Supplemental material
|
|
|
- Noel Charles
- 5 years ago
- Views:
Transcription
1 Supplemental material Diversity of O-antigen repeat-unit structures can account for the substantial sequence variation of Wzx translocases Yaoqin Hong and Peter R. Reeves School of Molecular Bioscience, The University of Sydney, NSW 2006 Australia Corresponding author For correspondence Telephone:
2 Table S1. The oligonucleotides used for clonings in this study. Primer DNA sequence 5' to 3' * Description 6827 TAT CCA TGG TAT ATA TAA TAA TC Forward primer for wbbl cloning, consists of 3b dummy sequence, the NcoI site, and 18b priming sequence homologous to the start of wbbl CTG GGA TCC TTA TAT TAC GGG TGA AAA Reverse primer for wbbl cloning, consists of 3b dummy sequence, the BamHI site, and 18b priming sequence homologous to the end of wbbl TAT CCATGG AA ATG AAT ACG AAT AAA TTA TCT Forward primer for wzx O16 cloning, consists of 3b dummy sequence, the NcoI site, and 18b priming sequence homologous to the start of wzx O GTA AGT CTG CAG CAA CAA TGA TAT AAT CGT Reverse primer for wzx O16 cloning, consists of 6b dummy sequence, the PstI site, and 18b priming sequence homologous to the end of wzx O16. * Note that the restriction sites are in Bold and the homology regions are Underlined.
3 Table S2. The oligonucleotides used for strain constructions in this study. Primer DNA sequence 5 to 3 Description 6872F AAG ATC CCC TCA CGC TGC CGC Primer pair designed to amplify the kan gene from pkd4, 6873R 6900F 6874R 6901F 6877R 6787F 6875R 6840F 6878R 6781F 6876R 6841F 6879R 6797F 6873R AAC AAA CCA GAA CCA ACA ATG ATA TAA TCG TAC ATA AAA TCC TCA GAA GAA CTC GTC AAG AAG ATT GCA TGA TGA ATA CGA ATA AAT TAT CTT TAA GAA GAA GCG GCA GCG TGA GGG GAT CTT TCA GCA AAC CAG TAA TTT ATT ATT GCA TGA TGG TAT TAA CAG TGA AAA AAA TTT TAG CGT TT GCG GCA GCG TGA GGG GAT CTT TCA ATA GAC ATT TTT CGC TCT ATT GCA TGA TGA ATA ACA AAC TAG CCA GGC A GCG GCA GCG TGA GGG GAT CTT TCA GTC CTT ATT TTT TAT GAG ATT GCA TGA TGA GCA TAA TAA AAA ATA GTG T GCG GCA GCG TGA GGG GAT CTT TTA GTT TTC ATA TAC AGA ACA ATT GCA TGA TGA TAA TAA ATA AAA TCA AAA A GCG GCA GCG TGA GGG GAT CTT TCA TCC TCT TAT ATT TAA CTG ATT GCA TGA TGA AAG TTC AAT TGT TAA AAA T GCG GCA GCG TGA GGG GAT CTT TTA TCC CTT ATT TGC CTT AAT ATT GCA TGA GTG TAG GCT GGA GCT GCT TC AAC AAA CCA GAA CCA ACA ATG ATA TAA TCG TAC ATA AAA TCC TCA GAA GAA CTC 6873R has 42b homologous to sequence just after wzx O16 in the O16 gene cluster Primer pair designed to amplify the wzx O16 gene from E.coli K-12 MG1655; 6900F has 42b homologous to sequence just before wzx O16 in the O16 gene cluster; 6874R has 21b homologous to the 6872F primer. 6900F/6873R are used to generate the wzx O16 -kan control knock in cassette using products of 6900F/6874R and 6872F/6873R. Primer pair designed to amplify the wzx O111 gene from E.coli O111; 6901F has 42b homologous to sequence just before wzx O16 in the O16 gene cluster; 6877R has 21b homologous to the 6872F primer. 6901F/6873R are used to generate the wzx O111 -kan knock in cassette using products of 6901F/6874R and 6872F/6873R. Primer pair designed to amplify the wzx O7 gene from E.coli O7; 6787F has 42b homologous to sequence just before wzx O16 in the O16 gene cluster; 6875R has 21b homologous to the 6872F primer. 6787F/6873R are used to generate the wzx O7 -kan knock in cassette using products of 6787F/6875R and 6872F/6873R. Primer pair designed to amplify the wzx SF2a gene from Shi. flexneri 2a; 6840F has 42b homologous to sequence just before wzx O16 in the O16 gene cluster; 6878R has 21b homologous to the 6872F primer. 6840F/6873R are used to generate the wzx Sf2a -kan knock in cassette using products of 6840F/6878R and 6872F/6873R. Primer pair designed to amplify the wzx O157 gene from E.coli O157; 6781F has 42b homologous to sequence just before wzx O16 in the O16 gene cluster; 6876R has 21b homologous to the 6872F primer. 6781F/6873R are used to generate the wzx O157 -kan knock in cassette using products of 6781F/6876R and 6872F/6873R. Primer pair designed to amplify the wzx SeLT2 gene from S. enterica LT2; 6841F has 42b homologous to sequence just before wzx O16 in the O16 gene cluster; 6879R has 21b homologous to the 6872F primer. 6841F/6873R are used to generate the wzx SeLT2 -kan knock in cassette using products of 6841F/6879R and 6872F/6873R. Primer pair designed to generate the recombination cassette for the replacement of the wzx O16 gene from E.coli K-12 MG1655 O-antigen gene cluster; 6797F has 42b homologous to sequence just before wzx O16 in the
4 GTC AAG AAG O16 gene cluster; 6873R has 42b homologous to sequence just after wzx O16 in the O16 gene cluster 6937F 6938R CCT TTA ATG GGA ATT AGC CAT GGT CC AAT AGA CAT TTT TCG CTC TAT TAA AAT AGA CAA AAG CTA CAT GTG TAG GCT GGA GCT GCT TCG AAG Primer pair designed to amplify the cat gene from pkd3; 6937F has 6b identical (in reverse direction) to the first 6b of 6935F; 6873R has 42b homologous to sequence just after wzx O111 in the E. coli O111 gene cluster in ppr F TGG TTT GGT TTT TCC TTC GTT ATA AAG GAG Primer pair designed to amplify ~ 250bp sequence just upstream of the wzx O111 gene in E. coli O111 (ppr2105); 6936R ATA TTC ATA TGG ACC ATG GCT AAT TCC 6936R has 42b homologous to sequence just after wzx O16 CAT TAA AGG CAC TCT ATT CGA AAT AGA in the O16 gene cluster. 6935F/6938R are used to GTG C generate a wzx O111 replacement cassette using products of 6935F/6936R and 6937F/6938R.
5 Table S3. Strains and plasmids used in this supplemental material. Strains Parent strain Strain genotype or plasmid description A Source/reference & plasmids Strains P5930 P5928 S. enterica group B serovar Typhimurium strain LT2,hsdL trp32 nml (1) flaa66, rpslxylt404 llve452 mete551 meta22 hsda gale wbav P9546 P5930 P5930, ppr2190 This study P5932 MG1655 MG1655, wzx O16 gene replaced by a kan gene This study P5946 P5937 MG1655, wzx O16 gene replaced by wzx O16 -kan, ppr2191 This study P5944 P5933 MG1655, wzx O16 gene replaced by wzx O7 -kan, ppr2191 This study P5947 P5938 MG1655, wzx O16 gene replaced by wzx O111 -kan, ppr2191 This study P5943 P5934 MG1655, wzx O16 gene replaced by wzx Sf2a -kan, ppr2191 This study P5953 P5942 MG1655, wzx O16 gene replaced by a kan gene, ppr2191, ppr2193 This study P5954 P5943 MG1655, wzx O16 gene replaced by wzx Sf2a -kan, ppr2191, ppr2193 This study P5955 P5944 MG1655, wzx O16 gene replaced by wzx O7 -kan, ppr2191, ppr2193 This study P5956 P5936 MG1655, wzx O16 gene replaced by wzx SeLT2 -kan, ppr2191, ppr2193 This study P5957 P5947 MG1655, wzx O16 gene replaced by wzx O111 -kan, ppr2191, ppr2193 This study P5958 P5952 MG1655, wzx O16 gene replaced by wzx O157 -kan, ppr2191, ppr2193 This study P5948 P5938 MG1655, wzx O16 gene replaced by wzx O111 -kan, ppr2192 This study P5949 P5937 MG1655, wzx O16 gene replaced by wzx O16 -kan, ppr2192 This study P5950 P5933 MG1655, wzx O16 gene replaced by wzx O7 -kan, ppr2192 This study P5951 P5934 MG1655, wzx O16 gene replaced by wzx Sf2a -kan, ppr2192 This study M2893 M388 S. enterica group D2 serovar Strasbourg, rpsl, gale (1) M2897 M2893 M2893, wzx D gene replaced by rpsl-kan (1) M2944 M2897 M2897, ppr2190 This study M2896 M2893 M2893, wbav gene replaced by rpsl-kan (1) M2950 M2896 M2896, ppr2190 This study M2820 M126 S. enterica group D1 serovar Dublin, gale wbav This study M2951 M2820 M2820, ppr2190 This study Plasmids ppr2190 ptrc99a (NcoI & BamHI) carrying the wzx D gene from S. enterica This study group D2 serovar Strasbourg, IPTG inducible, ampicilin resistant ppr2191 pwq572 (NcoI & BamHI) carrying the wbbl gene from E. coli This study ppr2192 K-12 strain WG1, which is controlled by tetracycline inducible P Tet promoter chloramphenicol resistant ppr691 carrying the E. coli O111 gene cluster with the wzx O111 gene replaced by a cat gene. Kanamycin and chloramphenicol resistance ppr2193 wzx O16 from E. coli K-12 cloned into pwq552 (NcoI & PstI), controlled by tetracycline inducible P Tet promoter, ampicillin resistance A. Genetic difference from the parent is underlined, including gene replacements and plasmid additions. This study This study
6 Fig. S1. The E. coli strain O16 variants with either a wzx gene for a non GlcNAc-initiated O antigen (wzx O157 and wzx SeLT2 ) or with no O-antigen wzx gene, produce small amounts of LPS with a single O16 repeat unit. A. Silver stained SDS-PAGE. B. The same set of LPS, with three times the loading for A, were run on a SDS-PAGE, and transferred to nitrocellulose membrane for immunoblotting with monospecific anti-e. coli O16 antibodies as described in (1). The immunoblot shows that the small amounts of material detected above the lipid A-core in strains with either a wzx gene for a non GlcNAc-initiated O antigen (lanes 2 and 3) or with no O-antigen wzx gene (lane 4), are LPS carrying a single O16 repeat unit, whereas the negative control LPS from MG1655 lacking the wbbl clone and so unable to produce O16 repeat units, gave no reaction to the anti-o16 antiserum (lane 5). It should be noted that the only O16 antiserum that is commercially available to us had been diluted for slide agglutination and gave a much weaker immunoblotting signal than expected, despite that almost all of the material was used in the single experiment.
7 Fig. S2. Comparison of Wzx O16 activity with those of Wzx O7, Wzx O111, and Wzx Sf2a, in translocation of the E. coli O16 repeat unit. The strains all have the ppr2191 (wbbl) plasmid for initiation of O16 antigen production. The extracted LPS samples were separated in 13% Tricine-SDS-PAGE gel and silver stained. For genetic details of strains used in this figure, see Table S3.
8 Fig. S3. The LPS profile of E. coli strain K-12 variants with different wzx genes after addition of the wzx O16 clone (ppr2193) to test for complementation. The extracted LPS samples were separated in 13% tricine SDS-PAGE and silver stained. For the genetic detail of strains used in this figure, see Table S3.
9 Fig. S4. A comparison of Wzx O111 activity with those of Wzx O16, Wzx O7, and Wzx Sf2a, for translocation of the E. coli O111 repeat unit. The plasmid, ppr2192 carrying the O111 gene cluster lacking the wzx O111 gene, is present in the strains examined for synthesis of O111 repeat units. The extracted LPS samples were separated in 13% Tricine-SDS-PAGE gel and stained by silver nitrate. For the genetic details of strains used in this figure, see Table S3.
10 Fig. S5. Effect of over-expression of the wzx D gene in wbav mutants of Salmonella enterica groups D2, B1 and D1, that produce repeat units lacking the side-branch tyvelose or abequose. B1, D2 and D1 wbav strains lack the side-branch dideoxyhexose that is normally present (1) and make very liitle long-chain O antigen as shown previously for groups B1 and D2 (1) (lanes 4, 6 and 8 respectively). Addition of a cloned wzx D gene (lanes 5, 7 and 9 respectively) restored wild-type O-antigen levels (lane 1). Note that the Wzx translocases from groups B1 and D2 are known not distinguish between abequose and tyvlose under these experimental conditions (1). The strains were grown according to Hong et al. (1), with IPTG (1mM final concentration) added at the same time as galactose addition. The extracted LPS samples were separated in 13% Tricine-SDS-PAGE gel and silver stained. For genetic details of strains used in this figure, see Table S3. Reference 1. Hong Y, Cunneen MM, Reeves PR The Wzx translocases for Salmonella enterica O-antigen processing have unexpected serotype specificity. Mol. Microbiol. 84:
Supplemental Data Supplemental Figure 1.
Supplemental Data Supplemental Figure 1. Silique arrangement in the wild-type, jhs, and complemented lines. Wild-type (WT) (A), the jhs1 mutant (B,C), and the jhs1 mutant complemented with JHS1 (Com) (D)
Supplementary. Table 1: Oligonucleotides and Plasmids. complementary to positions from 77 of the SRα '- GCT CTA GAG AAC TTG AAG TAC AGA CTG C
Supplementary Table 1: Oligonucleotides and Plasmids 913954 5'- GCT CTA GAG AAC TTG AAG TAC AGA CTG C 913955 5'- CCC AAG CTT ACA GTG TGG CCA TTC TGC TG 223396 5'- CGA CGC GTA CAG TGT GGC CAT TCT GCT G
Electronic Supplementary Information
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Dissecting binding of a β-barrel outer membrane
Lecture 10, 20/2/2002: The process of solution development - The CODEHOP strategy for automatic design of consensus-degenerate primers for PCR
Lecture 10, 20/2/2002: The process of solution development - The CODEHOP strategy for automatic design of consensus-degenerate primers for PCR 1 The problem We wish to clone a yet unknown gene from a known
Table S1. Bacterial strains (Related to Results and Experimental Procedures)
Table S1. Bacterial strains (Related to Results and Experimental Procedures) Strain number Relevant genotype Source or reference 1045 AB1157 Graham Walker (Donnelly and Walker, 1989) 2458 3084 (MG1655)
Figure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis
1 2 3 4 5 6 7 8 9 10 11 12 Figure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis Information Research). Exons
Arabidopsis actin depolymerizing factor AtADF4 mediates defense signal transduction triggered by the Pseudomonas syringae effector AvrPphB
Arabidopsis actin depolymerizing factor mediates defense signal transduction triggered by the Pseudomonas syringae effector AvrPphB Files in this Data Supplement: Supplemental Table S1 Supplemental Table
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/10/494/eaan6284/dc1 Supplementary Materials for Activation of master virulence regulator PhoP in acidic ph requires the Salmonella-specific protein UgtL Jeongjoon
Hes6. PPARα. PPARγ HNF4 CD36
SUPPLEMENTARY INFORMATION Supplementary Table Positions and Sequences of ChIP primers -63 AGGTCACTGCCA -79 AGGTCTGCTGTG Hes6-0067 GGGCAaAGTTCA ACOT -395 GGGGCAgAGTTCA PPARα -309 GGCTCAaAGTTCAaGTTCA CPTa
Supporting information for Biochemistry, 1995, 34(34), , DOI: /bi00034a013
Supporting information for Biochemistry, 1995, 34(34), 10807 10815, DOI: 10.1021/bi00034a013 LESNIK 10807-1081 Terms & Conditions Electronic Supporting Information files are available without a subscription
Supplemental Data. mir156-regulated SPL Transcription. Factors Define an Endogenous Flowering. Pathway in Arabidopsis thaliana
Cell, Volume 138 Supplemental Data mir156-regulated SPL Transcription Factors Define an Endogenous Flowering Pathway in Arabidopsis thaliana Jia-Wei Wang, Benjamin Czech, and Detlef Weigel Table S1. Interaction
PGRP negatively regulates NOD-mediated cytokine production in rainbow trout liver cells
Supplementary Information for: PGRP negatively regulates NOD-mediated cytokine production in rainbow trout liver cells Ju Hye Jang 1, Hyun Kim 2, Mi Jung Jang 2, Ju Hyun Cho 1,2,* 1 Research Institute
ΔPDD1 x ΔPDD1. ΔPDD1 x wild type. 70 kd Pdd1. Pdd3
Supplemental Fig. S1 ΔPDD1 x wild type ΔPDD1 x ΔPDD1 70 kd Pdd1 50 kd 37 kd Pdd3 Supplemental Fig. S1. ΔPDD1 strains express no detectable Pdd1 protein. Western blot analysis of whole-protein extracts
Quantitative reverse-transcription PCR. Transcript levels of flgs, flgr, flia and flha were
1 Supplemental methods 2 3 4 5 6 7 8 9 1 11 12 13 14 15 16 17 18 19 21 22 23 Quantitative reverse-transcription PCR. Transcript levels of flgs, flgr, flia and flha were monitored by quantitative reverse-transcription
Supplementary Figure 1A A404 Cells +/- Retinoic Acid
Supplementary Figure 1A A44 Cells +/- Retinoic Acid 1 1 H3 Lys4 di-methylation SM-actin VEC cfos (-) RA (+) RA 14 1 1 8 6 4 H3 Lys79 di-methylation SM-actin VEC cfos (-) RA (+) RA Supplementary Figure
Disease and selection in the human genome 3
Disease and selection in the human genome 3 Ka/Ks revisited Please sit in row K or forward RBFD: human populations, adaptation and immunity Neandertal Museum, Mettman Germany Sequence genome Measure expression
Materials Protein synthesis kit. This kit consists of 24 amino acids, 24 transfer RNAs, four messenger RNAs and one ribosome (see below).
Protein Synthesis Instructions The purpose of today s lab is to: Understand how a cell manufactures proteins from amino acids, using information stored in the genetic code. Assemble models of four very
Supporting Information
Supporting Information Table S1. Oligonucleotide sequences used in this work Oligo DNA A B C D CpG-A CpG-B CpG-C CpG-D Sequence 5 ACA TTC CTA AGT CTG AAA CAT TAC AGC TTG CTA CAC GAG AAG AGC CGC CAT AGT
SUPPORTING INFORMATION
SUPPORTING INFORMATION Investigation of the Biosynthesis of the Lasso Peptide Chaxapeptin Using an E. coli-based Production System Helena Martin-Gómez, Uwe Linne, Fernando Albericio, Judit Tulla-Puche,*
Multiplexing Genome-scale Engineering
Multiplexing Genome-scale Engineering Harris Wang, Ph.D. Department of Systems Biology Department of Pathology & Cell Biology http://wanglab.c2b2.columbia.edu Rise of Genomics An Expanding Toolbox Esvelt
Y-chromosomal haplogroup typing Using SBE reaction
Schematic of multiplex PCR followed by SBE reaction Multiplex PCR Exo SAP purification SBE reaction 5 A 3 ddatp ddgtp 3 T 5 A G 3 T 5 3 5 G C 5 3 3 C 5 ddttp ddctp 5 T 3 T C 3 A 5 3 A 5 5 C 3 3 G 5 3 G
Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC
Supplementary Appendixes Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC ACG TAG CTC CGG CTG GA-3 for vimentin, /5AmMC6/TCC CTC GCG CGT GGC TTC CGC
PCR analysis was performed to show the presence and the integrity of the var1csa and var-
Supplementary information: Methods: Table S1: Primer Name Nucleotide sequence (5-3 ) DBL3-F tcc ccg cgg agt gaa aca tca tgt gac tg DBL3-R gac tag ttt ctt tca ata aat cac tcg c DBL5-F cgc cct agg tgc ttc
Overexpression Normal expression Overexpression Normal expression. 26 (21.1%) N (%) P-value a N (%)
SUPPLEMENTARY TABLES Table S1. Alteration of ZNF322A protein expression levels in relation to clinicopathological parameters in 123 Asian and 74 Caucasian lung cancer patients. Asian patients Caucasian
NAME:... MODEL ANSWER... STUDENT NUMBER:... Maximum marks: 50. Internal Examiner: Hugh Murrell, Computer Science, UKZN
COMP710, Bioinformatics with Julia, Test One, Thursday the 20 th of April, 2017, 09h30-11h30 1 NAME:...... MODEL ANSWER... STUDENT NUMBER:...... Maximum marks: 50 Internal Examiner: Hugh Murrell, Computer
Supplemental Data. Bennett et al. (2010). Plant Cell /tpc
BRN1 ---------MSSSNGGVPPGFRFHPTDEELLHYYLKKKISYEKFEMEVIKEVDLNKIEPWDLQDRCKIGSTPQNEWYFFSHKDRKYPTGS 81 BRN2 --------MGSSSNGGVPPGFRFHPTDEELLHYYLKKKISYQKFEMEVIREVDLNKLEPWDLQERCKIGSTPQNEWYFFSHKDRKYPTGS 82 SMB
Supporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2006
Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2006 Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2006 Supporting Information for Expanding the Genetic
Cat. # Product Size DS130 DynaExpress TA PCR Cloning Kit (ptakn-2) 20 reactions Box 1 (-20 ) ptakn-2 Vector, linearized 20 µl (50 ng/µl) 1
Product Name: Kit Component TA PCR Cloning Kit (ptakn-2) Cat. # Product Size DS130 TA PCR Cloning Kit (ptakn-2) 20 reactions Box 1 (-20 ) ptakn-2 Vector, linearized 20 µl (50 ng/µl) 1 2 Ligation Buffer
II 0.95 DM2 (RPP1) DM3 (At3g61540) b
Table S2. F 2 Segregation Ratios at 16 C, Related to Figure 2 Cross n c Phenotype Model e 2 Locus A Locus B Normal F 1 -like Enhanced d Uk-1/Uk-3 149 64 36 49 DM2 (RPP1) DM1 (SSI4) a Bla-1/Hh-0 F 3 111
Dierks Supplementary Fig. S1
Dierks Supplementary Fig. S1 ITK SYK PH TH K42R wt K42R (kinase deficient) R29C E42K Y323F R29C E42K Y323F (reduced phospholipid binding) (enhanced phospholipid binding) (reduced Cbl binding) E42K Y323F
ORFs and genes. Please sit in row K or forward
ORFs and genes Please sit in row K or forward https://www.flickr.com/photos/teseum/3231682806/in/photostream/ Question: why do some strains of Vibrio cause cholera and others don t? Methods Mechanisms
Supplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR
Supplemental Dataset Supplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. DNA sequence Amino acid sequence WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR Allele 1 CCTGTC------------------GATAGC
S4B fluorescence (AU)
A S4B fluorescence (AU) S4B fluorescence (AU) dsbb csgba csgd dsbb csgba bcsa 5000 * NS NS 4000 * 3000 2000 1000 0 ΔcsgBAΔbcsA ΔcsgDΔdsbBΔbcsA ΔcsgBA ΔdsbBΔcsgBA ΔcsgDΔdsbB B -1000 4000 * * NS 3500 * 3000
Supporting Online Information
Supporting Online Information Isolation of Human Genomic DNA Sequences with Expanded Nucleobase Selectivity Preeti Rathi, Sara Maurer, Grzegorz Kubik and Daniel Summerer* Department of Chemistry and Chemical
Supplementary Information. Construction of Lasso Peptide Fusion Proteins
Supplementary Information Construction of Lasso Peptide Fusion Proteins Chuhan Zong 1, Mikhail O. Maksimov 2, A. James Link 2,3 * Departments of 1 Chemistry, 2 Chemical and Biological Engineering, and
strain devoid of the aox1 gene [1]. Thus, the identification of AOX1 in the intracellular
![strain devoid of the aox1 gene [1]. Thus, the identification of AOX1 in the intracellular](/thumbs/72/66361212.jpg "strain devoid of the aox1 gene [1]. Thus, the identification of AOX1 in the intracellular")
Additional file 2 Identification of AOX1 in P. pastoris GS115 with a Mut s phenotype Results and Discussion The HBsAg producing strain was originally identified as a Mut s (methanol utilization slow) strain
Gene synthesis by circular assembly amplification
Gene synthesis by circular assembly amplification Duhee Bang & George M Church Supplementary figures and text: Supplementary Figure 1. Dpo4 gene (1.05kb) construction by various methods. Supplementary
SUPPLEMENTAL TABLE S1. Additional descriptions of plasmid constructions and the oligonucleotides used Plasmid or Oligonucleotide
SUPPLEMENTAL TABLE S1. Additional descriptions of plasmid constructions and the oligonucleotides used Plasmid or Oligonucleotide former/ working Description a designation Plasmids pes213a b pes213-tn5
Converting rabbit hybridoma into recombinant antibodies with effective transient production in an optimized human expression system
Converting rabbit hybridoma into recombinant antibodies with effective transient production in an optimized human expression system Dr. Tim Welsink Molecular Biology Transient Gene Expression OUTLINE Short
RPA-AB RPA-C Supplemental Figure S1: SDS-PAGE stained with Coomassie Blue after protein purification.
RPA-AB RPA-C (a) (b) (c) (d) (e) (f) Supplemental Figure S: SDS-PAGE stained with Coomassie Blue after protein purification. (a) RPA; (b) RPA-AB; (c) RPA-CDE; (d) RPA-CDE core; (e) RPA-DE; and (f) RPA-C
Legends for supplementary figures 1-3
High throughput resistance profiling of Plasmodium falciparum infections based on custom dual indexing and Illumina next generation sequencing-technology Sidsel Nag 1,2 *, Marlene D. Dalgaard 3, Poul-Erik
Supplemental Table 1. Primers used for PCR.
Supplemental Table 1. Primers used for PCR. Gene Type Primer Sequence Genotyping and semi-quantitative RT-PCR F 5 -TTG CCC GAT CAC CAT CTG TA-3 rwa1-1 R 5 -TGT AGC GAT CAA GGC CTG ATC TAA-3 LB 5 -TAG CAT
evaluated with UAS CLB eliciting UAS CIT -N Libraries increase in the
Supplementary Figures Supplementary Figure 1: Promoter scaffold library assemblies. Many ensembless of libraries were evaluated in this work. As a legend, the box outline color in top half of the figure
hcd1tg/hj1tg/ ApoE-/- hcd1tg/hj1tg/ ApoE+/+
ApoE+/+ ApoE-/- ApoE-/- H&E (1x) Supplementary Figure 1. No obvious pathology is observed in the colon of diseased ApoE-/me. Colon samples were fixed in 1% formalin and laid out in Swiss rolls for paraffin
Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH).
Bisulfite Treatment of DNA Dilute DNA sample to 2µg DNA in 50µl ddh 2 O. Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH). Incubate in a 37ºC water bath for 30 minutes. To 55µl samples
Primer Design Workshop. École d'été en géné-que des champignons 2012 Dr. Will Hintz University of Victoria
Primer Design Workshop École d'été en géné-que des champignons 2012 Dr. Will Hintz University of Victoria Scenario You have discovered the presence of a novel endophy5c organism living inside the cells
Project 07/111 Final Report October 31, Project Title: Cloning and expression of porcine complement C3d for enhanced vaccines
Project 07/111 Final Report October 31, 2007. Project Title: Cloning and expression of porcine complement C3d for enhanced vaccines Project Leader: Dr Douglas C. Hodgins (519-824-4120 Ex 54758, fax 519-824-5930)
Supplemental Information. Human Senataxin Resolves RNA/DNA Hybrids. Formed at Transcriptional Pause Sites. to Promote Xrn2-Dependent Termination
Supplemental Information Molecular Cell, Volume 42 Human Senataxin Resolves RNA/DNA Hybrids Formed at Transcriptional Pause Sites to Promote Xrn2-Dependent Termination Konstantina Skourti-Stathaki, Nicholas
Search for and Analysis of Single Nucleotide Polymorphisms (SNPs) in Rice (Oryza sativa, Oryza rufipogon) and Establishment of SNP Markers
DNA Research 9, 163 171 (2002) Search for and Analysis of Single Nucleotide Polymorphisms (SNPs) in Rice (Oryza sativa, Oryza rufipogon) and Establishment of SNP Markers Shinobu Nasu, Junko Suzuki, Rieko
Lecture 11: Gene Prediction
Lecture 11: Gene Prediction Study Chapter 6.11-6.14 1 Gene: A sequence of nucleotides coding for protein Gene Prediction Problem: Determine the beginning and end positions of genes in a genome Where are
MacBlunt PCR Cloning Kit Manual
MacBlunt PCR Cloning Kit Manual Shipping and Storage MacBlunt PCR Cloning Kits are shipped on dry ice. Each kit contains a box with cloning reagents and an attached bag with Eco-Blue Competent Cells (optional).
Supplementary Figures
Supplementary Figures Supplementary Fig. 1 Characterization of GSCs. a. Immunostaining of primary GSC spheres from GSC lines. Nestin (neural progenitor marker, red), TLX (green). Merged images of nestin,
SAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer
TEACHER S GUIDE SAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer SYNOPSIS This activity uses the metaphor of decoding a secret message for the Protein Synthesis process. Students teach themselves
Supporting Information
Supporting Information Barderas et al. 10.1073/pnas.0801221105 SI Text: Docking of gastrin to Constructed scfv Models Interactive predocking of the 4-WL-5 motif into the central pocket observed in the
Supplemental Information. Target-Mediated Protection of Endogenous. MicroRNAs in C. elegans. Inventory of Supplementary Information
Developmental Cell, Volume 20 Supplemental Information Target-Mediated Protection of Endogenous MicroRNAs in C. elegans Saibal Chatterjee, Monika Fasler, Ingo Büssing, and Helge Großhans Inventory of Supplementary
A Genetically Encoded Toolbox for Glycocalyx Engineering: Tunable Control of Cell Adhesion,
TITLE A Genetically Encoded Toolbox for Glycocalyx Engineering: Tunable Control of Cell Adhesion, Survival, and Cancer Cell Behaviors AUTHORS Carolyn R. Shurer *, Marshall J. Colville *, Vivek K. Gupta,
2
1 2 3 4 5 6 7 Supplemental Table 1. Magnaporthe oryzae strains generated in this study. Strain background Genotype Strain name Description Guy-11 H1:RFP H1:RFP Strain expressing Histone H1- encoding gene
Table S1. Sequences of mutagenesis primers used to create altered rdpa- and sdpa genes
Supplementary Table and Figures for Structural Basis for the Enantiospecificities of R- and S-Specific Phenoxypropionate/α-Ketoglutarate Dioxygenases by Tina A. Müller, Maria I. Zavodszky, Michael Feig,
G+C content. 1 Introduction. 2 Chromosomes Topology & Counts. 3 Genome size. 4 Replichores and gene orientation. 5 Chirochores.
1 Introduction 2 Chromosomes Topology & Counts 3 Genome size 4 Replichores and gene orientation 5 Chirochores 6 7 Codon usage 121 marc.bailly-bechet@univ-lyon1.fr Bacterial genome structures Introduction
Complexity of the Ruminococcus flavefaciens FD-1 cellulosome reflects an expansion of family-related protein-protein interactions
Complexity of the Ruminococcus flavefaciens FD-1 cellulosome reflects an expansion of family-related protein-protein interactions Vered Israeli-Ruimy 1,*, Pedro Bule 2,*, Sadanari Jindou 3, Bareket Dassa
SUPPLEMENTARY INFORMATION
doi: 10.1038/nature07182 SUPPLEMENTAL FIGURES AND TABLES Fig. S1. myf5-expressing cells give rise to brown fat depots and skeletal muscle (a) Perirenal BAT from control (cre negative) and myf5-cre:r26r3-yfp
SUPPLEMENTARY MATERIALS AND METHODS. E. coli strains, plasmids, and growth conditions. Escherichia coli strain P90C (1)
SUPPLEMENTARY MATERIALS AND METHODS E. coli strains, plasmids, and growth conditions. Escherichia coli strain P90C (1) dinb::kan (lab stock) derivative was used as wild-type. MG1655 alka tag dinb (2) is
Supplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of
Supplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of the cell line) were immunostained for HA, acetylated
MCB421 FALL2005 EXAM#3 ANSWERS Page 1 of 12. ANSWER: Both transposon types form small duplications of adjacent host DNA sequences.
Page 1 of 12 (10pts) 1. There are two mechanisms for transposition used by bacterial transposable elements: replicative (Tn3) and non-replicative (Tn5 and Tn10). Compare and contrast the two mechanisms
11th Meeting of the Science Working Group. Lima, Peru, October 2012 SWG-11-JM-11
11th Meeting of the Science Working Group Lima, Peru, 15-19 October 2012 Russian population genetics studies of jack mackerel in the South Pacific P.K.Afanasiev M.A.Rabchun A.I.Glubokov Introduction. In
for Programmed Chemo-enzymatic Synthesis of Antigenic Oligosaccharides
Supporting Information Design of α-transglucosidases of Controlled Specificity for Programmed Chemo-enzymatic Synthesis of Antigenic Oligosaccharides Elise Champion ±,,,, Isabelle André ±,,, Claire Moulis
Det matematisk-naturvitenskapelige fakultet
UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam: Friday
Engineering Escherichia coli for production of functionalized terpenoids using plant P450s
Supplementary Information for Engineering Escherichia coli for production of functionalized terpenoids using plant P450s Michelle C. Y. Chang, Rachel A. Eachus, William Trieu, Dae-Kyun Ro, and Jay D. Keasling*
Homework. A bit about the nature of the atoms of interest. Project. The role of electronega<vity
Homework Why cited articles are especially useful. citeulike science citation index When cutting and pasting less is more. Project Your protein: I will mail these out this weekend If you haven t gotten
PCR-based Markers and Cut Flower Longevity in Carnation
PCRbased Markers and Cut Flower Longevity in Carnation Laura De Benedetti, Luca Braglia, Simona Bruna, Gianluca Burchi *, Antonio Mercuri and Tito Schiva Istituto Sperimentale per la Floricoltura, Corso
Supporting Information
Supporting Information Transfection of DNA Cages into Mammalian Cells Email: a.turberfield@physics.ox.ac.uk Table of Contents Supporting Figure 1 DNA tetrahedra used in transfection experiments 2 Supporting
SUPPLEMENTAL MATERIAL GENOTYPING WITH MULTIPLEXING TARGETED RESEQUENCING
SUPPLEMENTAL MATERIAL GENOTYPING WITH MULTIPLEXING TARGETED RESEQUENCING All of the patients and control subjects were sequenced and genotyped in the same way. Shotgun libraries of approximately 250 bp
Supplementary Methods Quantitative RT-PCR. For mrna, total RNA was prepared using TRIzol reagent (Invitrogen) and genomic DNA was eliminated with TURB
Supplementary Methods Quantitative RT-PCR. For mrna, total RNA was prepared using TRIzol reagent (Invitrogen) and genomic DNA was eliminated with TURBO DNA-free Kit (Ambion). One µg of total RNA was reverse
Lecture 19A. DNA computing
Lecture 19A. DNA computing What exactly is DNA (deoxyribonucleic acid)? DNA is the material that contains codes for the many physical characteristics of every living creature. Your cells use different
Appendix 1a. Microsatellite analysis of P1-hyg, P2-neo and their. Amplified cdna (base pairs) P1-hyg P2-neo All progeny A A
Supplementary information Appendix 1a. Microsatellite analysis of P1-hyg, P2-neo and their double drug resistant progeny (ABI 377). Primer set a,b Amplified cdna (base pairs) P1-hyg P2-neo All progeny
SUPPORTING INFORMATION FILE
Intrinsic and extrinsic connections of Tet3 dioxygenase with CXXC zinc finger modules Nan Liu, Mengxi Wang, Wen Deng, Christine S. Schmidt, Weihua Qin, Heinrich Leonhardt and Fabio Spada Department of
Codon Bias with PRISM. 2IM24/25, Fall 2007
Codon Bias with PRISM 2IM24/25, Fall 2007 from RNA to protein mrna vs. trna aminoacid trna anticodon mrna codon codon-anticodon matching Watson-Crick base pairing A U and C G binding first two nucleotide
Anti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR
Supplementary Methods Antibodies Anti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR (Cat#2646), anti-igf1r (Cat#3018), anti-insr (Cat#3020), anti-akt (pan, Cat#4691), anti-phospho-akt
DNA sentences. How are proteins coded for by DNA? Materials. Teacher instructions. Student instructions. Reflection
DNA sentences How are proteins coded for by DNA? Deoxyribonucleic acid (DNA) is the molecule of life. DNA is one of the most recognizable nucleic acids, a double-stranded helix. The process by which DNA
Protein Structure Analysis
BINF 731 Protein Structure Analysis http://binf.gmu.edu/vaisman/binf731/ Iosif Vaisman COMPUTATIONAL BIOLOGY COMPUTATIONAL STRUCTURAL BIOLOGY COMPUTATIONAL MOLECULAR BIOLOGY BIOINFORMATICS STRUCTURAL BIOINFORMATICS
Supporting Information
upporting Information hiota et al..73/pnas.159218 I Materials and Methods Yeast trains. Yeast strains used in this study are described in Table 1. TOM22FLAG, a yeast haploid strain for expression of C-terminally
Yeast BioBrick Assembly (YBA)
Yeast BioBrick Assembly (YBA) Standardized method for vector assembly of BioBrick devices via homologous recombination in Saccharomyces cerevisiae Martin Schneider, Leonard Fresenborg, Virginia Schadeweg
Table S2. Oligonucleotide primers used to amplify pile and tcpa genes. Restriction endonuclease sites are underlined. Oligonucleotide Gene/ Sequence
The metal binding site Even though metals were not added to the crystallization mixture, a strong positive peak (56 sigma) in the fo fc electron density map clearly shows the tetrahedral coordination of
-15 diopter negative lenses in wild-type and homozygous CHRM2-deleted mice, and
Supplementary Materials Supplementary Figure 1: Myopia induction was performed using uniocular -10 and -15 diopter negative lenses in wild-type and homozygous CHRM2-deleted mice, and results at 2, 4 and
Supplemental Data. Distinct Pathways for snorna and mrna Termination
Molecular Cell, Volume 24 Supplemental Data Distinct Pathways for snorna and mrna Termination Minkyu Kim, Lidia Vasiljeva, Oliver J. Rando, Alexander Zhelkovsky, Claire Moore, and Stephen Buratowski A
Supplemental Figure 1 Real-time RT-PCR analysis of 16 genes other than those shown in Fig. 6C.
arbitrary At1g02813 unit expressed protein Relative mrna amount 5.0 4.0 3.0 (X3.7) (X118) (X1.7) 5.6% act At1g06990 GDSL-motif lipase 3.0 (X2.2) /hydrolase (X39) (X1.3) 2.8% act At1g23590 expressed protein
NESTED Sequence-based Typing (SBT) protocol for epidemiological typing of Legionella pneumophila directly from clinical samples
NESTED Sequence-based Typing (SBT) protocol for epidemiological typing of Legionella pneumophila directly from clinical samples VERSION 2.0 SUMMARY This procedure describes the use of nested Sequence-Based
Phosphate and R2D2 Restrict the Substrate Specificity of Dicer-2, an ATP- Driven Ribonuclease
Supplemental Information Molecular Cell, Volume 42 hosphate and R2D2 Restrict the Substrate Specificity of Dicer-2, an AT- Driven Ribonuclease Elif Sarinay Cenik, Ryuya Fukunaga, Gang Lu, Robert Dutcher,
The B1 Protein Guides the Biosynthesis of a Lasso Peptide
The B1 Protein Guides the Biosynthesis of a Lasso Peptide Shaozhou Zhu 1,2, Christopher D. Fage 1, Julian D. Hegemann 1, Andreas Mielcarek 1, Dushan Yan 1, Uwe Linne 1 & Mohamed A. Marahiel*,1 1 Department
Supplementary Information
Supplementary Information A general solution for opening double-stranded DNA for isothermal amplification Gangyi Chen, Juan Dong, Yi Yuan, Na Li, Xin Huang, Xin Cui* and Zhuo Tang* Supplementary Materials
FAT10 and NUB1L bind the VWA domain of Rpn10 and Rpn1 to enable proteasome-mediated proteolysis
SUPPLEMENTARY INFORMATION FAT10 and NUB1L bind the VWA domain of Rpn10 and Rpn1 to enable proteasome-mediated proteolysis Neha Rani, Annette Aichem, Gunter Schmidtke, Stefan Kreft, and Marcus Groettrup
Supplementary Figure 1. The level of pri-mir-8 gradually decreases while those of BR-C and E74 increase during 3rd instar larval development.
qrt-pcr RT-PCR Relative pri-mir-8 level 1.2 1.0 0.8 0.6 0.4 0.2 0.0 Early 3rd (72h) Mid 3rd (96h) Late 3rd (119h) BR-C E74 mtl rrna Early 3rd (72h) Mid 3rd (96h) Late 3rd (119h) Supplementary Figure 1.
CHE-3H84: Protein Engineering Past Exam Papers
CHE-3H84: Protein Engineering Past Exam Papers Sorted by Topic then Year Knowledge-Based Engineering of Proteins, Large Scale Production of Recombinant Proteins, and Protein Purification Dr. Hemmings 2006/7
Supplemental Data. Jones et al. Plant Cell. (2010) /tpc
IAA synthesis rate Supplemental Data. Jones et al. Plant Cell. ()..5/tpc..7856 Supplemental Figure. Root tip specific IAA biosynthesis after induction of the CKX gene. 6 DAG pmdc7:atckx seedling roots
Supporting Information. Trifluoroacetophenone-Linked Nucleotides and DNA for Studying of DNA-protein Interactions by 19 F NMR Spectroscopy
Supporting Information Trifluoroacetophenone-Linked Nucleotides and DNA for Studying of DNA-protein Interactions by 19 F NMR Spectroscopy Agata Olszewska, Radek Pohl and Michal Hocek # * Institute of Organic
Supporting Information. Table of Contents
Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2015 Supporting Information Spatial Regulation of a Common Precursor from Two Distinct Genes
Supplementary Material and Methods
Supplementary Material and Methods Synaptosomes preparation and RT-PCR analysis. Synaptoneurosome fractions were prepared as previously described in 1. Briefly, rat total brain was homogenized in ice-cold
7.03 Problem Set 3 Due before 5 PM on Wednesday, October 18 Hand in answers in recitation section or in the box outside of
7.03 Problem Set 3 Due before 5 PM on Wednesday, October 18 Hand in answers in recitation section or in the box outside of 68-120 1. The following DNA sequence fragment comes from the middle of a bacterial
An engineered tryptophan zipper-type peptide as a molecular recognition scaffold
SUPPLEMENTARY MATERIAL An engineered tryptophan zipper-type peptide as a molecular recognition scaffold Zihao Cheng and Robert E. Campbell* Supplementary Methods Library construction for FRET-based screening
SUPPLEMENTARY INFORMATION
doi:1.138/nature11496 Cl. 8 Cl. E93 Rag1 -/- 3H9 + BM Rag1 -/- BM CD CD c-kit c-kit c-kit wt Spleen c-kit B22 B22 IgM IgM IgM Supplementary Figure 1. FACS analysis of single-cell-derived pre-b cell clones.