynthesis of the Lasso Peptide Chaxapeptin Using an E. coli-based Production System Helena Martin-Gómez, Uwe Linne, Fernando Albericio, Judit Tulla-Puche,*
More informationSupporting Online Information
Supporting Online Information Isolation of Human Genomic DNA Sequences with Expanded Nucleobase Selectivity Preeti Rathi, Sara Maurer, Grzegorz Kubik and Daniel Summerer* Department of Chemistry and Chemical
More informationSupplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR
Supplemental Dataset Supplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. DNA sequence Amino acid sequence WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR Allele 1 CCTGTC------------------GATAGC
More informationPCR analysis was performed to show the presence and the integrity of the var1csa and var-
Supplementary information: Methods: Table S1: Primer Name Nucleotide sequence (5-3 ) DBL3-F tcc ccg cgg agt gaa aca tca tgt gac tg DBL3-R gac tag ttt ctt tca ata aat cac tcg c DBL5-F cgc cct agg tgc ttc
More informationNucleic Acids Research
Volume 10 Number 1 1982 VoLume 10 Number 11982 Nucleic Acids Research Nucleic Acids Research A convenient and adaptable package of DNA sequence analysis programs for microcomputers James Pustell and Fotis
More information2
1 2 3 4 5 6 7 Supplemental Table 1. Magnaporthe oryzae strains generated in this study. Strain background Genotype Strain name Description Guy-11 H1:RFP H1:RFP Strain expressing Histone H1- encoding gene
More informationComplexity of the Ruminococcus flavefaciens FD-1 cellulosome reflects an expansion of family-related protein-protein interactions
Complexity of the Ruminococcus flavefaciens FD-1 cellulosome reflects an expansion of family-related protein-protein interactions Vered Israeli-Ruimy 1,*, Pedro Bule 2,*, Sadanari Jindou 3, Bareket Dassa
More informationINTRODUCTION TO THE MOLECULAR GENETICS OF THE COLOR MUTATIONS IN ROCK POCKET MICE
The Making of the The Fittest: Making of the Fittest Natural Selection Natural and Adaptation Selection and Adaptation Educator Materials TEACHER MATERIALS INTRODUCTION TO THE MOLECULAR GENETICS OF THE
More informationAdd 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH).
Bisulfite Treatment of DNA Dilute DNA sample to 2µg DNA in 50µl ddh 2 O. Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH). Incubate in a 37ºC water bath for 30 minutes. To 55µl samples
More informationS4B fluorescence (AU)
A S4B fluorescence (AU) S4B fluorescence (AU) dsbb csgba csgd dsbb csgba bcsa 5000 * NS NS 4000 * 3000 2000 1000 0 ΔcsgBAΔbcsA ΔcsgDΔdsbBΔbcsA ΔcsgBA ΔdsbBΔcsgBA ΔcsgDΔdsbB B -1000 4000 * * NS 3500 * 3000
More informationhcd1tg/hj1tg/ ApoE-/- hcd1tg/hj1tg/ ApoE+/+
ApoE+/+ ApoE-/- ApoE-/- H&E (1x) Supplementary Figure 1. No obvious pathology is observed in the colon of diseased ApoE-/me. Colon samples were fixed in 1% formalin and laid out in Swiss rolls for paraffin
More informationGene synthesis by circular assembly amplification
Gene synthesis by circular assembly amplification Duhee Bang & George M Church Supplementary figures and text: Supplementary Figure 1. Dpo4 gene (1.05kb) construction by various methods. Supplementary
More informationevaluated with UAS CLB eliciting UAS CIT -N Libraries increase in the
Supplementary Figures Supplementary Figure 1: Promoter scaffold library assemblies. Many ensembless of libraries were evaluated in this work. As a legend, the box outline color in top half of the figure
More informationFAT10 and NUB1L bind the VWA domain of Rpn10 and Rpn1 to enable proteasome-mediated proteolysis
SUPPLEMENTARY INFORMATION FAT10 and NUB1L bind the VWA domain of Rpn10 and Rpn1 to enable proteasome-mediated proteolysis Neha Rani, Annette Aichem, Gunter Schmidtke, Stefan Kreft, and Marcus Groettrup
More informationSUPPLEMENTAL MATERIAL GENOTYPING WITH MULTIPLEXING TARGETED RESEQUENCING
SUPPLEMENTAL MATERIAL GENOTYPING WITH MULTIPLEXING TARGETED RESEQUENCING All of the patients and control subjects were sequenced and genotyped in the same way. Shotgun libraries of approximately 250 bp
More informationSearch for and Analysis of Single Nucleotide Polymorphisms (SNPs) in Rice (Oryza sativa, Oryza rufipogon) and Establishment of SNP Markers
DNA Research 9, 163 171 (2002) Search for and Analysis of Single Nucleotide Polymorphisms (SNPs) in Rice (Oryza sativa, Oryza rufipogon) and Establishment of SNP Markers Shinobu Nasu, Junko Suzuki, Rieko
More informationEvolution of protein coding sequences
Evolution of protein coding sequences Kinds of nucleo-de subs-tu-ons Given 2 nucleo-de sequences, how their similari-es and differences arose from a common ancestor? We assume A the common ancestor: Single
More informationCat. # Product Size DS130 DynaExpress TA PCR Cloning Kit (ptakn-2) 20 reactions Box 1 (-20 ) ptakn-2 Vector, linearized 20 µl (50 ng/µl) 1
Product Name: Kit Component TA PCR Cloning Kit (ptakn-2) Cat. # Product Size DS130 TA PCR Cloning Kit (ptakn-2) 20 reactions Box 1 (-20 ) ptakn-2 Vector, linearized 20 µl (50 ng/µl) 1 2 Ligation Buffer
More informationBIOSTAT516 Statistical Methods in Genetic Epidemiology Autumn 2005 Handout1, prepared by Kathleen Kerr and Stephanie Monks
Rationale of Genetic Studies Some goals of genetic studies include: to identify the genetic causes of phenotypic variation develop genetic tests o benefits to individuals and to society are still uncertain
More informationAdditional Table A1. Accession numbers of resource records for all rhodopsin sequences downloaded from NCBI. Species common name
1 2 3 Additional Table A1. Accession numbers of resource records for all rhodopsin sequences downloaded from NCBI. Species common name Scientific name Accession number Accession number (introns) Codons
More informationPCR-based Markers and Cut Flower Longevity in Carnation
PCRbased Markers and Cut Flower Longevity in Carnation Laura De Benedetti, Luca Braglia, Simona Bruna, Gianluca Burchi *, Antonio Mercuri and Tito Schiva Istituto Sperimentale per la Floricoltura, Corso
More informationSupporting Information
Supporting Information Transfection of DNA Cages into Mammalian Cells Email: a.turberfield@physics.ox.ac.uk Table of Contents Supporting Figure 1 DNA tetrahedra used in transfection experiments 2 Supporting
More informationSUPPLEMENTARY MATERIALS AND METHODS. E. coli strains, plasmids, and growth conditions. Escherichia coli strain P90C (1)
SUPPLEMENTARY MATERIALS AND METHODS E. coli strains, plasmids, and growth conditions. Escherichia coli strain P90C (1) dinb::kan (lab stock) derivative was used as wild-type. MG1655 alka tag dinb (2) is
More informationSupplemental Table 1. Primers used for PCR.
Supplemental Table 1. Primers used for PCR. Gene Type Primer Sequence Genotyping and semi-quantitative RT-PCR F 5 -TTG CCC GAT CAC CAT CTG TA-3 rwa1-1 R 5 -TGT AGC GAT CAA GGC CTG ATC TAA-3 LB 5 -TAG CAT
More informationQuantitative reverse-transcription PCR. Transcript levels of flgs, flgr, flia and flha were
1 Supplemental methods 2 3 4 5 6 7 8 9 1 11 12 13 14 15 16 17 18 19 21 22 23 Quantitative reverse-transcription PCR. Transcript levels of flgs, flgr, flia and flha were monitored by quantitative reverse-transcription
More informationLegends for supplementary figures 1-3
High throughput resistance profiling of Plasmodium falciparum infections based on custom dual indexing and Illumina next generation sequencing-technology Sidsel Nag 1,2 *, Marlene D. Dalgaard 3, Poul-Erik
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nature07182 SUPPLEMENTAL FIGURES AND TABLES Fig. S1. myf5-expressing cells give rise to brown fat depots and skeletal muscle (a) Perirenal BAT from control (cre negative) and myf5-cre:r26r3-yfp
More informationConverting rabbit hybridoma into recombinant antibodies with effective transient production in an optimized human expression system
Converting rabbit hybridoma into recombinant antibodies with effective transient production in an optimized human expression system Dr. Tim Welsink Molecular Biology Transient Gene Expression OUTLINE Short
More informationCodon bias and gene expression of mitochondrial ND2 gene in chordates
www.bioinformation.net Hypothesis Volume 11(8) Codon bias and gene expression of mitochondrial ND2 gene in chordates Arif Uddin, Tarikul Huda Mazumder, Monisha Nath Choudhury & Supriyo Chakraborty* Department
More informationSequence Design for DNA Computing
Sequence Design for DNA Computing 2004. 10. 16 Advanced AI Soo-Yong Shin and Byoung-Tak Zhang Biointelligence Laboratory DNA Hydrogen bonds Hybridization Watson-Crick Complement A single-stranded DNA molecule
More information11th Meeting of the Science Working Group. Lima, Peru, October 2012 SWG-11-JM-11
11th Meeting of the Science Working Group Lima, Peru, 15-19 October 2012 Russian population genetics studies of jack mackerel in the South Pacific P.K.Afanasiev M.A.Rabchun A.I.Glubokov Introduction. In
More informationBioInformatics and Computational Molecular Biology. Course Website
BioInformatics and Computational Molecular Biology Course Website http://bioinformatics.uchc.edu What is Bioinformatics Bioinformatics upgrades the information content of biological measurements. Discovery
More informationMolecular Level of Genetics
Molecular Level of Genetics Most of the molecules found in humans and other living organisms fall into one of four categories: 1. carbohydrates (sugars and starches) 2. lipids (fats, oils, and waxes) 3.
More informationGenomics and Gene Recognition Genes and Blue Genes
Genomics and Gene Recognition Genes and Blue Genes November 1, 2004 Prokaryotic Gene Structure prokaryotes are simplest free-living organisms studying prokaryotes can give us a sense what is the minimum
More informationLevel 2 Biology, 2017
91159 911590 2SUPERVISOR S Level 2 Biology, 2017 91159 Demonstrate understanding of gene expression 2.00 p.m. Wednesday 22 November 2017 Credits: Four Achievement Achievement with Merit Achievement with
More informationSupplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of
Supplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of the cell line) were immunostained for HA, acetylated
More informationSupplemental Data. Distinct Pathways for snorna and mrna Termination
Molecular Cell, Volume 24 Supplemental Data Distinct Pathways for snorna and mrna Termination Minkyu Kim, Lidia Vasiljeva, Oliver J. Rando, Alexander Zhelkovsky, Claire Moore, and Stephen Buratowski A
More informationCauses and Effects of N-Terminal Codon Bias in Bacterial Genes. Mikk Eelmets Journal Club
Causes and Effects of N-Terminal Codon Bias in Bacterial Genes Mikk Eelmets Journal Club 21.2.214 Introduction Ribosomes were first observed in the mid-195s (Nobel Prize in 1974) Nobel Prize in 29 for
More informationFolding simulation: self-organization of 4-helix bundle protein. yellow = helical turns
Folding simulation: self-organization of 4-helix bundle protein yellow = helical turns Protein structure Protein: heteropolymer chain made of amino acid residues R + H 3 N - C - COO - H φ ψ Chain of amino
More informationSupplementary Figures
Supplementary Figures Supplementary Fig. 1 Characterization of GSCs. a. Immunostaining of primary GSC spheres from GSC lines. Nestin (neural progenitor marker, red), TLX (green). Merged images of nestin,
More informationSupplemental Information. Target-Mediated Protection of Endogenous. MicroRNAs in C. elegans. Inventory of Supplementary Information
Developmental Cell, Volume 20 Supplemental Information Target-Mediated Protection of Endogenous MicroRNAs in C. elegans Saibal Chatterjee, Monika Fasler, Ingo Büssing, and Helge Großhans Inventory of Supplementary
More informationSUPPORTING INFORMATION FILE
Intrinsic and extrinsic connections of Tet3 dioxygenase with CXXC zinc finger modules Nan Liu, Mengxi Wang, Wen Deng, Christine S. Schmidt, Weihua Qin, Heinrich Leonhardt and Fabio Spada Department of
More informationSupplemental Information. Human Senataxin Resolves RNA/DNA Hybrids. Formed at Transcriptional Pause Sites. to Promote Xrn2-Dependent Termination
Supplemental Information Molecular Cell, Volume 42 Human Senataxin Resolves RNA/DNA Hybrids Formed at Transcriptional Pause Sites to Promote Xrn2-Dependent Termination Konstantina Skourti-Stathaki, Nicholas
More information1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation
1. DNA, RNA structure 2. DNA replication 3. Transcription, translation DNA and RNA are polymers of nucleotides DNA is a nucleic acid, made of long chains of nucleotides Nucleotide Phosphate group Nitrogenous
More information