Thermo Scientific Dharmacon Accell sirna A new world of RNAi discovery

Size: px
Start display at page:

Download "Thermo Scientific Dharmacon Accell sirna A new world of RNAi discovery"

Transcription

1 Thermo Scientific Dharmacon sirna A new world of RNAi discovery Delivery to any cell type without transfection reagents or viral vectors Extraordinary ease-of-use for rapid results Expert designs and modifications for specific target silencing

2 sirna delivery into any cell type empowers RNAi innovation RNAi research no longer is constrained by cell types that are resistant to conventional lipid-based delivery reagents. Thermo Scientific Dharmacon sirna provides delivery into any cell type for unprecedented experimental flexibility and discovery. Effective delivery with no transfection reagent or viral vector required Novel sirna modifications for uptake, stability, and specificity Proven performance in primary, differentiated, and other difficult-to-transfect cell types delivery into any cell type Efficient delivery of Dharmacon Red sirna to SH-SY5Y and MCF-7 cells Dharmacon sirna provides reproducible, reliable results across cell lines Uptake of sirna confirmed by fluorescence microscopy. SH-SY5Y (top panel) and MCF-7 cells (lower panel) were treated with Red Cyclophilin B Control sirna in delivery media. (Red fluorescence = Cytoplasmic localization of sirna; Blue = Nuclear Hoechst dye). HEK293 FKHR-U2OS HeLa S3 LAN-5 HuVEC MCF-a SH-SY5Y SKOV3 THP- MK2-U2OS HuH-7 T Cells Jurkat IMR-32 mes-d3 mc2c2 mprihepat m3t3l Control Dharmacon sirna has delivered effective knockdown in every cell type tested to date Human Suspension Cells Human Differentiated Stem Cells Human, Mouse, and Rat Primary Cells Other Mouse and Rat Cells Human Adherent Cells Jurkat THP- IM-9 Osteoblasts and adipocytes derived from hmsc HUVEC HUASMC hmsc PBMC Primary human astrocytes Primary human T cells Primary human keratinocytes Primary mouse hepatocytes Primary rat cortical neurons Primary rat striatum neurons 3T3 NIH ES-D3 3T3 L Rat2 C2C2 H9c2 PC-2 SH-SY5Y IMR32 LAN5 A-375 HeLa HeLa S3 LNCap MCF-A 293T MCF-7 SK-BR3 OVCAR-3 Huh7 GTM-3 DU45 HT8 DLD- HepG2 U2OS HEK293 U87MG MIA PaCa-2 NCI/ADR-RES

3 Extraordinary ease-of-use for rapid, high confidence results Dharmacon sirna reagents are specially modified for uptake by any cell type without a separate delivery reagent - no complexing wait time, no wash steps. Simply combine Dharmacon sirna with optimized sirna delivery media* and add directly to cells. Achieve faster time-to-results with a two-step delivery protocol Enjoy long-term reproducibility with delivery mix stability of up to 9 months at 4ºC Simplify RNAi delivery conditions with a single, validated delivery media formulation* ease-of-use A simple delivery protocol with Dharmacon sirna makes targeted gene knockdown effortless sirna reagents deliver effective knockdown without cytotoxicity. Eighteen cell lines were treated with Cyclophilin B sirna in delivery media and assayed for knockdown at 72 hours. mrna expression was determined by QuantiGene branched DNA assay (Panomics) and cell viability was determined by alamarblue (Biosource International). sirna (stock solution) delivery mix ( sirna) 2 sirna delivery media * sirna should always be used with delivery media (Cat# B-5). This is a serumfree media specially formulated and optimized for use with sirna. It has undergone thorough testing and successful validation in over 4 cell lines A B C D E F G H 2 Combine sirna and delivery media Add delivery mix directly to cells and incubate 72 hours

4 Accelerate time to results and leave lengthy delivery optimization behind Dharmacon sirna reagents eliminate the need for complicated delivery optimization by consistently providing effective sirna delivery and knockdown at an unprecedented range of experimental conditions. In addition to simplifying single-gene silencing experiments, Dharmacon sirna lends itself to high-confidence screening with higher reproducibility. Save time and money by eliminating transfection reagents Reduce the need for cell type-specific delivery protocols Expand assay possibilities with more cell types and broader RNAi conditions accelerate time to results Narrow windows of optimization hinder reproducibility. MK2-U2OS (Thermo Scientific BioImage) cells were transfected with nm sigenome Cyclophilin B Control sirna with three concentrations of Thermo Scientific DharmaFECT Transfection Reagent across three cell densities and assayed at 24 hours post-transfection. Dharmacon sirna application is superior to lipid transfection at a wide range of conditions Lipid optimization.5 µl µl. µl µl.2 µl µl Untreatedted.5 5 µl µl. µl µl.2 2 µl µl Untreated ted.5 5 µl µl 5K K 2K Dharmacon application. µl µl.22 µl µl Untreatedted Boxed areas indicate optimal conditions - cellular viability greater than 75% and target gene knockdown greater than 75%. Broad windows of optimization provide experimental flexibility and high confidence results. MK2-U2OS cells were treated with.,.5, and Cyclophiln B Control sirna across three cell densities and assayed at 72 hours post-transfection Cyclophilin B expression was determined by QuantiGene branched DNA assay (Panomics) and cell viability was determined by alamarblue (Biosource International)..5. Untreated ted Untreatedted 5K K 2K Untreated Untreatedted

5 Novel delivery causes minimal cellular perturbation for unmatched clarity of results Imagine your results free from the toxicity and inflammatory response typically associated with conventional lipid transfection reagents. The passive nature of Dharmacon sirna uptake avoids adverse cellular responses that could interfere with analysis of target gene knockdown. This new paradigm for sirna delivery offers: No detectable inflammatory response Sustained viability at a range of cellular densities Elimination of non-specific lipid effects for pure silencing results clarity of results Reduce off-targets and delivery effects with Dharmacon sirna --X 4X Scale: Scale + 4X +X 5 DBI PPIB LMNA 3 HIFA RB RHOA RAC CDC A RN cce A ll #4 A de cc l e m iver ll ed y ia si si A RN cce A ll #3 si Ac RN ce A ll #2 si Ac RN ce A ll # on e 2 al pi d sirna μm working concentration induces little to no off-target effects. Total RNA from HeLa cells treated with SMARTpool reagents targeting different genes was measured by microarray analysis (Agilent Whole Genome Array, 4 x 44K format). The number of offtargets (showing 2-fold or more downregulation) are indicated. CDK4 Li # of Off-target Genes MET IL-8 ProteinExpression (pg/ml) Target Knockdown Dharmacon sirna delivery does not induce expression of the IL-8 inflammatory protein HeLa S3 cells were treated with either lipid alone (DharmaFECT transfection reagent), sirna (either #, 2, 3 or 4) targeting diazepam binding inhibitor or delivery media alone. 72 hours after transfection, the cellular supernatant was analyzed for the cytokine IL-8 and eight other interferon response genes (IL-α, IL-β, IL-2, IL-6, IL-, IL-2p7, IFNγ, TNFα) using the SearchLight array platform.

6 Dharmacon sirna delivers a proven silencing strategy Dharmacon sirna provides specific knockdown of your target gene by combining SMARTpool technology - recognized to enhance overall functionality and specificity - with additional proven strategies: Validated SMARTselection sirna design algorithm for effective silencing Seed region filters for toxic and mirna-like motifs along with seed frequency analysis to eliminate designs with high likelihood of off-target silencing Specificity-enhancing modifications on both strands to reduce off-target effects proven silencing strategy Dharmacon sirna reagents successfully silence target genes across cell types 2 Achieve effective target knockdown across cell types. HeLa S3, Rat-2, 3T3L, Jurkat, THP-, NHA, and SH-SY5Y cells were treated with μm SMARTpool sirna targeting various genes or Non-targeting control (NTC) and assayed for knockdown at 72 hours mrna expression was determined by QuantiGene branched DNA assay (Panomics) and cell viability was determined by alamarblue (Biosource International). LMNA CDC2 TP53 AKT RB HRI MET DBI rppib rgapdh mgapdh mppib PTPN RhoA Csk RhoA PPIB RhoA PPIB CDC2 TP53 AKT RB HRI DBI RAC RhoA SRC NTC Untreated HeLa S3 Rat-2 3T3 L Jurkat THP- NHA SH-SY5Y Controls egfp expression silenced by Dharmacon sirna FKHR-U2OS cells (BioImage) were treated with μm egfp Control sirna or Non-targeting Control sirna # in delivery media. Reduction of egfp expression is visualized using Cellomics ArrayScan V TI (green= GFP expression; blue= nuclear Hoechst dye). Delivery Media Only egfp Control sirna Non-targeting Control sirna #

7 New delivery technology. New possibilities. A new world of RNAi is waiting. The passive nature of Dharmacon sirna uptake lends itself to gene silencing applications not possible with other delivery techniques: Repeated dosing for extended duration knockdown - useful for study of long-lived proteins and downstream cellular responses Transient silencing of multiple genes with multiplex delivery Combinatorial approaches to silence in cells stably transduced using SMARTvector shrna technology new possibilities Demonstration of extended duration silencing with continuous dosing of Dharmacon sirna HeLa and SH-SY5Y cells were treated with Cyclophilin B Control sirna at multiple intervals for sustained target knockdown. HeLa cells showed sustained knockdown for 3 days (9 passages), SH-SY5Y for 2 days (5 passages). At each passage, cells were split and cultured in the delivery mix. Target knockdown was reassessed at 24 (HeLa) or 48 hr (SH-SY5Y) intervals following each sirna treatment. Day 3 Day 7 Day Day 5 Day 9 Day 3 Day 7 Day Day 5 Day 9 Day 2 Day 6 Day Day 4 Day 8 Day 22 Day 26 Day 3 Day 2 Day 6 Day Day 4 Day 8 Day 22 Day 26 Day 3 PPIB sirna SH-SY5Y NTC sirna PPIB sirna HeLa NTC sirna mrna expression was determined by QuantiGene bdna assay (Panomics) and cell viability was determined by alamarblue (Biosource International, Inc). Get started at Predesigned Dharmacon sirna reagents Dharmacon sirna delivery media Dharmacon RNAi controls Dharmacon sirna libraries Simply search for your human, mouse, or rat gene and click to order Optimized for use with Dharmacon sirna to virtually eliminate delivery optimization Validated positive controls for Cyclophilin B, GAPD, and egfp, and non-targeting negative controls for high confidence results Check our website for a growing list of available gene collections

8 Thermo Scientific Dharmacon sirna Contact Information North America 265 Crescent Dr., Suite Lafayette, CO 826 Toll free: Tel: Fax: Belgium & distributors Industriezone III Industrielaan Erembodegem Tel: Fax: France BP Brebières Tel: Fax: The Netherlands Postbus AA Etten-Leur Tel: Fax: Germany Adenauerallee Bonn Tel: Fax: United Kingdom Unit 9 Atley Way, North Nelson Industrial Estate Cramlington, Northumberland NE23 WA Tel: Fax: Switzerland Place Pépinet 2 Lausanne Tel: Fax: US web: Euro web: US dharmacon.lab@thermofisher.com Euro perbio.eurotech@thermofisher.com. 28 Thermo Fisher Scientific Inc. All rights reserved. QuantiGene is a trademark of Bayer. alamarblue is a trademark of Accumed International, Inc. All other trademarks are the property of Thermo Fisher Scientific Inc. and its subsidiaries. US Literature # 66-7-K--U Euro Literature # PB 27 75

Thermo Scientific Dharmacon SMARTvector 2.0 Lentiviral shrna Particles

Thermo Scientific Dharmacon SMARTvector 2.0 Lentiviral shrna Particles Thermo Scientific Dharmacon SMARTvector 2.0 Lentiviral shrna Particles Long-term gene silencing shrna-specific design algorithm High titer, purified particles Thermo Scientific Dharmacon SMARTvector shrna

More information

Thermo Scientific DharmaFECT Transfection Reagents sirna Transfection Protocol

Thermo Scientific DharmaFECT Transfection Reagents sirna Transfection Protocol Protocol Thermo Scientific Transfection Reagents sirna Transfection Protocol The following is a general protocol for use of Thermo Scientific transfection reagents to deliver sirna into cultured mammalian

More information

Arrest-In Transfection Reagent Catalog numbers: ATR1740, ATR1741, ATR1742, ATR1743

Arrest-In Transfection Reagent Catalog numbers: ATR1740, ATR1741, ATR1742, ATR1743 Arrest-In Transfection Reagent Catalog numbers: ATR1740, ATR1741, ATR1742, ATR1743 Technical support: 1-888-412-2225 Page 1 Arrest-In Transfection Reagent Catalog numbers: ATR1740, ATR1741, ATR1742, ATR1743

More information

Product Quantity* Product No.

Product Quantity* Product No. Page 1 of 6 Lit.# ML015 Rev.7/04 TransIT-TKO Transfection Reagent Product Quantity* Product No. TransIT-TKO Transfection Reagent 0.4 ml MIR 2154 1 ml MIR 2150 5 ml (5 x 1 ml) MIR 2155 10 ml (10 x 1 ml)

More information

Nucleic Acid Transfection. Genomics. TransIT Transfection Tools. Technical tip D.103

Nucleic Acid Transfection. Genomics. TransIT Transfection Tools. Technical tip D.103 The nucleic acids delivery specialists design our transfection reagents. Our formulations provide superior transfection efficiency and cell viability. This complete range includes TransIT reagents, based

More information

Knockdown of ZFX by sirna in C42B

Knockdown of ZFX by sirna in C42B Knockdown of ZFX by sirna in C42B LY 20160606 Day 0: Cell Plating The cell density recommendation for LNCap is 1*10 4 in 96-well format (see table 2 in DharmaFECT Transfection Reagents protocol). Since

More information

Off-target effects: disturbing the silence of RNA interference (RNAi)

Off-target effects: disturbing the silence of RNA interference (RNAi) TECH NOTE Off-target effects: disturbing the silence of RNA interference (RNAi) Abstract Off-target effects occur when an is processed by the RNA-Induced Silencing Complex (RISC) and down-regulates unintended

More information

Convoy TM Transfection Reagent

Convoy TM Transfection Reagent Convoy TM Transfection Reagent Catalog No.11103 0.25ml (40-80 transfections in 35mm dishes) Catalog No.11105 0.5 ml (80-165 transfections in 35mm dishes) Catalog No.11110 1.0 ml (165-330 transfections

More information

Transfection Reagents That Really Work

Transfection Reagents That Really Work Transfection Reagents That Really Work non-toxic, biodegradable, highly efficient, serum-compatible Available for DNA,, protein, stem cells www.clontech.com/xf P L A S M I D T R A N S F E C T I O N R E

More information

Lullaby sirna Transfection Reagent - Results

Lullaby sirna Transfection Reagent - Results sirna Transfection Reagent - Results OZ Biosciences is delighted to announce the launching of a new sirna transfection reagent: -sirna. This lipid based transfection reagent is specifically designed for

More information

horizondiscovery.com p53 APPLICATION NOTE Žaklina Strezoska, Horizon Discovery, Lafayette, CO, USA Tamara Seredenina, Siena Biotech, Siena, Italy

horizondiscovery.com p53 APPLICATION NOTE Žaklina Strezoska, Horizon Discovery, Lafayette, CO, USA Tamara Seredenina, Siena Biotech, Siena, Italy APPLICATION NOTE Silencing of expression with Accell sirna causes inhibition of the DNA damage response in IMR-32 neuroblastoma cells and protects primary cortical neurons from β-amyloid toxicity Žaklina

More information

Product: Arrest-In TM Transfection Reagent for RNAi

Product: Arrest-In TM Transfection Reagent for RNAi Product: Arrest-In TM Transfection Reagent for RNAi Catalog #: ATR1740, ATR1741, ATR1742, ATR1743 Product Description Arrest-In transfection reagent is a proprietary polymeric formulation, developed and

More information

Please read the entire protocol carefully and proceed with the section(s) appropriate for the desired experiment.

Please read the entire protocol carefully and proceed with the section(s) appropriate for the desired experiment. Page 1 of 9 Lit.# ML044 Rev.5/18/05 TransIT -sipak Trial Kit Product Components Quantity Product No. TransIT -sipak Trial Kit TransIT -siquest Reagent* TransIT-TKO Reagent* *To re-order components separately,

More information

Ingenio Electroporation Kits and Solution

Ingenio Electroporation Kits and Solution Protocol for MIR 08, 09, 01, 0111, 0112, 0113, 0114, 011, 0116, 0117, 0118, 0119 Quick Reference Protocol, SDS and Certificate of Analysis available at mirusbio.com/0111 INTRODUCTION Ingenio Electroporation

More information

Ingenio Electroporation Kits and Solution

Ingenio Electroporation Kits and Solution Protocol for MIR 0111, 0112, 0113, 0114, 011, 0116, 0117, 0118, 0119 INTRODUCTION Ingenio Electroporation Kits and Solution provide a universal, high efficiency, low toxicity solution for electroporation

More information

Comparison of Commercial Transfection Reagents: Cell line optimized transfection kits for in vitro cancer research.

Comparison of Commercial Transfection Reagents: Cell line optimized transfection kits for in vitro cancer research. Comparison of Commercial Transfection Reagents: Cell line optimized transfection kits for in vitro cancer research. by Altogen Labs, 11200 Manchaca Road, Suite 203 Austin TX 78748 USA Tel. (512) 433-6177

More information

long noncoding RNA Knockdown and detection of Thermo Scientific Lincode sirna and Solaris lncrna Expression Assays

long noncoding RNA Knockdown and detection of Thermo Scientific Lincode sirna and Solaris lncrna Expression Assays Thermo Scientific Lincode sirna and Solaris lncrna Expression Assays Knockdown and detection of long noncoding RNA C omprehensive pre-designed reagents for investigation of human lncrnas sirnas with enhanced

More information

siport Amine Transfection Agent

siport Amine Transfection Agent siport Amine Transfection Agent Polyamine-Based Transfection Agent Part Number AM4502, AM4503 A. Introduction siport Amine Polyamine-Based Transfection Agent is a proprietary blend of polyamines formulated

More information

DeliverX and DeliverX Plus sirna Transfection Kits

DeliverX and DeliverX Plus sirna Transfection Kits DeliverX and DeliverX Plus sirna Transfection Kits User Manual P/N 10586 Rev. C 06.09.16 DRAFT September 16, 2006 3:54 pm DeliverXTtile.fm Panomics, Inc. DeliverX and DeliverX Plus sirna Transfection Kit

More information

DeliverX and DeliverX Plus sirna Transfection Kits

DeliverX and DeliverX Plus sirna Transfection Kits DeliverX and DeliverX Plus sirna Transfection Kits User Manual P/N 10586.060504 Rev. A DRAFT May 4, 2006 4:41 pm DeliverXTtile.fm Panomics, Inc. DeliverX and DeliverX Plus sirna Transfection Kit User Manual

More information

CH_07_4C_QIAGEN_PG_2007.qxd :50 Uhr Seite 238 7Transfection QIAGEN Product Guide 2007

CH_07_4C_QIAGEN_PG_2007.qxd :50 Uhr Seite 238 7Transfection QIAGEN Product Guide 2007 7Transfection 238 www.qiagen.com QIAGEN Product Guide 2007 Transfection 7 Transfection www.qiagen.com/pg/transfectiontools 7.0 Transfection selection guide 240 7.1 sirna/mrna transfection Transfection

More information

FastLane Kits from Sample Direct to Result

FastLane Kits from Sample Direct to Result FastLane Kits from Sample Direct to Result New Sample & Assay Technologies Overview of FastLane technology Speed up and simplify your workflow FastLane Kits accelerate and streamline real-time RT-PCR analysis

More information

Xfect Protein Transfection Reagent

Xfect Protein Transfection Reagent Xfect Protein Transfection Reagent Mammalian Expression Systems Rapid, high-efficiency, low-toxicity protein transfection Transfect a large amount of active protein Virtually no cytotoxicity, unlike lipofection

More information

Certified. TransIT Broad Spectrum Transfection Reagents. TransIT-X2. TransIT -LT1. TransIT TransIT -mrna

Certified. TransIT Broad Spectrum Transfection Reagents. TransIT-X2. TransIT -LT1. TransIT TransIT -mrna Broad Spectrum Reagents For more than two decades Mirus Bio has been dedicated to developing reagents that feature high efficiency, low toxicity transfections. The products included in this piece are our

More information

THE DELIVERY EXPERTS. INTERFERin in vitro sirna transfection reagent PROTOCOL

THE DELIVERY EXPERTS. INTERFERin in vitro sirna transfection reagent PROTOCOL THE DELIVERY EXPERTS INTERFERin in vitro sirna transfection reagent PROTOCOL DESCRIPTION INTERFERin is a powerful sirna transfection reagent that ensures efficient gene silencing and reproducible transfection

More information

Product Name Catalog Number Size. Avalanche -Omni Transfection Reagent. Note: Avalanche is the trademark of EZ Biosystems. All right reserved

Product Name Catalog Number Size. Avalanche -Omni Transfection Reagent. Note: Avalanche is the trademark of EZ Biosystems. All right reserved Avalanche -Omni The Next Generation Transfection Reagent Powerful Versatile Gentle Avalanche -Omni Transfection Reagent is an exceptionally powerful and versatile next-generation DNA and sirna transfection

More information

SureSilencing sirna Array Technology Overview

SureSilencing sirna Array Technology Overview SureSilencing sirna Array Technology Overview Pathway-Focused sirna-based RNA Interference Topics to be Covered Who is SuperArray? Brief Introduction to RNA Interference Challenges Facing RNA Interference

More information

Sunma Biotech Co., Ltd. Sofast transfection reagent

Sunma Biotech Co., Ltd. Sofast transfection reagent Sunma Sofast Transfection Reagent Catalog No.11103 0.3ml (50-100 transfections in 35mm dishes) Catalog No.11105 0.5 ml (80-165 transfections in 35mm dishes) Catalog No.11110 1.0 ml (165-330 transfections

More information

Please read the entire protocol carefully and proceed with the section(s) appropriate for the desired experiment.

Please read the entire protocol carefully and proceed with the section(s) appropriate for the desired experiment. Page 1 of 11 Lit.# ML045 Rev.5/18/05 TransIT -sipak Plus Trial Kit Product Components Component No. Quantity TransIT -siquest Reagent* 2111 0.1 ml Product No. TransIT -sipak Plus Trial Kit TransIT-TKO

More information

sirna Transfection Into Primary Neurons Using Fuse-It-siRNA

sirna Transfection Into Primary Neurons Using Fuse-It-siRNA sirna Transfection Into Primary Neurons Using Fuse-It-siRNA This Application Note describes a protocol for sirna transfection into sensitive, primary cortical neurons using Fuse-It-siRNA. This innovative

More information

Performance of cell viability and cytotoxicity assays on the IN Cell Analyzer 3000

Performance of cell viability and cytotoxicity assays on the IN Cell Analyzer 3000 GE Healthcare Application Note 28-4070-51 AA IN Cell Analyzer 3000 Performance of cell viability and cytotoxicity assays on the IN Cell Analyzer 3000 Key words: cell-based assay viability cytotoxicity

More information

INTERFERin sirna transfection reagent

INTERFERin sirna transfection reagent INTERFERin in vitro sirna Transfection Protocol Company Information... 2 Product Information... 3 1. Standard sirna transfection of adherent cells... 4 (forward transfection)... 4 1.1 Cell seeding... 5

More information

Evaluation of RNA interference (RNAi) in Skin

Evaluation of RNA interference (RNAi) in Skin Evaluation of RNA interference (RNAi) in Skin Next Generation in RNAi Pamela A. Pavco VP Pharmaceutical Development 3rd International SCAR Club Meeting March 26, 2010 www.rxipharma.com Massachusetts, USA

More information

Si Silencing Duplex. Advanced molecule designed for next-generation applications of RNAi.

Si Silencing Duplex. Advanced molecule designed for next-generation applications of RNAi. SM Now improved with: Si 2 Purfect TRANSFECTION REAGENT PROTOCOL: 2 Si Silencing Duplex Advanced molecule designed for next-generation applications of RNAi. Greater Specificity of Suppression Reliable

More information

TRANSFEX - SUPERIOR GENE EXPRESSION FOR HARD-TO-TRANSFECT CELL TYPES. Kevin Grady Product Line Business Manager ASCB Vendor Showcase Dec.

TRANSFEX - SUPERIOR GENE EXPRESSION FOR HARD-TO-TRANSFECT CELL TYPES. Kevin Grady Product Line Business Manager ASCB Vendor Showcase Dec. TRANSFEX - SUPERIOR GENE EXPRESSION FOR HARD-TO-TRANSFECT CELL TYPES Kevin Grady Product Line Business Manager ASCB Vendor Showcase Dec. 15, 2013 Outline Overview of transfection TransfeX Primary/hTERT

More information

TOOLS sirna and mirna. User guide

TOOLS sirna and mirna. User guide TOOLS sirna and mirna User guide Introduction RNA interference (RNAi) is a powerful tool for suppression gene expression by causing the destruction of specific mrna molecules. Small Interfering RNAs (sirnas)

More information

GE Healthcare. DharmaconTM. Gene Editing, RNAi & Gene Expression. RNAi Application Guide 2016/17

GE Healthcare. DharmaconTM. Gene Editing, RNAi & Gene Expression. RNAi Application Guide 2016/17 GE Healthcare DharmaconTM Gene Editing, RNAi & Gene Expression RNAi Application Guide 2016/17 Every discovery is a stepping stone toward clarity, firm conclusions, and ultimately an amazing breakthrough.

More information

Amaxa Automated Nucleofection on Tecan Freedom EVO Workstation

Amaxa Automated Nucleofection on Tecan Freedom EVO Workstation Amaxa Automated Nucleofection on Tecan Freedom EVO Workstation Combining Leading Technologies to New Solutions for Drug Discovery Fully automated high throughput transfection with Tecan and Lonza s combined

More information

RiboCellin sirna Delivery Reagent Protocol vs1 2/12

RiboCellin sirna Delivery Reagent Protocol vs1 2/12 RiboCellin sirna Delivery Reagent Protocol vs1 2/12 RiboCellin sirna Delivery Reagent Protocol Table of content Description......4 Content......4 Storage......4 Certificate of Quality......4 Parameters

More information

INTERFERin in vitro sirna/mirna transfection reagent PROTOCOL

INTERFERin in vitro sirna/mirna transfection reagent PROTOCOL INTERFERin in vitro sirna/mirna transfection reagent PROTOCOL DESCRIPTION INTERFERin is a powerful sirna/mirna transfection reagent that ensures efficient gene silencing and reproducible transfection in

More information

TransIT-TKO Transfection Reagent

TransIT-TKO Transfection Reagent Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/2150 INTRODUCTION TransIT-TKO is a broad spectrum sirna transfection reagent that enables high efficiency sirna delivery

More information

jetprime DNA & sirna transfection reagent

jetprime DNA & sirna transfection reagent jetprime in vitro DNA & sirna Transfection Protocol Company Information... 2 Product Information... 3 1. Transient DNA transfection protocol... 4 1.1 Cell seeding... 4 1.2 DNA Transfection Protocol...

More information

PromoFectin-siRNA. Instruction Manual

PromoFectin-siRNA. Instruction Manual PromoFectin-siRNA 2 3 Contents Contents 3 Product Description 3 Materials and Methods 3 Troubleshooting 9 Shipping & Storage 9 Quality Control 9 Ordering Information 10 Contents 0.5 ml (PK-CT-2000-RNA-050),

More information

M X 500 µl. M X 1000 µl

M X 500 µl. M X 1000 µl GeneGlide TM sirna Transfection Reagent (Catalog # M1081-300, -500, -1000; Store at 4 C) I. Introduction: BioVision s GeneGlide TM sirna Transfection reagent is a cationic proprietary polymer/lipid formulation,

More information

Improving CRISPR-Cas9 Gene Knockout with a Validated Guide RNA Algorithm

Improving CRISPR-Cas9 Gene Knockout with a Validated Guide RNA Algorithm Improving CRISPR-Cas9 Gene Knockout with a Validated Guide RNA Algorithm Anja Smith Director R&D Dharmacon, part of GE Healthcare Imagination at work crrna:tracrrna program Cas9 nuclease Active crrna is

More information

SideStep Lysis and Stabilization Buffer

SideStep Lysis and Stabilization Buffer SideStep Lysis and Stabilization Buffer INSTRUCTION MANUAL Catalog #400900 Revision B.0 For Research Use Only. Not for use in diagnostic procedures. 400900-12 LIMITED PRODUCT WARRANTY This warranty limits

More information

THE DELIVERY EXPERTS PROTOCOL

THE DELIVERY EXPERTS PROTOCOL THE DELIVERY EXPERTS jetprime in vitro DNA & sirna transfection reagent PROTOCOL DESCRIPTION jetprime is a novel powerful molecule based on a polymer formulation manufactured at Polyplustransfection. jetprime

More information

sirna Overview and Technical Tips

sirna Overview and Technical Tips 1 sirna Overview and Technical Tips 2 CONTENTS 3 4 5 7 8 10 11 13 14 18 19 20 21 Introduction Applications How Does It Work? Handy Tips Troubleshooting Conclusions Further References Contact Us 3 INTRODUCTION

More information

Instructions. Fuse-It-siRNA. Shipping and Storage. Overview. Kit Contents. Specifications. Note: Important Guidelines

Instructions. Fuse-It-siRNA. Shipping and Storage. Overview. Kit Contents. Specifications. Note: Important Guidelines Membrane fusion is a highly efficient method for transfecting various molecules and particles into mammalian cells, even into sensitive and primary cells. The Fuse-It reagents are cargo-specific liposomal

More information

CELL HEALTH. reliable cell viability data. instant time savings. PrestoBlue Cell Viability Reagent

CELL HEALTH. reliable cell viability data. instant time savings. PrestoBlue Cell Viability Reagent CELL HEALTH reliable cell viability data instant time savings PrestoBlue Cell Viability Reagent PrestoBlue Cell Viability Reagent Why should I use the PrestoBlue Cell Viability Reagent? PrestoBlue reagent

More information

Instructions. Torpedo sirna. Additional Material Required. Overview. Important Guidelines. Specifications. Shipping and Storage.

Instructions. Torpedo sirna. Additional Material Required. Overview. Important Guidelines. Specifications. Shipping and Storage. is a state of the art transfection reagent, specifically designed for the transfer of sirna and mirna into a variety of mammalian cell types. It combines high transfection efficiency with low cytotoxicity

More information

VIROMER BLUE and GREEN

VIROMER BLUE and GREEN VIROMER BLUE and GREEN In vitro sirna/mirna Standard Transfection PRODUCT INFORMATION... 2 GENERAL... 2 BLUE OR GREEN?... 3 PROTOCOL GUIDELINES... 4 GENERAL REMARKS... 4 CELL CULTURE AND PLATING... 4 INITIAL

More information

PromoFectin-HUVEC Cell Transfection Reagent. Instruction Manual. Cat.No. PK-CT-2000-HUV-10 PK-CT-2000-HUV-50

PromoFectin-HUVEC Cell Transfection Reagent. Instruction Manual. Cat.No. PK-CT-2000-HUV-10 PK-CT-2000-HUV-50 PromoFectin-HUVEC Cell Transfection Reagent Instruction Manual Cat.No. PK-CT-2000-HUV-10 PK-CT-2000-HUV-50 2 Instruction Manual Contents Content 3 Formulation and Storage 3 General Considerations 3 Transient

More information

Multi-Purpose Transfection Reagents

Multi-Purpose Transfection Reagents Product Information & Instruction Manual Multi-Purpose Transfection Reagents Cat. No: ScreenFect A S-3001 S-3001-2 S-3001-3 ScreenFect A-plus S-6001 S-6001-2 S-6001-3 www.incella.com Contents 1. Characteristics

More information

sirna Transfection Reagent

sirna Transfection Reagent Description RiboJuice 0.3 ml 71115-3 1.0 ml 71115-4 Description RiboJuice efficiently delivers small interfering RNA (sirna) into a wide range of mammalian cell lines for targeted gene suppression (1).

More information

Mag4C-Lv Kit - Results

Mag4C-Lv Kit - Results Mag4C-Lv Kit - Results Mag4C-Lv Kit Magnetic capture for viral concentration & storage buffer for superior viral preservation OZ Biosciences is delighted to announce the launching of a new product Mag4C-Lv

More information

PromoFectin-Hepatocyte Cell Transfection Reagent. Instruction Manual. Cat.No. PK-CT-2000-HEP-10 PK-CT-2000-HEP-50

PromoFectin-Hepatocyte Cell Transfection Reagent. Instruction Manual. Cat.No. PK-CT-2000-HEP-10 PK-CT-2000-HEP-50 PromoFectin-Hepatocyte Cell Transfection Reagent Instruction Manual Cat.No. PK-CT-2000-HEP-10 PK-CT-2000-HEP-50 2 Instruction Manual Contents Content 3 Formulation and Storage 3 General Considerations

More information

ViaFect Transfection Reagent

ViaFect Transfection Reagent TECHNICAL MANUAL ViaFect Transfection Reagent Instructions for Use of Products E4981, E4982 and E4983 Revised 7/17 TM409 ViaFect Transfection Reagent All technical literature is available at: www.promega.com/protocols/

More information

ViewRNA ISH Cell Assays. Visualize RNA with single-molecule sensitivity and single-cell resolution

ViewRNA ISH Cell Assays. Visualize RNA with single-molecule sensitivity and single-cell resolution ViewRNA ISH Cell Assays Visualize RNA with single-molecule sensitivity and single-cell resolution ViewRNA ISH Cell Assays Analyze sample heterogeneity Study noncoding RNAs, including mirna and lncrna,

More information

Description. Lipodin-Pro TM - Protein Transfection Reagent. 1. Kit Benefits

Description. Lipodin-Pro TM - Protein Transfection Reagent. 1. Kit Benefits Description Lipodin-Pro TM - Protein Transfection Reagent The delivery of proteins inside living cells represents an alternative to nucleic acids transfection and a powerful strategy for functional studies

More information

jetprime in vitro DNA & sirna transfection reagent PROTOCOL

jetprime in vitro DNA & sirna transfection reagent PROTOCOL jetprime in vitro DNA & sirna transfection reagent PROTOCOL DESCRIPTION jetprime is a novel powerful transfection reagent based on a polymer formulation manufactured at Polyplus-transfection. jetprime

More information

siport NeoFX Transfection Agent

siport NeoFX Transfection Agent USER GUIDE siport NeoFX Transfection Agent Lipid-based Agent for Reverse Transfection Publication Part Number 4510M Rev. D Revision Date September 2011 Product description....................................................

More information

Avalanche -Everyday Transfection Reagent

Avalanche -Everyday Transfection Reagent The Transfection & Gene Expression Experts Avalanche -Everyday Transfection Reagent Cat. No. EZT-EVDY-1 Description Size: 0.75 ml 1.5 ml Store at 4 C As the simplified version of our most popular and powerful

More information

INSTRUCTION MANUAL HiViTM Transfection Reagent

INSTRUCTION MANUAL HiViTM Transfection Reagent Transfection reagents from labtech.com INSTRUCTION MANUAL HiViTM Transfection Reagent Labtech International Ltd 2 Birch House, Brambleside, Bellbrook Industrial Estate, Uckfield, TN22 1QQ Tel: 01825 744

More information

amaxa Peptide Transfection Control 2-3 Product specifications 2 Storage and stability 3 Product use limitations 3 Intended use 3

amaxa Peptide Transfection Control 2-3 Product specifications 2 Storage and stability 3 Product use limitations 3 Intended use 3 Contents amaxa Peptide Transfection Control 2-3 Product specifications 2 Storage and stability 3 Product use limitations 3 Intended use 3 Background Information 4 Cell culture 4 Supporting Data 5-8 Equipment

More information

Cell Health and Viability Assays Real-time automated measurements of cell health and viability inside your incubator

Cell Health and Viability Assays Real-time automated measurements of cell health and viability inside your incubator INCUCYTE LIVE-CELL ANALYSIS SYSTEM Cell Health and Viability Assays Real-time automated measurements of cell health and viability inside your incubator See what your cells are doing and when they do it

More information

RNAi-Shuttle sirna Transfection Reagent Instruction Manual

RNAi-Shuttle sirna Transfection Reagent Instruction Manual RNAi-Shuttle sirna Transfection Reagent Instruction Manual Catalog Number BUF-10015 6827 Nancy Ridge Drive, San Diego, CA 92121 USA Tel. 1-866-672-4436 (US Toll Free) 1-858-457-5423 Fax: 1-858-362-2030

More information

ingenio electroporation kits & solution

ingenio electroporation kits & solution ingenio electroporation kits & solution Electroporation x DEFINITION and OPTIMIZATION What is ELECTROPORATION? Electroporation is a physical method of nucleic acid transfer wherein the cells and nucleic

More information

LabBOOK VIROMER CRISPR. for RNP delivery

LabBOOK VIROMER CRISPR. for RNP delivery LabBOOK VIROMER CRISPR for RNP delivery General information Technology Viromer are polymer-based transfection reagents featuring a viral mechanism of membrane fusion. They do form transfection complexes

More information

Silencer Select Pre-designed sirna Silencer Select Validated sirna Silencer Select Custom Designed sirna Custom Select sirna

Silencer Select Pre-designed sirna Silencer Select Validated sirna Silencer Select Custom Designed sirna Custom Select sirna Catalog #: Various Silencer Select Pre-designed sirna Silencer Select Validated sirna Silencer Select Custom Designed sirna Custom Select sirna General Product Details and User Information Refer to page

More information

Arrayed shrna screening 11,415 hairpins representing 1383 unique genes. encompassing the murine protein kinome, GTPases, and components of the vesicle

Arrayed shrna screening 11,415 hairpins representing 1383 unique genes. encompassing the murine protein kinome, GTPases, and components of the vesicle Supplemental Material for Strohecker et al. Identification of 6-phosphofructo-2- kinase/fructose-2,6-bisphosphatase (PFKFB4) as a Novel Autophagy Regulator by High Content shrna Screening Supplemental

More information

Stem cell transfection guide

Stem cell transfection guide APPLICATION NOTE Stem cell transfection guide Gene delivery solutions Introduction Stem cells continue to show immense promise for the future of regenerative medicine and personalized therapeutic treatments.

More information

Avalanche -Omni Transfection Reagent

Avalanche -Omni Transfection Reagent The Transfection & Gene Expression Experts Avalanche -Omni Transfection Reagent Cat. No. EZT-OMNI-1 Size: 0.75 ml 1.5 ml Store at 4 C Description Avalanche -Omni Transfection Reagent is a proprietary lipid-polymer

More information

Custom RNAi Services. GeneCust Europe. GeneCust Europe

Custom RNAi Services. GeneCust Europe. GeneCust Europe GeneCust Europe Laboratoire de Biotechnologie du Luxembourg S.A. 2 route de Remich L-5690 Ellange Luxembourg Tél. : +352 27620411 Fax : +352 27620412 Email : info@genecust.com Web : www.genecust.com Custom

More information

Development of Novel Advanced Cell Culture Surfaces that Provide Better Cell Growth and Attachment for Cell-Based Assays

Development of Novel Advanced Cell Culture Surfaces that Provide Better Cell Growth and Attachment for Cell-Based Assays Development of Novel Advanced Cell Culture Surfaces that Provide Better Cell Growth and Attachment for Cell-Based Assays Elizabeth J. Abraham, Ph.D. BD Biosciences Outline Overview of surfaces and culture

More information

TransIT -LT1 Transfection Reagent

TransIT -LT1 Transfection Reagent Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/2300 INTRODUCTION TransIT -LT1 Transfection Reagent is a broad spectrum reagent that provides high efficiency plasmid

More information

LabBOOK VIROMER BLUE VIROMER GREEN. sirna /mirna transfection

LabBOOK VIROMER BLUE VIROMER GREEN. sirna /mirna transfection LabBOOK VIROMER BLUE VIROMER GREEN sirna /mirna transfection Contact General information Bettina Weber (Biologist) +49 345 55 59 625 bettina.weber@lipocalyx.de Dr. Sandra Lagauzère (Biologist) +49 345

More information

All-In-One for cell research

All-In-One for cell research Live cell movie analyzer All-In-One for cell research Crazy + Tangible play, 2K13 www.nanoentek.com What is JuLI TM Br counting? JuLI Br TM Counting software is designed to measure cell count and viability

More information

TransIT-X2 Dynamic Delivery System

TransIT-X2 Dynamic Delivery System INTRODUCTION TransIT-X2 Dynamic Delivery System is an advanced, non-liposomal polymeric system that enables high efficiency transfection of many cell types, including primary cells. TransIT-X2 can be used

More information

Avalanche -Omni Transfection Reagent

Avalanche -Omni Transfection Reagent The Transfection & Gene Expression Experts Avalanche -Omni Transfection Reagent Cat. No. EZT-OMNI-1 Description Size: 0.75 ml 1.5 ml Store at 4 C Avalanche -Omni Transfection Reagent is a proprietary lipid-polymer

More information

User s Guide MegaTran 1.0 Transfection Reagent

User s Guide MegaTran 1.0 Transfection Reagent User s Guide MegaTran 1.0 Transfection Reagent Package Contents and Storage Conditions... 2 Related products... 2 Introduction... 2 Production and Quality Assurance:... 3 Experimental Procedures... 3 Transfection

More information

USER GUIDE. Introduction. Catalog No. C10423, C10723

USER GUIDE. Introduction. Catalog No. C10423, C10723 USER GUIDE CellEvent Caspase-3/7 Green Detection Reagent Catalog No. C10423, C10723 Pub. No. MAN0003556 Rev. B.0 Table 1. Contents and storage Material C10423 Amount C10723 Concentration Storage* CellEvent

More information

TransIT-TKO Transfection Reagent

TransIT-TKO Transfection Reagent INTRODUCTION TransIT-TKO is a broad spectrum sirna transfection reagent that enables high efficiency sirna delivery and knockdown of target gene expression in many cell types including primary cells. TransIT-TKO

More information

Corning Microplates for Microscopy and High Content Imaging. Improve results with microplates for high resolution cell imaging

Corning Microplates for Microscopy and High Content Imaging. Improve results with microplates for high resolution cell imaging Corning Microplates for Microscopy and High Content Imaging Improve results with microplates for high resolution cell imaging High Performance for Cell-based Assays Within the drug discovery process, high

More information

Factorial TM 30: Evaluate 30 Transcription Factors in single experiment

Factorial TM 30: Evaluate 30 Transcription Factors in single experiment Factorial TM 30: Evaluate 30 Transcription Factors in single experiment Attagene Inc. proudly introduces FACTORIAL 30, the founding product line that is based on our proprietary technology and enables

More information

mirusbio.com Trans IT Certified Transfection

mirusbio.com Trans IT Certified Transfection mirusbio.com TransIT Certified Transfection PROGRAMMING THE GENOME: Any Delivery Method. Any Nucleic Acid. Any Cell Type. At Mirus Bio, our role in PROGRAMMING THE GENOME is to provide scientists turnkey

More information

EVE. Automatic cell counter. Crazy + Tangible play, 2K13.

EVE. Automatic cell counter. Crazy + Tangible play, 2K13. EVE Automatic cell counter Crazy + Tangible play, 2K13 www.nanoentek.com What is a EVE? The EVE Automatic cell counter uses state-of-the-art optics and image analysis to automate cell counting. The EVE

More information

3D-FectIN transfection reagent - Results

3D-FectIN transfection reagent - Results 3D-FectIN transfection reagent - Results OZ Biosciences is delighted to announce the launching of a new 3D transfection reagent, 3D-FectIN. 3D- FectIN is the newest reagent specifically designed and developed

More information

Genome Editing: Cas9 Stable Cell Lines for CRISPR sgrna Validation, Library Screening, and More. Ed Davis, Ph.D.

Genome Editing: Cas9 Stable Cell Lines for CRISPR sgrna Validation, Library Screening, and More. Ed Davis, Ph.D. TECHNICAL NOTE Genome Editing: Cas9 Stable Cell Lines for CRISPR sgrna Validation, Library Screening, and More Introduction Ed Davis, Ph.D. The CRISPR-Cas9 system has become greatly popular for genome

More information

USER GUIDE. Introduction. Catalog No. C10730, C10731

USER GUIDE. Introduction. Catalog No. C10730, C10731 USER GUIDE CellEvent Caspase-3/7 Red Detection Reagent Catalog No. C10730, C10731 Pub. No. MAN0016090 Rev. B.0 Table 1. Contents and storage Material C10730 Amount C10731 Concentration Storage* CellEvent

More information

Dharmacon TM solutions for studying gene function

Dharmacon TM solutions for studying gene function GE Healthcare Capabilities Overview Dharmacon TM solutions for studying gene function RNAi Gene Expression Gene Editing RNA Interference Our RNAi products encompass the most complete portfolio of innovative

More information

Alt-R CRISPR-Cas9 system:

Alt-R CRISPR-Cas9 system: Alt-R CRISPR-Cas9 system: Delivery of ribonucleoprotein complexes into Jurkat T cells using the Bio-Rad Gene Pulser Xcell Electroporation System See what more we can do for you at www.idtdna.com. For Research

More information

Avalanche -Everyday Transfection Reagent

Avalanche -Everyday Transfection Reagent The Transfection & Gene Expression Experts Avalanche -Everyday Transfection Reagent Cat. No. EZT-EVDY-1 Description Size: 0.75 ml 1.5 ml Store at 4 C As the simplified version of our most popular and powerful

More information

pdsipher and pdsipher -GFP shrna Vector User s Guide

pdsipher and pdsipher -GFP shrna Vector User s Guide pdsipher and pdsipher -GFP shrna Vector User s Guide NOTE: PLEASE READ THE ENTIRE PROTOCOL CAREFULLY BEFORE USE Page 1. Introduction... 1 2. Vector Overview... 1 3. Vector Maps 2 4. Materials Provided...

More information

Mag4C-Ad Kit - Results

Mag4C-Ad Kit - Results Mag4C-Ad Kit - Results Mag4C-Ad Kit Magnetic capture for viral concentration & storage buffer for superior viral preservation OZ Biosciences is delighted to announce the launching of a new product Mag4C-Ad

More information

Supplemental Table 1 Primers used in study. Human. Mouse

Supplemental Table 1 Primers used in study. Human. Mouse Supplemental Table 1 Primers used in study Human Forward primer region(5-3 ) Reverse primer region(5-3 ) RT-PCR GAPDH gagtcaacggatttggtcgt ttgattttggagggatctcg Raftlin atgggttgcggattgaacaagttaga ctgaggtataacaccaacgaatttcaggc

More information

Transfection Reagent SPECIFICATIONS MATERIALS. For Research Use Only. Materials Supplied. Materials required, but not supplied

Transfection Reagent SPECIFICATIONS MATERIALS. For Research Use Only. Materials Supplied. Materials required, but not supplied TransIT-siQUEST Transfection Reagent Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/2110 INTRODUCTION TransIT-siQUEST is a broad spectrum sirna transfection reagent

More information

Everything counts. But nothing counts like the

Everything counts. But nothing counts like the Everything counts But nothing counts like the Countess II FL Automated Cell Counter The new Countess II FL Automated Cell Counter is a benchtop cell assay platform equipped with state-of-the-art optics

More information

jetcrispr RNP transfection reagent PROTOCOL

jetcrispr RNP transfection reagent PROTOCOL jetcrispr RNP transfection reagent PROTOCOL DESCRIPTION jetcrispr is a RiboNucleoProtein (RNP) transfection reagent designed to perform CRISPR-Cas9 genome editing in mammalian cells. This reagent has been

More information

PRODUCT INFORMATION...

PRODUCT INFORMATION... VIROMER GREEN In vitro sirna/microrna Standard Transfection PRODUCT INFORMATION... 2 GENERAL... 2 BLUE OR GREEN?... 3 PROTOCOL GUIDELINES... 4 GENERAL REMARKS... 4 CELL CULTURE AND PLATING... 4 FORWARD/REVERSE

More information