DNA extraction. ITS amplication and sequencing. ACT, CAL, COI, TEF or TUB2 required for species level. ITS identifies to species level
|
|
- Rhoda Todd
- 6 years ago
- Views:
Transcription
1 DNA extraction ITS amplication and sequencing ITS identifies to species level Ceratocystis fagacearum Ceratocystis virescens Melampsora medusae (only to species) Mycosphaerella laricis-leptolepidis Phaeoramularia angolensis Phytophthora kernoviae Puccinia horiana Puccinia pittieriana Stenocarpella macrospora Stenocarpella maydis Thecaphora solani ACT, CAL, COI, TEF or TUB2 required for species level Ceratocystis fimbriata f. sp. platani - TEF required Davidiella (Mycosphaerella) populorum - TUB2 required Didymella ligulicola - ACT required Monilinia fructicola - TEF required Mycosphaerella dearnessii - TUB2 required Mycosphaerella gibsonii - TUB2 required Mycosphaerella pini - TEF required Phoma andigena - ACT required Phoma tracheiphila - ACT required Phyllosticta citricarpa - TEF required Phytophthora fragariae var. fragariae - COI required Phytophthora fragariae var. rubi - COI required Phytophthora lateralis - COI required Phytophthora ramorum - COI required Septoria lycopersici var. malagutii - TUB2 required Verticillium albo-atrum (only to species) - CAL required Verticillium dahliae (only to species) - CAL required ITS protocol ACT protocol TEF protocols CAL protocol TUB2 protocol COI protocol High quality version of picture and protocols
2 Fungi DNA extraction Extraction protocols for DNA isolation from fungal mycelium Points to consider Mycelium of pure cultures is removed from the agar surface (approximately 2 cm2) using a sterile scalpel or micro pestle and used as starting material for the DNA extraction. DNA is extracted using the UltraClean Microbial DNA Isolation Kit (MoBio) or DNeasy Plant Mini Kit (Qiagen) following the manufacturer s instructions. Particular care should be given to ensure the sample is adequately homogenised in the initial step. Micro pestles can be used to grind fungal tissue but specialist equipment can be used when high throughput is required (e.g. Retsch Mixer Mill MM301 or Precellys tissue homogenizer). DNA is eluted in 50 µl elution buffer (provided in the isolation kits). After DNA extraction, no DNA clean-up is required. Either use extracted DNA immediately or store it at 20 o C or below until use.
3 Fungi ITS amplification and sequencing PCR for 550-1,700 bp of the internal transcribed spacer regions of the nrrna genes for species allocation of majority of EU regulated fungi PCR-Sequencing approx ,700 bp of the ITS region ITS4 TCC TCC GCT TAT TGA TAT GC X X ITS5 GGA AGT AAA AGT CGT AAC AAG G X X V9G TTA CGT CCC TGC CCT TTG TA (X) LR5 TCC TGA GGG AAA CTT CG (X) Remarks: 550 (ITS5/ITS4) (V9G/LR5) bp. 5 min 94 C, 40x (45 sec 94 C, 30 sec 52 C, 90 sec 72 C), 6 min 72 C, quick cooling to room. The annealing can be decreased from 52 C to 48 C if problems with ITS amplification is encountered using a different DNA Polymerase. Cycle sequencing reactions are performed using the primers ITS5 and ITS4 in separate reactions. Although the combination of ITS5 / ITS4 works for many fungi, the combination of ITS5 / LR5 or V9G / LR5 could be useful alternatives. When these alternative amplification primers are used, ITS5 and ITS4 are still used as sequencing primers. Master mix per reaction (µl) 6 reactions final concentration DNase and RNase free water 14,73 88,38 µl 5x Colorless GoTaq Flexi buffer (Promega) 5,0 30,0 µl 1x MgC l 2 (25 mm, Promega) 2,0 12,0 µl 2 mm dntp's (10 mm each) 0,15 0,90 µl 0.06 mm each ITS5 (10 µm) 0,5 3,0 µl 0.2 µm ITS4 (10 µm) 0,5 3,0 µl 0.2 µm GoTaq DNA polymerase (5 U/µl, Promega) 0,12 0,72 µl 0.6 Unit subtotal 23,0 138,0 µl template 2,0 total 25,0
4 Fungi ACT amplification and sequencing PCR for approximately 330 bp of the partial actin region for species allocation of Phoma (-like) species PCR-Sequencing approx. 330 bp of the partial ACT region ACT-512F ATG TGC AAG GCC GGT TTC GC X X ACT-783R TAC GAG TCC TTC TGG CCC AT X X Approximately 330 bp. 5 min 94 C, 40x (45 sec 94 C, 30 sec 52 C, 90 sec 72 C), 6 min 72 C, quick cooling to room Cycle sequencing reactions are performed using the primers ACT-512F and ACT-783R in separate reactions. DNase and RNase free water µl 5x Colorless GoTaq Flexi buffer (Promega) µl 1x MgCl 2 (25 mm, Promega) µl 2 mm dntp's (10 mm each) µl 0,06 mm each ACT-512F (10 µm) µl 0,2 µm ACT-783R (10 µm) µl 0,2 µm Taq DNA polymerase (5 U/µl, Promega) µl 0,6 Unit subtotal µl
5 Fungi CAL amplification and sequencing PCR for 470 bp of the partial calmodulin region for species allocation of Verticillium PCR-Sequencing approx. 470 bp of the partial CAL region CAL-228F GAG TTC AAG GAG GCC TTC TCC C X X CAL-737R CAT CTT TCT GGC CAT CAT GG X X Approximately 470 bp. 2 min 94 C, 35x (60 sec 94 C, 30 sec 50 C, 90 sec 72 C), 10 min 72 C, quick cooling to room Cycle sequencing reactions are performed using the primers CAL-228F and CAL-737R in separate reactions. DNase and RNase free water µl 5x Colorless GoTaq Flexi buffer (Promega) µl 1x MgCl 2 (25 mm, Promega) µl 2 mm dntp's (10 mm each) µl 0,06 mm each CAL-228F (10 µm) µl 0,2 µm CAL-737R (10 µm) µl 0,2 µm Taq DNA polymerase (5 U/µl, Promega) µl 0,6 Unit subtotal µl
6 Fungi COI amplification and sequencing PCR for 700 bp of the partial cytochrome oxidase I region for species allocation of Phytophthora PCR-Sequencing approx. 700 bp of the partial COI region OomCoxI-Levup TCA WCW MGA TGG CTT TTT TCA AC X X OomCoxI-Levlo CYT CHG GRT GWC CRA AAA ACC AAA X X Approximately 700 bp. 2 min 95 C, 35x (30 sec 95 C, 30 sec 52 C, 1 min 72 C), 7 min 72 C, quick cooling to 10 C Cycle sequencing reactions are performed using the primers OomCoxI-Levup and OomCoxI-levlo in separate reactions. DNase and RNase free water 16,20 97,20 µl 5x Colorless GoTaq Flexi buffer (Promega) 2,50 15,0 µl 1x MgCl 2 (25 mm, Promega) 1,2 7,2 µl 2 mm DMSO 1,4 8,4 µl dntp's (10 mm each) 0,50 3,00 µl 0,06 mm each OomCoxI-Levup (10 µm) 0,50 3,0 µl 0,2 µm OomCoxI-Levlo (10 µm) 0,50 3,0 µl 0,2 µm Taq DNA polymerase (5 U/µl, Promega) 0,20 1,20 µl 0,6 Unit subtotal 23,0 138,0 µl template 2,0 total 25,0
7 Fungi Ceratocystis TEF amplification and sequencing PCR for 430 bp of the partial translation elongation factor 1-alpha region as additional check for species allocation of Ceratocystis fimbriata f. sp. platani and Ceratocystis virescens. PCR-Sequencing approx. 430 bp of the partial TEF region EFCF1 AGT GCG GTG GTA TCG ACA AG X X EFCF6 CAT GTC ACG GAC GGC GAA AC (X) EFCF2 TGC TCA CGG GTC TGG CCA T X X Remarks: 430 bp. 5 min 94 C, 40x (45 sec 94 C, 30 sec 52 C, 120 sec 72 C), 6 min 72 C, quick cooling to room Cycle sequencing reactions are performed using the primers EFCF1 and EFCF2 in separate reactions. Dimethyl sulfoxide for molecular biology >99.9% ( DMSO, Sigma) could be required as supplement if other DNA Polymerases (e.g. Bioline) are used - substitute 1.4 µl of MGW with 1.4 µl DMSO in a 25 µl total reaction volume DNase and RNase free water µl 5x colorless GoTaq Flexi buffer (Promega) µl 1x MgCl 2 (25 mm, Promega) µl 2 mm dntp's (10 mm each) µl 0.06 mm each EFCF1 (10 µm) µl 0.2 µm EFCF2 (10 µm) or EFCF6 (10 µm) µl 0.2 µm GoTaq DNA polymerase (5 U/µl, Promega) µl 0.6 Unit subtotal µl
8 Fungi Monilinia, Mycosphaerella and Phyllosticta TEF amplification and sequencing Q-bank, protocol version January 2015 PCR for 400 bp of the partial translation elongation factor 1-alpha region for species allocation of Scirrhia pini (=Mycosphaerella pini, with anamorph Dothistroma septosporum), Dothistroma pini, as well as Monilinia fructicola and Phyllosticta citricarpa. PCR-Sequencing approx. 400 bp of the partial TEF region EF1-728F CAT CGA GAA GTT CGA GAA GG X X EF-2 GGA RGT ACC AGT SAT CAT GTT X X EF1-986R TAC TTG AAG GAA CCC TTA CC (X) (X) Remarks: 400 bp. 5 min 94 C, 40x (45 sec 94 C, 30 sec 52 C, 90 sec 72 C), 6 min 72 C, quick cooling to room Cycle sequencing reactions are performed using the primers EF1-728F and EF-2 in separate reactions. Dimethyl sulfoxide for molecular biology >99.9% ( DMSO, Sigma) could be required as supplement if other DNA Polymerases (e.g. Bioline) are used - substitute 1.4 µl of MGW with 1.4 µl DMSO in a 25 µl total reaction volume. As an alternative reverse primer, EF1-986R can be used but will result in a shorter fragment. DNase and RNase free water µl 5x Colorless GoTaq Flexi buffer (Promega) µl 1x MgCl 2 (25 mm, Promega) µl 2 mm dntp's (10 mm each) µl 0,06 mm each EF1-728F (10 µm) µl 0,2 µm EF-2 (10 µm) µl 0,2 µm Taq DNA polymerase (5 U/µl, Promega) µl 0,6 Unit subtotal µl
9 Fungi TUB2 amplification and sequencing PCR for 400 bp of the partial beta-tubulin region for species allocation of Mycosphaerella gibsonii and Septoria lycopersici var. malagutii PCR-Sequencing approx. 400 bp of the partial TUB region TUB2Fd GTB CAC CTY CAR ACC GGY CAR TG X X TUB4Rd CCR GAY TGR CCR AAR ACR AAG TTG TC X X 400 bp. 5 min 94 C, 40x (45 sec 94 C, 30 sec 52 C, 90 sec 72 C), 6 min 72 C, quick cooling to room Cycle sequencing reactions are performed using the primers TUB2Fd and TUB4Rd, in separate reactions DNase and RNase free water µl per reaction (µl) 3 reactions final concentration 5x Colorless GoTaq Flexi buffer (Promega) µl 1x MgCl 2 (25 mm, Promega) µl 2 mm dntp's (10 mm) µl 0.06 mm TUB2Fd (10 µm) µl 0.2 µm TUB4Rd (10 µm) µl 0.2 µm GoTaq DNA polymerase (5 U/µl, Promega) µl 0.6 Unit subtotal µl
Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC
Supplementary Appendixes Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC ACG TAG CTC CGG CTG GA-3 for vimentin, /5AmMC6/TCC CTC GCG CGT GGC TTC CGC
More informationY-chromosomal haplogroup typing Using SBE reaction
Schematic of multiplex PCR followed by SBE reaction Multiplex PCR Exo SAP purification SBE reaction 5 A 3 ddatp ddgtp 3 T 5 A G 3 T 5 3 5 G C 5 3 3 C 5 ddttp ddctp 5 T 3 T C 3 A 5 3 A 5 5 C 3 3 G 5 3 G
More informationSupplemental Data Supplemental Figure 1.
Supplemental Data Supplemental Figure 1. Silique arrangement in the wild-type, jhs, and complemented lines. Wild-type (WT) (A), the jhs1 mutant (B,C), and the jhs1 mutant complemented with JHS1 (Com) (D)
More informationLecture 10, 20/2/2002: The process of solution development - The CODEHOP strategy for automatic design of consensus-degenerate primers for PCR
Lecture 10, 20/2/2002: The process of solution development - The CODEHOP strategy for automatic design of consensus-degenerate primers for PCR 1 The problem We wish to clone a yet unknown gene from a known
More informationSupplementary. Table 1: Oligonucleotides and Plasmids. complementary to positions from 77 of the SRα '- GCT CTA GAG AAC TTG AAG TAC AGA CTG C
Supplementary Table 1: Oligonucleotides and Plasmids 913954 5'- GCT CTA GAG AAC TTG AAG TAC AGA CTG C 913955 5'- CCC AAG CTT ACA GTG TGG CCA TTC TGC TG 223396 5'- CGA CGC GTA CAG TGT GGC CAT TCT GCT G
More informationAdd 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH).
Bisulfite Treatment of DNA Dilute DNA sample to 2µg DNA in 50µl ddh 2 O. Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH). Incubate in a 37ºC water bath for 30 minutes. To 55µl samples
More informationElectronic Supplementary Information
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Dissecting binding of a β-barrel outer membrane
More informationSupporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2006
Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2006 Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2006 Supporting Information for Expanding the Genetic
More informationFigure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis
1 2 3 4 5 6 7 8 9 10 11 12 Figure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis Information Research). Exons
More informationArabidopsis actin depolymerizing factor AtADF4 mediates defense signal transduction triggered by the Pseudomonas syringae effector AvrPphB
Arabidopsis actin depolymerizing factor mediates defense signal transduction triggered by the Pseudomonas syringae effector AvrPphB Files in this Data Supplement: Supplemental Table S1 Supplemental Table
More informationPGRP negatively regulates NOD-mediated cytokine production in rainbow trout liver cells
Supplementary Information for: PGRP negatively regulates NOD-mediated cytokine production in rainbow trout liver cells Ju Hye Jang 1, Hyun Kim 2, Mi Jung Jang 2, Ju Hyun Cho 1,2,* 1 Research Institute
More informationHes6. PPARα. PPARγ HNF4 CD36
SUPPLEMENTARY INFORMATION Supplementary Table Positions and Sequences of ChIP primers -63 AGGTCACTGCCA -79 AGGTCTGCTGTG Hes6-0067 GGGCAaAGTTCA ACOT -395 GGGGCAgAGTTCA PPARα -309 GGCTCAaAGTTCAaGTTCA CPTa
More informationSupplementary Figure 1A A404 Cells +/- Retinoic Acid
Supplementary Figure 1A A44 Cells +/- Retinoic Acid 1 1 H3 Lys4 di-methylation SM-actin VEC cfos (-) RA (+) RA 14 1 1 8 6 4 H3 Lys79 di-methylation SM-actin VEC cfos (-) RA (+) RA Supplementary Figure
More informationSupplemental Data. mir156-regulated SPL Transcription. Factors Define an Endogenous Flowering. Pathway in Arabidopsis thaliana
Cell, Volume 138 Supplemental Data mir156-regulated SPL Transcription Factors Define an Endogenous Flowering Pathway in Arabidopsis thaliana Jia-Wei Wang, Benjamin Czech, and Detlef Weigel Table S1. Interaction
More informationSupplemental Information. Human Senataxin Resolves RNA/DNA Hybrids. Formed at Transcriptional Pause Sites. to Promote Xrn2-Dependent Termination
Supplemental Information Molecular Cell, Volume 42 Human Senataxin Resolves RNA/DNA Hybrids Formed at Transcriptional Pause Sites to Promote Xrn2-Dependent Termination Konstantina Skourti-Stathaki, Nicholas
More informationLegends for supplementary figures 1-3
High throughput resistance profiling of Plasmodium falciparum infections based on custom dual indexing and Illumina next generation sequencing-technology Sidsel Nag 1,2 *, Marlene D. Dalgaard 3, Poul-Erik
More informationSupporting information for Biochemistry, 1995, 34(34), , DOI: /bi00034a013
Supporting information for Biochemistry, 1995, 34(34), 10807 10815, DOI: 10.1021/bi00034a013 LESNIK 10807-1081 Terms & Conditions Electronic Supporting Information files are available without a subscription
More informationCat. # Product Size DS130 DynaExpress TA PCR Cloning Kit (ptakn-2) 20 reactions Box 1 (-20 ) ptakn-2 Vector, linearized 20 µl (50 ng/µl) 1
Product Name: Kit Component TA PCR Cloning Kit (ptakn-2) Cat. # Product Size DS130 TA PCR Cloning Kit (ptakn-2) 20 reactions Box 1 (-20 ) ptakn-2 Vector, linearized 20 µl (50 ng/µl) 1 2 Ligation Buffer
More informationGene synthesis by circular assembly amplification
Gene synthesis by circular assembly amplification Duhee Bang & George M Church Supplementary figures and text: Supplementary Figure 1. Dpo4 gene (1.05kb) construction by various methods. Supplementary
More informationPCR analysis was performed to show the presence and the integrity of the var1csa and var-
Supplementary information: Methods: Table S1: Primer Name Nucleotide sequence (5-3 ) DBL3-F tcc ccg cgg agt gaa aca tca tgt gac tg DBL3-R gac tag ttt ctt tca ata aat cac tcg c DBL5-F cgc cct agg tgc ttc
More informationNESTED Sequence-based Typing (SBT) protocol for epidemiological typing of Legionella pneumophila directly from clinical samples
NESTED Sequence-based Typing (SBT) protocol for epidemiological typing of Legionella pneumophila directly from clinical samples VERSION 2.0 SUMMARY This procedure describes the use of nested Sequence-Based
More informationMacBlunt PCR Cloning Kit Manual
MacBlunt PCR Cloning Kit Manual Shipping and Storage MacBlunt PCR Cloning Kits are shipped on dry ice. Each kit contains a box with cloning reagents and an attached bag with Eco-Blue Competent Cells (optional).
More informationOverexpression Normal expression Overexpression Normal expression. 26 (21.1%) N (%) P-value a N (%)
SUPPLEMENTARY TABLES Table S1. Alteration of ZNF322A protein expression levels in relation to clinicopathological parameters in 123 Asian and 74 Caucasian lung cancer patients. Asian patients Caucasian
More informationSupplementary Information. Construction of Lasso Peptide Fusion Proteins
Supplementary Information Construction of Lasso Peptide Fusion Proteins Chuhan Zong 1, Mikhail O. Maksimov 2, A. James Link 2,3 * Departments of 1 Chemistry, 2 Chemical and Biological Engineering, and
More informationSupporting Online Information
Supporting Online Information Isolation of Human Genomic DNA Sequences with Expanded Nucleobase Selectivity Preeti Rathi, Sara Maurer, Grzegorz Kubik and Daniel Summerer* Department of Chemistry and Chemical
More informationMaterials Protein synthesis kit. This kit consists of 24 amino acids, 24 transfer RNAs, four messenger RNAs and one ribosome (see below).
Protein Synthesis Instructions The purpose of today s lab is to: Understand how a cell manufactures proteins from amino acids, using information stored in the genetic code. Assemble models of four very
More informationDisease and selection in the human genome 3
Disease and selection in the human genome 3 Ka/Ks revisited Please sit in row K or forward RBFD: human populations, adaptation and immunity Neandertal Museum, Mettman Germany Sequence genome Measure expression
More informationstrain devoid of the aox1 gene [1]. Thus, the identification of AOX1 in the intracellular
Additional file 2 Identification of AOX1 in P. pastoris GS115 with a Mut s phenotype Results and Discussion The HBsAg producing strain was originally identified as a Mut s (methanol utilization slow) strain
More informationPCR-based Markers and Cut Flower Longevity in Carnation
PCRbased Markers and Cut Flower Longevity in Carnation Laura De Benedetti, Luca Braglia, Simona Bruna, Gianluca Burchi *, Antonio Mercuri and Tito Schiva Istituto Sperimentale per la Floricoltura, Corso
More informationSupplementary Figures
Supplementary Figures Supplementary Fig. 1 Characterization of GSCs. a. Immunostaining of primary GSC spheres from GSC lines. Nestin (neural progenitor marker, red), TLX (green). Merged images of nestin,
More informationSUPPORTING INFORMATION
SUPPORTING INFORMATION Investigation of the Biosynthesis of the Lasso Peptide Chaxapeptin Using an E. coli-based Production System Helena Martin-Gómez, Uwe Linne, Fernando Albericio, Judit Tulla-Puche,*
More informationORFs and genes. Please sit in row K or forward
ORFs and genes Please sit in row K or forward https://www.flickr.com/photos/teseum/3231682806/in/photostream/ Question: why do some strains of Vibrio cause cholera and others don t? Methods Mechanisms
More informationII 0.95 DM2 (RPP1) DM3 (At3g61540) b
Table S2. F 2 Segregation Ratios at 16 C, Related to Figure 2 Cross n c Phenotype Model e 2 Locus A Locus B Normal F 1 -like Enhanced d Uk-1/Uk-3 149 64 36 49 DM2 (RPP1) DM1 (SSI4) a Bla-1/Hh-0 F 3 111
More informationSupplemental Data. Bennett et al. (2010). Plant Cell /tpc
BRN1 ---------MSSSNGGVPPGFRFHPTDEELLHYYLKKKISYEKFEMEVIKEVDLNKIEPWDLQDRCKIGSTPQNEWYFFSHKDRKYPTGS 81 BRN2 --------MGSSSNGGVPPGFRFHPTDEELLHYYLKKKISYQKFEMEVIREVDLNKLEPWDLQERCKIGSTPQNEWYFFSHKDRKYPTGS 82 SMB
More informationSearch for and Analysis of Single Nucleotide Polymorphisms (SNPs) in Rice (Oryza sativa, Oryza rufipogon) and Establishment of SNP Markers
DNA Research 9, 163 171 (2002) Search for and Analysis of Single Nucleotide Polymorphisms (SNPs) in Rice (Oryza sativa, Oryza rufipogon) and Establishment of SNP Markers Shinobu Nasu, Junko Suzuki, Rieko
More informationNAME:... MODEL ANSWER... STUDENT NUMBER:... Maximum marks: 50. Internal Examiner: Hugh Murrell, Computer Science, UKZN
COMP710, Bioinformatics with Julia, Test One, Thursday the 20 th of April, 2017, 09h30-11h30 1 NAME:...... MODEL ANSWER... STUDENT NUMBER:...... Maximum marks: 50 Internal Examiner: Hugh Murrell, Computer
More informationQuantitative reverse-transcription PCR. Transcript levels of flgs, flgr, flia and flha were
1 Supplemental methods 2 3 4 5 6 7 8 9 1 11 12 13 14 15 16 17 18 19 21 22 23 Quantitative reverse-transcription PCR. Transcript levels of flgs, flgr, flia and flha were monitored by quantitative reverse-transcription
More informationSupplemental material
Supplemental material Diversity of O-antigen repeat-unit structures can account for the substantial sequence variation of Wzx translocases Yaoqin Hong and Peter R. Reeves School of Molecular Bioscience,
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/10/494/eaan6284/dc1 Supplementary Materials for Activation of master virulence regulator PhoP in acidic ph requires the Salmonella-specific protein UgtL Jeongjoon
More information11th Meeting of the Science Working Group. Lima, Peru, October 2012 SWG-11-JM-11
11th Meeting of the Science Working Group Lima, Peru, 15-19 October 2012 Russian population genetics studies of jack mackerel in the South Pacific P.K.Afanasiev M.A.Rabchun A.I.Glubokov Introduction. In
More informationhcd1tg/hj1tg/ ApoE-/- hcd1tg/hj1tg/ ApoE+/+
ApoE+/+ ApoE-/- ApoE-/- H&E (1x) Supplementary Figure 1. No obvious pathology is observed in the colon of diseased ApoE-/me. Colon samples were fixed in 1% formalin and laid out in Swiss rolls for paraffin
More informationSupporting Information
Supporting Information Table S1. Oligonucleotide sequences used in this work Oligo DNA A B C D CpG-A CpG-B CpG-C CpG-D Sequence 5 ACA TTC CTA AGT CTG AAA CAT TAC AGC TTG CTA CAC GAG AAG AGC CGC CAT AGT
More informationSupplemental Data. Jones et al. Plant Cell. (2010) /tpc
IAA synthesis rate Supplemental Data. Jones et al. Plant Cell. ()..5/tpc..7856 Supplemental Figure. Root tip specific IAA biosynthesis after induction of the CKX gene. 6 DAG pmdc7:atckx seedling roots
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nature07182 SUPPLEMENTAL FIGURES AND TABLES Fig. S1. myf5-expressing cells give rise to brown fat depots and skeletal muscle (a) Perirenal BAT from control (cre negative) and myf5-cre:r26r3-yfp
More informationΔPDD1 x ΔPDD1. ΔPDD1 x wild type. 70 kd Pdd1. Pdd3
Supplemental Fig. S1 ΔPDD1 x wild type ΔPDD1 x ΔPDD1 70 kd Pdd1 50 kd 37 kd Pdd3 Supplemental Fig. S1. ΔPDD1 strains express no detectable Pdd1 protein. Western blot analysis of whole-protein extracts
More informationSupplemental Table 1. Primers used for PCR.
Supplemental Table 1. Primers used for PCR. Gene Type Primer Sequence Genotyping and semi-quantitative RT-PCR F 5 -TTG CCC GAT CAC CAT CTG TA-3 rwa1-1 R 5 -TGT AGC GAT CAA GGC CTG ATC TAA-3 LB 5 -TAG CAT
More informationSUPPORTING INFORMATION FILE
Intrinsic and extrinsic connections of Tet3 dioxygenase with CXXC zinc finger modules Nan Liu, Mengxi Wang, Wen Deng, Christine S. Schmidt, Weihua Qin, Heinrich Leonhardt and Fabio Spada Department of
More informationPrimer Design Workshop. École d'été en géné-que des champignons 2012 Dr. Will Hintz University of Victoria
Primer Design Workshop École d'été en géné-que des champignons 2012 Dr. Will Hintz University of Victoria Scenario You have discovered the presence of a novel endophy5c organism living inside the cells
More informationSUPPLEMENTAL MATERIAL GENOTYPING WITH MULTIPLEXING TARGETED RESEQUENCING
SUPPLEMENTAL MATERIAL GENOTYPING WITH MULTIPLEXING TARGETED RESEQUENCING All of the patients and control subjects were sequenced and genotyped in the same way. Shotgun libraries of approximately 250 bp
More informationSAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer
TEACHER S GUIDE SAY IT WITH DNA: Protein Synthesis Activity by Larry Flammer SYNOPSIS This activity uses the metaphor of decoding a secret message for the Protein Synthesis process. Students teach themselves
More information2
1 2 3 4 5 6 7 Supplemental Table 1. Magnaporthe oryzae strains generated in this study. Strain background Genotype Strain name Description Guy-11 H1:RFP H1:RFP Strain expressing Histone H1- encoding gene
More informationRPA-AB RPA-C Supplemental Figure S1: SDS-PAGE stained with Coomassie Blue after protein purification.
RPA-AB RPA-C (a) (b) (c) (d) (e) (f) Supplemental Figure S: SDS-PAGE stained with Coomassie Blue after protein purification. (a) RPA; (b) RPA-AB; (c) RPA-CDE; (d) RPA-CDE core; (e) RPA-DE; and (f) RPA-C
More informationTable S1. Bacterial strains (Related to Results and Experimental Procedures)
Table S1. Bacterial strains (Related to Results and Experimental Procedures) Strain number Relevant genotype Source or reference 1045 AB1157 Graham Walker (Donnelly and Walker, 1989) 2458 3084 (MG1655)
More informationSupplementary Methods Quantitative RT-PCR. For mrna, total RNA was prepared using TRIzol reagent (Invitrogen) and genomic DNA was eliminated with TURB
Supplementary Methods Quantitative RT-PCR. For mrna, total RNA was prepared using TRIzol reagent (Invitrogen) and genomic DNA was eliminated with TURBO DNA-free Kit (Ambion). One µg of total RNA was reverse
More informationMultiplexing Genome-scale Engineering
Multiplexing Genome-scale Engineering Harris Wang, Ph.D. Department of Systems Biology Department of Pathology & Cell Biology http://wanglab.c2b2.columbia.edu Rise of Genomics An Expanding Toolbox Esvelt
More informationAnti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR
Supplementary Methods Antibodies Anti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR (Cat#2646), anti-igf1r (Cat#3018), anti-insr (Cat#3020), anti-akt (pan, Cat#4691), anti-phospho-akt
More informationevaluated with UAS CLB eliciting UAS CIT -N Libraries increase in the
Supplementary Figures Supplementary Figure 1: Promoter scaffold library assemblies. Many ensembless of libraries were evaluated in this work. As a legend, the box outline color in top half of the figure
More informationConverting rabbit hybridoma into recombinant antibodies with effective transient production in an optimized human expression system
Converting rabbit hybridoma into recombinant antibodies with effective transient production in an optimized human expression system Dr. Tim Welsink Molecular Biology Transient Gene Expression OUTLINE Short
More informationAn engineered tryptophan zipper-type peptide as a molecular recognition scaffold
SUPPLEMENTARY MATERIAL An engineered tryptophan zipper-type peptide as a molecular recognition scaffold Zihao Cheng and Robert E. Campbell* Supplementary Methods Library construction for FRET-based screening
More informationSUPPLEMENTARY MATERIALS
SUPPLEMENTARY MATERIALS Supplementary Table S1: Water sampling sites in Brisbane River and their characteristics Sampling sites GPS coordinates Site characteristics Suspected source of fecal pollution
More informationSupplementary Information
Supplementary Information Microbead-based biomimetic synthetic neighbors enhance survival and function of rat pancreatic β-cells Wei Li, a Samuel Lee, b Minglin Ma, a, f Soo Min Kim, b Patrick Guye, c
More informationDierks Supplementary Fig. S1
Dierks Supplementary Fig. S1 ITK SYK PH TH K42R wt K42R (kinase deficient) R29C E42K Y323F R29C E42K Y323F (reduced phospholipid binding) (enhanced phospholipid binding) (reduced Cbl binding) E42K Y323F
More informationHomework. A bit about the nature of the atoms of interest. Project. The role of electronega<vity
Homework Why cited articles are especially useful. citeulike science citation index When cutting and pasting less is more. Project Your protein: I will mail these out this weekend If you haven t gotten
More informationSUPPLEMENTARY MATERIALS AND METHODS. E. coli strains, plasmids, and growth conditions. Escherichia coli strain P90C (1)
SUPPLEMENTARY MATERIALS AND METHODS E. coli strains, plasmids, and growth conditions. Escherichia coli strain P90C (1) dinb::kan (lab stock) derivative was used as wild-type. MG1655 alka tag dinb (2) is
More informationDet matematisk-naturvitenskapelige fakultet
UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam: Friday
More informationSequencing of DNA lesions facilitated by site-specific excision via base. excision repair DNA glycosylases yielding ligatable gaps
Supporting information Sequencing of DNA lesions facilitated by site-specific excision via base excision repair DNA glycosylases yielding ligatable gaps Jan Riedl, Aaron M. Fleming, and Cynthia J. Burrows*
More informationSupplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR
Supplemental Dataset Supplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. DNA sequence Amino acid sequence WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR Allele 1 CCTGTC------------------GATAGC
More informationAppendix 1a. Microsatellite analysis of P1-hyg, P2-neo and their. Amplified cdna (base pairs) P1-hyg P2-neo All progeny A A
Supplementary information Appendix 1a. Microsatellite analysis of P1-hyg, P2-neo and their double drug resistant progeny (ABI 377). Primer set a,b Amplified cdna (base pairs) P1-hyg P2-neo All progeny
More informationSupplemental Figure 1 Real-time RT-PCR analysis of 16 genes other than those shown in Fig. 6C.
arbitrary At1g02813 unit expressed protein Relative mrna amount 5.0 4.0 3.0 (X3.7) (X118) (X1.7) 5.6% act At1g06990 GDSL-motif lipase 3.0 (X2.2) /hydrolase (X39) (X1.3) 2.8% act At1g23590 expressed protein
More informationWet Lab Tutorial: Genelet Circuits
Wet Lab Tutorial: Genelet Circuits DNA 17 This tutorial will introduce the in vitro transcriptional circuits toolkit. The tutorial will focus on the design, synthesis, and experimental testing of a synthetic
More informationSupplemental Information. Target-Mediated Protection of Endogenous. MicroRNAs in C. elegans. Inventory of Supplementary Information
Developmental Cell, Volume 20 Supplemental Information Target-Mediated Protection of Endogenous MicroRNAs in C. elegans Saibal Chatterjee, Monika Fasler, Ingo Büssing, and Helge Großhans Inventory of Supplementary
More informationYeast BioBrick Assembly (YBA)
Yeast BioBrick Assembly (YBA) Standardized method for vector assembly of BioBrick devices via homologous recombination in Saccharomyces cerevisiae Martin Schneider, Leonard Fresenborg, Virginia Schadeweg
More informationS4B fluorescence (AU)
A S4B fluorescence (AU) S4B fluorescence (AU) dsbb csgba csgd dsbb csgba bcsa 5000 * NS NS 4000 * 3000 2000 1000 0 ΔcsgBAΔbcsA ΔcsgDΔdsbBΔbcsA ΔcsgBA ΔdsbBΔcsgBA ΔcsgDΔdsbB B -1000 4000 * * NS 3500 * 3000
More informationSupporting Information
Supporting Information Transfection of DNA Cages into Mammalian Cells Email: a.turberfield@physics.ox.ac.uk Table of Contents Supporting Figure 1 DNA tetrahedra used in transfection experiments 2 Supporting
More informationI. Things to keep in mind before you start this protocol
Inverse PCR and Sequencing Protocol on 5 Fly Preps For recovery of sequences flanking piggybac elements This protocol is an adaptation of "Inverse PCR and Cycle Sequencing Protocols" by E. Jay Rehm Berkeley
More informationGenetic Diversity of Gold-Spotted Pond Frog, Rana chosenica in Korea
Genetic Diversity of Gold-Spotted Pond Frog, Rana chosenica in Korea Mi-Sook Min, Sun Kyung Park, Kelly Lasater, Hae Jun Baek, Dae Sik Park2, and Hang Lee 4 Seoul National University College of Veterinary
More informationSUPPLEMENTAL TABLE S1. Additional descriptions of plasmid constructions and the oligonucleotides used Plasmid or Oligonucleotide
SUPPLEMENTAL TABLE S1. Additional descriptions of plasmid constructions and the oligonucleotides used Plasmid or Oligonucleotide former/ working Description a designation Plasmids pes213a b pes213-tn5
More informationProject 07/111 Final Report October 31, Project Title: Cloning and expression of porcine complement C3d for enhanced vaccines
Project 07/111 Final Report October 31, 2007. Project Title: Cloning and expression of porcine complement C3d for enhanced vaccines Project Leader: Dr Douglas C. Hodgins (519-824-4120 Ex 54758, fax 519-824-5930)
More informationComplexity of the Ruminococcus flavefaciens FD-1 cellulosome reflects an expansion of family-related protein-protein interactions
Complexity of the Ruminococcus flavefaciens FD-1 cellulosome reflects an expansion of family-related protein-protein interactions Vered Israeli-Ruimy 1,*, Pedro Bule 2,*, Sadanari Jindou 3, Bareket Dassa
More informationSupporting Information
Supporting Information Barderas et al. 10.1073/pnas.0801221105 SI Text: Docking of gastrin to Constructed scfv Models Interactive predocking of the 4-WL-5 motif into the central pocket observed in the
More informationLecture 11: Gene Prediction
Lecture 11: Gene Prediction Study Chapter 6.11-6.14 1 Gene: A sequence of nucleotides coding for protein Gene Prediction Problem: Determine the beginning and end positions of genes in a genome Where are
More informationThe B1 Protein Guides the Biosynthesis of a Lasso Peptide
The B1 Protein Guides the Biosynthesis of a Lasso Peptide Shaozhou Zhu 1,2, Christopher D. Fage 1, Julian D. Hegemann 1, Andreas Mielcarek 1, Dushan Yan 1, Uwe Linne 1 & Mohamed A. Marahiel*,1 1 Department
More informationSupporting Information. Table of Contents
Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2015 Supporting Information Spatial Regulation of a Common Precursor from Two Distinct Genes
More informationLecture 19A. DNA computing
Lecture 19A. DNA computing What exactly is DNA (deoxyribonucleic acid)? DNA is the material that contains codes for the many physical characteristics of every living creature. Your cells use different
More informationEvent-specific Method for the Quantification of Maize Line LY038 Using Real-time PCR. Protocol
Event-specific Method for the Quantification of Maize Line LY038 Using Real-time PCR Protocol 6 October 2008 Joint Research Centre Institute for Health and Consumer Protection Biotechnology & GMOs Unit
More informationGenomics and Gene Recognition Genes and Blue Genes
Genomics and Gene Recognition Genes and Blue Genes November 1, 2004 Prokaryotic Gene Structure prokaryotes are simplest free-living organisms studying prokaryotes can give us a sense what is the minimum
More informationSupplementary Material and Methods
Supplementary Material and Methods Synaptosomes preparation and RT-PCR analysis. Synaptoneurosome fractions were prepared as previously described in 1. Briefly, rat total brain was homogenized in ice-cold
More informationfor Programmed Chemo-enzymatic Synthesis of Antigenic Oligosaccharides
Supporting Information Design of α-transglucosidases of Controlled Specificity for Programmed Chemo-enzymatic Synthesis of Antigenic Oligosaccharides Elise Champion ±,,,, Isabelle André ±,,, Claire Moulis
More information-15 diopter negative lenses in wild-type and homozygous CHRM2-deleted mice, and
Supplementary Materials Supplementary Figure 1: Myopia induction was performed using uniocular -10 and -15 diopter negative lenses in wild-type and homozygous CHRM2-deleted mice, and results at 2, 4 and
More informationSupplementary Figure 1. The level of pri-mir-8 gradually decreases while those of BR-C and E74 increase during 3rd instar larval development.
qrt-pcr RT-PCR Relative pri-mir-8 level 1.2 1.0 0.8 0.6 0.4 0.2 0.0 Early 3rd (72h) Mid 3rd (96h) Late 3rd (119h) BR-C E74 mtl rrna Early 3rd (72h) Mid 3rd (96h) Late 3rd (119h) Supplementary Figure 1.
More informationNature Genetics: doi: /ng Supplementary Figure 1
Supplementary Figure 1 Coding and noncoding transcription at the vg locus. (a,b) qpcr analysis of developmental and tissue-specific vg mrna (a) and PRE/TRE (b) transcription, shown as percentage of TBP
More informationDNA sentences. How are proteins coded for by DNA? Materials. Teacher instructions. Student instructions. Reflection
DNA sentences How are proteins coded for by DNA? Deoxyribonucleic acid (DNA) is the molecule of life. DNA is one of the most recognizable nucleic acids, a double-stranded helix. The process by which DNA
More informationG+C content. 1 Introduction. 2 Chromosomes Topology & Counts. 3 Genome size. 4 Replichores and gene orientation. 5 Chirochores.
1 Introduction 2 Chromosomes Topology & Counts 3 Genome size 4 Replichores and gene orientation 5 Chirochores 6 7 Codon usage 121 marc.bailly-bechet@univ-lyon1.fr Bacterial genome structures Introduction
More informationUse of the Agilent 2100 Bioanalyzer for Basmati Rice Authenticity Testing. Application. Author. Abstract: Introduction. Food
Use of the Agilent 2100 Bioanalyzer for Basmati Rice Authenticity Testing Application Food Author Steve Garrett and Marie-Anne Clarke Molecular Biology Group Dept. Chemistry & Biochemistry Campden & Chorleywood
More informationSupplementary Information
Supplementary Information A general solution for opening double-stranded DNA for isothermal amplification Gangyi Chen, Juan Dong, Yi Yuan, Na Li, Xin Huang, Xin Cui* and Zhuo Tang* Supplementary Materials
More informationEvent-specific Method for the Quantification of Maize MON Using Real-time PCR. Protocol
Event-specific Method for the Quantification of Maize MON 87460 Using Real-time PCR Protocol 18 January 2012 Joint Research Centre Institute for Health and Consumer Protection Molecular Biology and Genomics
More informationProtein Structure Analysis
BINF 731 Protein Structure Analysis http://binf.gmu.edu/vaisman/binf731/ Iosif Vaisman COMPUTATIONAL BIOLOGY COMPUTATIONAL STRUCTURAL BIOLOGY COMPUTATIONAL MOLECULAR BIOLOGY BIOINFORMATICS STRUCTURAL BIOINFORMATICS
More informationSUPPLEMENTARY INFORMATION. Material and methods
SUPPLEMENTARY INFORMATION Material and methods Cell culture Human hepatocellular carcinoma (HepG) cells and human embryonic kidney (HEK)93 cells were grown in Dulbecco s modified Eagle s medium (Invitrogen
More informationEvent-specific Method for the Quantification of maize MON by Real-time PCR. Validated Method
EUROPEAN COMMISSION JOINT RESEARCH CENTRE Health, Consumers & Reference Materials Food & Feed Compliance Unit Event-specific Method for the Quantification of maize MON 87403 by Real-time PCR Validated
More informationEvent-specific Method for the Quantification of Soybean SYHT0H2 by Real-time PCR. Validated Method
EUROPEAN COMMISSION JOINT RESEARCH CENTRE Institute for Health and Consumer Protection Molecular Biology and Genomics Unit Event-specific Method for the Quantification of Soybean SYHT0H2 by Real-time PCR
More information