Identifying recessive gene candidates with GEMINI
|
|
- Scarlett Neal
- 6 years ago
- Views:
Transcription
1 Identifying recessive gene candidates with GEMINI Aaron Quinlan University of Utah! quinlanlab.org Please refer to the following Github Gist to find each command for this session. Commands should be copy/pasted from this Gist 1
2 Compound heterozygote detective work with GEMINI 2
3 Compound het refresher 3
4 Example compound heterozygote Dad Mom G a G G Kid C C t C a G C t T 4
5 Phasing genotypes 5 Jessica Chong
6 The result of phasing by transmission 6 Jessica Chong
7 Phasing a VCF file by transmission with GATK Jessica Chong 7 Jessica Chong
8 Phasing a VCF file by transmission with GATK Jessica Chong G/G 7 Jessica Chong
9 Phasing a VCF file by transmission with GATK Jessica Chong G/G 7 Jessica Chong
10 Phasing a VCF file by transmission with GATK Jessica Chong G/G 7 Jessica Chong
11 Phasing a VCF file by transmission with GATK Jessica Chong G/G? 7 Jessica Chong
12 Phasing a VCF file by transmission with GEMINI 8
13 Phasing a VCF file by transmission with GEMINI G/G 8
14 Phasing a VCF file by transmission with GEMINI G/G 8
15 Phasing a VCF file by transmission with GEMINI G/G 8
16 Phasing a VCF file by transmission with GEMINI G/G? 8
17 Phasing by transmission C/C 9 * Convention for phased genotype is maternal allele first
18 Phasing by transmission C/C G A C T Both sites phasable: high confidence as deleterious alleles on different chromosomes 9 * Convention for phased genotype is maternal allele first
19 Phasing by transmission C/C G/A C/C G A C T Both sites phasable: high confidence as deleterious alleles on different chromosomes 9 * Convention for phased genotype is maternal allele first
20 Phasing by transmission C/C G/A C/C G A C T G A T C Both sites phasable: high confidence as deleterious alleles on different chromosomes Both sites phasable: yet exclude as deleterious alleles on same chromosomes 9 * Convention for phased genotype is maternal allele first
21 Phasing by transmission C/C G/A C/C G A C T G A T C Both sites phasable: high confidence as deleterious alleles on different chromosomes Both sites phasable: yet exclude as deleterious alleles on same chromosomes G/G 9 * Convention for phased genotype is maternal allele first
22 Phasing by transmission C/C G/A C/C G A C T G A T C Both sites phasable: high confidence as deleterious alleles on different chromosomes Both sites phasable: yet exclude as deleterious alleles on same chromosomes G/G G A? Only one site is phasable: lower confidence but cannot necessarily exclude. 9 * Convention for phased genotype is maternal allele first
23 Phasing by transmission C/C G/A C/C G A C T G A T C Both sites phasable: high confidence as deleterious alleles on different chromosomes Both sites phasable: yet exclude as deleterious alleles on same chromosomes G/G G A? Only one site is phasable: lower confidence but cannot necessarily exclude. 9 * Convention for phased genotype is maternal allele first
24 Phasing by transmission C/C G/A C/C G A C T G A T C Both sites phasable: high confidence as deleterious alleles on different chromosomes Both sites phasable: yet exclude as deleterious alleles on same chromosomes G/G G A??? Only one site is phasable: lower confidence but cannot necessarily exclude. Neither site is phasable: lower confidence but cannot necessarily exclude (recombination?). 9 * Convention for phased genotype is maternal allele first
25 Compound het test case 10 Jessica Chong
26 The comp_hets tool in GEMINI Requires a PED file #family_id sample_id paternal_id maternal_id sex phenotype family family family
27 Create a GEMINI database from a VCF Notes: 1. The VCF has been normalized and decomposed with VT 2. The VCF has been annotated with VEP. $ curl tutorials/trio.trim.vep.vcf.gz > trio.trim.vep.vcf.gz $ curl tutorials/recessive.ped > recessive.ped $ gemini load - - cores 4\ - v trio.trim.vep.vcf.gz \ - t VEP \ - - skip- gene- tables \! - p recessive.ped \ trio.trim.vep.recessive.db Note: copy and paste the full command from the Github Gist to avoid errors
28 Running the comp_hets tool. gemini comp_hets trio.trim.vep.recessive.db Note: copy and paste the full command from the Github Gist 13
29 Again, we can limit the attributes returned w/ the --columns option. gemini comp_hets --columns "chrom, start, end, gene, impact, cadd_raw" trio.trim.vep.recessive.db Note: copy and paste the full command from the Github Gist chrom start end gene impact cadd_raw variant_id family_id family_members family_genotypes samples family_count comp_het_id priority chr AAK1 UTR_3_prime family1 1805;unaffected,1847;unaffected,4805;affected G/C,G/C,G/C _1638_ chr AAK1 UTR_5_prime family1 1805;unaffected,1847;unaffected,4805;affected G/G,G/A,G A _1638_ chr AAK1 UTR_3_prime family1 1805;unaffected,1847;unaffected,4805;affected A/C,A/C,A/C _1637_ chr AAK1 UTR_3_prime family1 1805;unaffected,1847;unaffected,4805;affected G/C,G/C,G/C _1637_ chr AAK1 UTR_3_prime family1 1805;unaffected,1847;unaffected,4805;affected T/T,T/T,T/C _1636_ chr AAK1 UTR_5_prime family1 1805;unaffected,1847;unaffected,4805;affected G/G,G/A,G A _1636_ chr AAK1 UTR_3_prime family1 1805;unaffected,1847;unaffected,4805;affected G/C,G/C,G/C _1638_ chr AAK1 UTR_5_prime None 1645 family1 1805;unaffected,1847;unaffected,4805;affected AT/A,AT/A,AT/A _1638_ chr AAK1 UTR_3_prime family1 1805;unaffected,1847;unaffected,4805;affected T/T,T/T,T/C _1636_
30 Start with highest priority compound heterozygote candidates C/C 15
31 Start with highest priority compound heterozygote candidates C/C G A C T Both sites phasable: high confidence as deleterious alleles on different chromosomes 15
32 Restrict to highest priority (i.e, priority==1) candidates $ gemini comp_hets \ --columns "chrom, start, end, gene, impact, cadd_raw" \ trio.trim.vep.recessive.db \ awk '$14==1' \ head chrom start end gene impact cadd_raw variant_id family_id family_members family_genotypes samples family_count comp_het_id priority chr ACAN non_syn_coding family1 1805;unaffected,1847;unaffected,4805;affected C/A,C/C,A C _9519_ chr ACAN non_syn_coding family1 1805;unaffected,1847;unaffected,4805;affected,,A G _9519_ chr ACAN non_syn_coding family1 1805;unaffected,1847;unaffected,4805;affected C/A,C/C,A C _9519_ chr ACAN splice_region family1 1805;unaffected,1847;unaffected,4805;affected G/G,G/A,G A _9519_ chr ACOXL non_syn_coding family1 1805;unaffected,1847;unaffected,4805;affected C/C,,C T _3247_ chr ACOXL non_syn_coding family1 1805;unaffected,1847;unaffected,4805;affected,C/C,T C _3247_ chr AKAP1 non_syn_coding family1 1805;unaffected,1847;unaffected,4805;affected,C/C,T C _13305_ chr AKAP1 synonymous_coding family1 1805;unaffected,1847;unaffected,4805;affected G/G,G/A,G A _13305_ chr ALK non_syn_coding family1 1805;unaffected,1847;unaffected,4805;affected T/T,T/G,T G _839_841 1 chr ALK non_syn_coding family1 1805;unaffected,1847;unaffected,4805;affected A/T,,T A _839_841 1 $ gemini comp_hets \ --columns "chrom, start, end, gene, impact, cadd_raw" \ trio.trim.vep.recessive.db \ awk '$14==1' \ wc -l 612 lines Note: copy and paste the full command from the Github Gist Each compund heterozygote is a set of two lines, so we have 306 (612 / 2) compound heterozygote candidates 16
33 So many candidates. Time to start --filtering! $ gemini comp_hets \ --columns "chrom, start, end, gene, impact, cadd_raw" \ --filter "impact_severity!= 'LOW'" \ trio.trim.vep.recessive.db \ awk '$14==1' \ wc -l Note: copy and paste the full command from the Github Gist 260 lines (130 comp_hets) 17
34 Use ESP and ExAC to focus on rare variants $ gemini comp_hets \ --columns "chrom, start, end, gene, impact, cadd_raw" \ --filter "impact_severity!= 'LOW' \ and ((aaf_esp_ea <= 0.01 or aaf_esp_ea is NULL) \ and (aaf_exac_all <= 0.01 or aaf_exac_all is NULL)) \ trio.trim.vep.recessive.db \ awk '$14==1' \ wc -l Note: copy and paste the full command from the Github Gist 8 lines, 4 comp_hets 18
35 Use ESP and ExAC to focus on rare variants $ gemini comp_hets \ --columns "chrom, start, end, gene, impact, cadd_raw" \ --filter "impact_severity!= 'LOW' \ and ((aaf_esp_ea <= 0.01 or aaf_esp_ea is NULL) \ and (aaf_exac_all <= 0.01 or aaf_exac_all is NULL)) \ trio.trim.vep.recessive.db \ awk '$14==1' Note: copy and paste the full command from the Github Gist chr GAA non_syn_coding family1 1805;unaffected,1847;unaffected4805;affected T/T,T/C,T C _14401_ chr GAA non_syn_coding family1 1805;unaffected,1847;unaffected4805;affected G/A,G/G,A G _14401_ chr HS6ST1 non_syn_coding family1 1805;unaffected,1847;unaffected4805;affected C/A,C/C,A C _3657_ chr HS6ST1 non_syn_coding family1 1805;unaffected,1847;unaffected4805;affected G/G,G/C,G C _3657_ chr PRR5- ARHGAP8 non_syn_coding family1 1805;unaffected,1847;unaffected4805;affected G/G,G/T,G T _16838_ chr PRR5- ARHGAP8 non_syn_coding family1 1805;unaffected,1847;unaffected4805;affected,C/C,T C _16838_ chr THSD4 non_syn_coding family1 1805;unaffected,1847;unaffected4805;affected C/C,,C T _8777_ chr THSD4 non_syn_coding family1 1805;unaffected,1847;unaffected4805;affected G/A,G/G,A G _8777_
36 Load the following files into IGV (Load from URL) and inspect your candidates BAM alignment files:! tutorials/1805.workshop.bam tutorials/1847.workshop.bam tutorials/4805.workshop.bam VCF variant file:! tutorials/trio.trim.vep.vcf.gz! 20
37 Finding recessive genes with GEMINI assuming consanguinuity 21
38 The autosomal_recessive tool. 22
39 The autosomal_recessive tool. Default behavior: 23
40 The autosomal_recessive tool. The - - min- kindreds option: This specifies the number of families required to have a variant in the same gene in order for it to be reported. For example, we may only be interested in candidates where at least 2 families have a variant in that gene. 24
41 The autosomal_recessive tool. - - filter for variants with potential functional consequence: 25
42 The autosomal_recessive tool: other options The gt- pl- max option: In order to eliminate less confident genotypes, it is possible to enforce a maximum PL value for each sample. On this scale, lower values indicate more confidence that the called genotype is correct. 10 is a reasonable value: What is the PL? What is a Phred scaled genotype likelihood? 26
43 The autosomal_recessive tool: other options What is a Phred scaled genotype likelihood? Example calculation based on the GATK HaplotypeCaller 27
44 Runs of homozygosity Method 1: intersecting with previously known regions 28
45 Intersect with observed homozygosity region(s) (Example commands) 1. Tabix a BED file with the observed homozygosity regions bgzip homoz_region.bed tabix -p bed homoz_region.bed.gz 2. Use the annotate tool to flag variants that overlap these regions. gemini annotate -f homoz_region.bed.gz \ c homoz_region \ -t boolean \ AR.db 3. Filter variants for those that overlap these regions. gemini autosomal_recessive AR.db --columns "chrom, start, end, ref, alt, filter, qual, gene, impact, aaf_esp_ea, aaf_1kg_eur - filter "filter is NULL and aaf_esp_ea < 0.1 and (impact_severity = 'HIGH' or impact_severity = 'MED') and region ==1 29
46 Runs of homozygosity Method 2: search for runs of homozygosity 30
47 Intersect with observed homozygosity region(s) Run the roh tool to search for candidate runs of homozygosity. gemini roh AR.db 31
48 Intersect with observed homozygosity region(s) Run the roh tool to search for candidate runs of homozygosity. gemini roh AR.db sort -k7nr chrom start end sample num_of_snps density_per_kb run_length_in_bp! chr S ! chr S ! chr S ! chr S ! chr S ! chr S ! chr S ! chr S ! chr S ! chr S ! chr S ! chr S ! chr S ! chr S ! chr S ! chr S ! chr S ! chr S ! chr S
49 Caveats when screening for runs of homozygosity 1. Difficult with exome data. Density of markers. 2. Shorter runs of homozygosity happen often by chance. 3. Density of homozygotes is important. 33
Identifying dominant gene candidates with GEMINI
Identifying dominant gene candidates with GEMINI Aaron Quinlan University of Utah! quinlanlab.org Please refer to the following Github Gist to find each command for this session. Commands should be copy/pasted
More informationPrioritization: from vcf to finding the causative gene
Prioritization: from vcf to finding the causative gene vcf file making sense A vcf file from an exome sequencing project may easily contain 40-50 thousand variants. In order to optimize the search for
More informationWhat is genetic variation?
enetic Variation Applied Computational enomics, Lecture 05 https://github.com/quinlan-lab/applied-computational-genomics Aaron Quinlan Departments of Human enetics and Biomedical Informatics USTAR Center
More informationRareVariantVis 2: R suite for analysis of rare variants in whole genome sequencing data.
RareVariantVis 2: R suite for analysis of rare variants in whole genome sequencing data. Adam Gudyś and Tomasz Stokowy October 30, 2017 Introduction The search for causative genetic variants in rare diseases
More informationBICF Variant Analysis Tools. Using the BioHPC Workflow Launching Tool Astrocyte
BICF Variant Analysis Tools Using the BioHPC Workflow Launching Tool Astrocyte Prioritization of Variants SNP INDEL SV Astrocyte BioHPC Workflow Platform Allows groups to give easy-access to their analysis
More informationBioinformatics small variants Data Analysis. Guidelines. genomescan.nl
Next Generation Sequencing Bioinformatics small variants Data Analysis Guidelines genomescan.nl GenomeScan s Guidelines for Small Variant Analysis on NGS Data Using our own proprietary data analysis pipelines
More informationRV-TDT: Rare Variant Extensions of the Transmission Disequilibrium Test
RV-TDT: Rare Variant Extensions of the Transmission Disequilibrium Test Copyrighted 2018 Zongxiao He & Suzanne M. Leal Introduction Many population-based rare-variant association tests, which aggregate
More informationVariant prioritization in NGS studies: Annotation and Filtering "
Variant prioritization in NGS studies: Annotation and Filtering Colleen J. Saunders (PhD) DST/NRF Innovation Postdoctoral Research Fellow, South African National Bioinformatics Institute/MRC Unit for Bioinformatics
More informationGenomics: Human variation
Genomics: Human variation Lecture 1 Introduction to Human Variation Dr Colleen J. Saunders, PhD South African National Bioinformatics Institute/MRC Unit for Bioinformatics Capacity Development, University
More informationC3BI. VARIANTS CALLING November Pierre Lechat Stéphane Descorps-Declère
C3BI VARIANTS CALLING November 2016 Pierre Lechat Stéphane Descorps-Declère General Workflow (GATK) software websites software bwa picard samtools GATK IGV tablet vcftools website http://bio-bwa.sourceforge.net/
More informationSNP calling and VCF format
SNP calling and VCF format Laurent Falquet, Oct 12 SNP? What is this? A type of genetic variation, among others: Family of Single Nucleotide Aberrations Single Nucleotide Polymorphisms (SNPs) Single Nucleotide
More informationAnalysis of neo-antigens to identify T-cell neo-epitopes in human Head & Neck cancer. Project XX1001. Customer Detail
Analysis of neo-antigens to identify T-cell neo-epitopes in human Head & Neck cancer Project XX Customer Detail Table of Contents. Bioinformatics analysis pipeline...3.. Read quality check. 3.2. Read alignment...3.3.
More informationSNP calling. Jose Blanca COMAV institute bioinf.comav.upv.es
SNP calling Jose Blanca COMAV institute bioinf.comav.upv.es SNP calling Genotype matrix Genotype matrix: Samples x SNPs SNPs and errors A change in a read may due to: Sample contamination Cloning or PCR
More informationVariant Analysis. CB2-201 Computational Biology and Bioinformatics! February 27, Emidio Capriotti!
Variant Analysis CB2-201 Computational Biology and Bioinformatics February 27, 2015 Emidio Capriotti http://biofold.org/emidio Division of Informatics Department of Pathology Variant Call Format The final
More informationAnnotating your variants: Ensembl Variant Effect Predictor (VEP) Helen Sparrow Ensembl EMBL-EBI 2nd November 2016
Training materials Ensembl training materials are protected by a CC BY license http://creativecommons.org/licenses/by/4.0/ If you wish to re-use these materials, please credit Ensembl for their creation
More informationVariant calling workflow for the Oncomine Comprehensive Assay using Ion Reporter Software v4.4
WHITE PAPER Oncomine Comprehensive Assay Variant calling workflow for the Oncomine Comprehensive Assay using Ion Reporter Software v4.4 Contents Scope and purpose of document...2 Content...2 How Torrent
More informationVariant calling in NGS experiments
Variant calling in NGS experiments Jorge Jiménez jjimeneza@cipf.es BIER CIBERER Genomics Department Centro de Investigacion Principe Felipe (CIPF) (Valencia, Spain) 1 Index 1. NGS workflow 2. Variant calling
More informationNext Generation Sequencing: Data analysis for genetic profiling
Next Generation Sequencing: Data analysis for genetic profiling Raed Samara, Ph.D. Global Product Manager Raed.Samara@QIAGEN.com Welcome to the NGS webinar series - 2015 NGS Technology Webinar 1 NGS: Introduction
More informationIntroduction to Next Generation Sequencing (NGS) Andrew Parrish Exeter, 2 nd November 2017
Introduction to Next Generation Sequencing (NGS) Andrew Parrish Exeter, 2 nd November 2017 Topics to cover today What is Next Generation Sequencing (NGS)? Why do we need NGS? Common approaches to NGS NGS
More informationMPG NGS workshop I: SNP calling
MPG NGS workshop I: SNP calling Mark DePristo Manager, Medical and Popula
More informationFrom raw reads to variants
From raw reads to variants Sebastian DiLorenzo Sebastian.DiLorenzo@NBIS.se Talk Overview Concepts Reference genome Variants Paired-end data NGS Workflow Quality control & Trimming Alignment Local realignment
More informationNovel Variant Discovery Tutorial
Novel Variant Discovery Tutorial Release 8.4.0 Golden Helix, Inc. August 12, 2015 Contents Requirements 2 Download Annotation Data Sources...................................... 2 1. Overview...................................................
More informationUSER MANUAL for the use of the human Genome Clinical Annotation Tool (h-gcat) uthors: Klaas J. Wierenga, MD & Zhijie Jiang, P PhD
USER MANUAL for the use of the human Genome Clinical Annotation Tool (h-gcat)) Authors: Klaas J. Wierenga, MD & Zhijie Jiang, PhD First edition, May 2013 0 Introduction The Human Genome Clinical Annotation
More informationAnswers to additional linkage problems.
Spring 2013 Biology 321 Answers to Assignment Set 8 Chapter 4 http://fire.biol.wwu.edu/trent/trent/iga_10e_sm_chapter_04.pdf Answers to additional linkage problems. Problem -1 In this cell, there two copies
More informationExploring genomic databases: Practical session "
Exploring genomic databases: Practical session Work through the following practical exercises on your own. The objective of these exercises is to become familiar with the information available in each
More informationAssignment 9: Genetic Variation
Assignment 9: Genetic Variation Due Date: Friday, March 30 th, 2018, 10 am In this assignment, you will profile genome variation information and attempt to answer biologically relevant questions. The variant
More informationEdexcel (B) Biology A-level
Edexcel (B) Biology A-level Topic 8: Origins of Genetic Variation Notes Meiosis is reduction division. The main role of meiosis is production of haploid gametes as cells produced by meiosis have half the
More informationHardy Weinberg Equilibrium
Gregor Mendel Hardy Weinberg Equilibrium Lectures 4-11: Mechanisms of Evolution (Microevolution) Hardy Weinberg Principle (Mendelian Inheritance) Genetic Drift Mutation Sex: Recombination and Random Mating
More informationEvidence of Purifying Selection in Humans. John Long Mentor: Angela Yen (Kellis Lab)
Evidence of Purifying Selection in Humans John Long Mentor: Angela Yen (Kellis Lab) Outline Background Genomes Expression Regulation Selection Goal Methods Progress Future Work Outline Background Genomes
More informationSupplementary Figures
1 Supplementary Figures exm26442 2.40 2.20 2.00 1.80 Norm Intensity (B) 1.60 1.40 1.20 1 0.80 0.60 0.40 0.20 2 0-0.20 0 0.20 0.40 0.60 0.80 1 1.20 1.40 1.60 1.80 2.00 2.20 2.40 2.60 2.80 Norm Intensity
More informationCourse Presentation. Ignacio Medina Presentation
Course Index Introduction Agenda Analysis pipeline Some considerations Introduction Who we are Teachers: Marta Bleda: Computational Biologist and Data Analyst at Department of Medicine, Addenbrooke's Hospital
More informationVariant Finding. UCD Genome Center Bioinformatics Core Wednesday 30 August 2016
Variant Finding UCD Genome Center Bioinformatics Core Wednesday 30 August 2016 Types of Variants Adapted from Alkan et al, Nature Reviews Genetics 2011 Why Look For Variants? Genotyping Correlation with
More informationAutozygosity by difference a method for locating autosomal recessive mutations. Geoff Pollott
Autozygosity by difference a method for locating autosomal recessive mutations Geoff Pollott Background Mutations occur regularly in all species Autosomal recessive conditions arise in most breeds from
More informationBulked Segregant Analysis For Fine Mapping Of Genes. Cheng Zou, Qi Sun Bioinformatics Facility Cornell University
Bulked Segregant Analysis For Fine Mapping Of enes heng Zou, Qi Sun Bioinformatics Facility ornell University Outline What is BSA? Keys for a successful BSA study Pipeline of BSA extended reading ompare
More informationTHE HEALTH AND RETIREMENT STUDY: GENETIC DATA UPDATE
: GENETIC DATA UPDATE April 30, 2014 Biomarker Network Meeting PAA Jessica Faul, Ph.D., M.P.H. Health and Retirement Study Survey Research Center Institute for Social Research University of Michigan HRS
More informationCOMPUTER SIMULATIONS AND PROBLEMS
Exercise 1: Exploring Evolutionary Mechanisms with Theoretical Computer Simulations, and Calculation of Allele and Genotype Frequencies & Hardy-Weinberg Equilibrium Theory INTRODUCTION Evolution is defined
More informationExome Sequencing and Disease Gene Search
Exome Sequencing and Disease Gene Search Erzurumluoglu AM, Rodriguez S, Shihab HA, Baird D, Richardson TG, Day IN, Gaunt TR. Identifying Highly Penetrant Disease Causal Mutations Using Next Generation
More informationMining GWAS Catalog & 1000 Genomes Dataset. Segun Fatumo
Mining GWAS Catalog & 1000 Genomes Dataset Segun Fatumo What is GWAS Catalog NHGRI GWA Catalog www.genome.gov/gwastudies Citation How to cite the NHGRI GWAS Catalog: Hindorff LA, MacArthur J (European
More informationUsing VarSeq to Improve Variant Analysis Research
Using VarSeq to Improve Variant Analysis Research June 10, 2015 G Bryce Christensen Director of Services Questions during the presentation Use the Questions pane in your GoToWebinar window Agenda 1 Variant
More informationLECTURE 5: LINKAGE AND GENETIC MAPPING
LECTURE 5: LINKAGE AND GENETIC MAPPING Reading: Ch. 5, p. 113-131 Problems: Ch. 5, solved problems I, II; 5-2, 5-4, 5-5, 5.7 5.9, 5-12, 5-16a; 5-17 5-19, 5-21; 5-22a-e; 5-23 The dihybrid crosses that we
More informationMedSavant: An open source platform for personal genome interpretation
MedSavant: An open source platform for personal genome interpretation Marc Fiume 1, James Vlasblom 2, Ron Ammar 3, Orion Buske 1, Eric Smith 1, Andrew Brook 1, Sergiu Dumitriu 2, Christian R. Marshall
More informationVARIANT ANNOTATION. Vivien Deshaies.
VARIANT ANNOTATION Vivien Deshaies vivien.deshaies@icm-institute.org Goal Add meta-information on variant to facilitate interpretation Location TSS Exon Intron Exon Intron Exon 5 3 upstream Donor Acceptor
More informationVariant Quality Score Recalibra2on
talks Variant Quality Score Recalibra2on Assigning accurate confidence scores to each puta2ve muta2on call You are here in the GATK Best Prac2ces workflow for germline variant discovery Data Pre-processing
More informationGenomic resources. for non-model systems
Genomic resources for non-model systems 1 Genomic resources Whole genome sequencing reference genome sequence comparisons across species identify signatures of natural selection population-level resequencing
More informationEnsembl Tools. EBI is an Outstation of the European Molecular Biology Laboratory.
Ensembl Tools EBI is an Outstation of the European Molecular Biology Laboratory. Questions? We ve muted all the mics Ask questions in the Chat box in the webinar interface I will check the Chat box periodically
More information1. What is the wild-type phenotype? 2. What is the assay? 3. Who are the mutants? Fascinated, Garrod decided to study the disease more.
B. Pedigrees In 1901 a physician in London named Archibald Garrod had some new patients with an unusual condition: when their urine came into contact with air it turned black. 1. What is the wild-type
More informationAnalytics Behind Genomic Testing
A Quick Guide to the Analytics Behind Genomic Testing Elaine Gee, PhD Director, Bioinformatics ARUP Laboratories 1 Learning Objectives Catalogue various types of bioinformatics analyses that support clinical
More informationSingle Nucleotide Variant Analysis. H3ABioNet May 14, 2014
Single Nucleotide Variant Analysis H3ABioNet May 14, 2014 Outline What are SNPs and SNVs? How do we identify them? How do we call them? SAMTools GATK VCF File Format Let s call variants! Single Nucleotide
More informationPLINK gplink Haploview
PLINK gplink Haploview Whole genome association software tutorial Shaun Purcell Center for Human Genetic Research, Massachusetts General Hospital, Boston, MA Broad Institute of Harvard & MIT, Cambridge,
More informationOral Cleft Targeted Sequencing Project
Oral Cleft Targeted Sequencing Project Oral Cleft Group January, 2013 Contents I Quality Control 3 1 Summary of Multi-Family vcf File, Jan. 11, 2013 3 2 Analysis Group Quality Control (Proposed Protocol)
More informationGenome STRiP ASHG Workshop demo materials. Bob Handsaker October 19, 2014
Genome STRiP ASHG Workshop demo materials Bob Handsaker October 19, 2014 Running Genome STRiP directly on AWS Genome STRiP Structure in Populations Popula'on)aware-discovery-andgenotyping-of-structural-varia'onfrom-whole)genome-sequencing-
More informationModule 2: Introduction to PLINK and Quality Control
Module 2: Introduction to PLINK and Quality Control 1 Introduction to PLINK 2 Quality Control 1 Introduction to PLINK 2 Quality Control Single Nucleotide Polymorphism (SNP) A SNP (pronounced snip) is a
More informationLD Mapping and the Coalescent
Zhaojun Zhang zzj@cs.unc.edu April 2, 2009 Outline 1 Linkage Mapping 2 Linkage Disequilibrium Mapping 3 A role for coalescent 4 Prove existance of LD on simulated data Qualitiative measure Quantitiave
More informationNGS in Pathology Webinar
NGS in Pathology Webinar NGS Data Analysis March 10 2016 1 Topics for today s presentation 2 Introduction Next Generation Sequencing (NGS) is becoming a common and versatile tool for biological and medical
More informationIntroduction to Genetics. Bruce Walsh lecture notes Uppsala EQG course version 28 Jan 2012
Introduction to Genetics Bruce Walsh lecture notes Uppsala EQG course version 28 Jan 2012 Darwin and Mendel Mendel genetics Topics Mendel's experiments Mendel's laws Genes and chromosomes Linkage Prior
More informationGenomic management of inbreeding in breeding schemes
Genomic management of inbreeding in breeding schemes Theo Meuwissen, Anna Sonesson, John Woolliams Norwegian University of Life Sciences, Ås, Norway. NOFIMA, Ås, Norway Roslin Institute, Edinburgh, UK
More information4) How many alleles does each individual carry? 5) How many total alleles do we need to create this population?
SC135 Introductory Biology Hardy-Weinberg and Natural Selection with M & M s Lab Objectives: Understand the concepts of allele frequency, genotype frequency and phenotype frequency in a population. Understand
More informationAlignment & Variant Discovery. J Fass UCD Genome Center Bioinformatics Core Tuesday June 17, 2014
Alignment & Variant Discovery J Fass UCD Genome Center Bioinformatics Core Tuesday June 17, 2014 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG
More information-Genes on the same chromosome are called linked. Human -23 pairs of chromosomes, ~35,000 different genes expressed.
Linkage -Genes on the same chromosome are called linked Human -23 pairs of chromosomes, ~35,000 different genes expressed. - average of 1,500 genes/chromosome Following Meiosis Parental chromosomal types
More informationShaare Zedek Medical Center (SZMC) Gaucher Clinic. Peripheral blood samples were collected from each
SUPPLEMENTAL METHODS Sample collection and DNA extraction Pregnant Ashkenazi Jewish (AJ) couples, carrying mutation/s in the GBA gene, were recruited at the Shaare Zedek Medical Center (SZMC) Gaucher Clinic.
More informationAnnotation of Genetic Variants
Annotation of Genetic Variants Valerie Obenchain Fred Hutchinson Cancer Research Center 27-28 February 2012 Read VCF Files Structural location of variants Amino acid coding changes Extras Outline Read
More informationDNA Collection. Data Quality Control. Whole Genome Amplification. Whole Genome Amplification. Measure DNA concentrations. Pros
DNA Collection Data Quality Control Suzanne M. Leal Baylor College of Medicine sleal@bcm.edu Copyrighted S.M. Leal 2016 Blood samples For unlimited supply of DNA Transformed cell lines Buccal Swabs Small
More informationThe Revolution in Human Genetics: Deciphering Complexity. David Galas Institute for Systems Biology, Seattle, WA
The Revolution in Human Genetics: Deciphering Complexity David Galas Institute for Systems Biology, Seattle, WA Genetics and Environment integration is key to future medicine Genome Blood proteins, mirna,
More informationAlignment. J Fass UCD Genome Center Bioinformatics Core Wednesday December 17, 2014
Alignment J Fass UCD Genome Center Bioinformatics Core Wednesday December 17, 2014 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG
More informationVariant Calling CHRIS FIELDS MAYO-ILLINOIS COMPUTATIONAL GENOMICS WORKSHOP, JUNE 19, 2017
Variant Calling CHRIS FIELDS MAYO-ILLINOIS COMPUTATIONAL GENOMICS WORKSHOP, JUNE 19, 2017 Up-front acknowledgments Many figures/slides come from: GATK Workshop slides: http://www.broadinstitute.org/gatk/guide/events?id=2038
More informationIntroduc)on to Genomics
Introduc)on to Genomics Libor Mořkovský, Václav Janoušek, Anastassiya Zidkova, Anna Přistoupilová, Filip Sedlák h1p://ngs-course.readthedocs.org/en/praha-january-2017/ Genome The genome is the gene,c material
More informationMapping errors require re- alignment
RE- ALIGNMENT Mapping errors require re- alignment Source: Heng Li, presenta8on at GSA workshop 2011 Alignment Key component of alignment algorithm is the scoring nega8ve contribu8on to score opening a
More informationAssociation Mapping. Mendelian versus Complex Phenotypes. How to Perform an Association Study. Why Association Studies (Can) Work
Genome 371, 1 March 2010, Lecture 13 Association Mapping Mendelian versus Complex Phenotypes How to Perform an Association Study Why Association Studies (Can) Work Introduction to LOD score analysis Common
More informationBIOLOGY - CLUTCH CH.14 - MENDELIAN GENETICS.
!! www.clutchprep.com CONCEPT: MENDEL S EXPERIMENT Gregor Mendel designed an experiment to study inheritance in pea plants. Character a feature that can be inherited, and shows variation between individuals
More informationSelecting TILLING mutants
Selecting TILLING mutants The following document will explain how to select TILLING mutants for your gene(s) of interest. To begin, you will need the IWGSC gene model identifier for your gene(s), the IWGSC
More informationTrimethylaminuria (TMAU) Yiran Guo, Ph.D. Center for Applied Genomics Children's Hospital of Philadelphia
Trimethylaminuria (TMAU) Yiran Guo, Ph.D. Center for Applied Genomics Children's Hospital of Philadelphia TMAU Genetics Background in Human Genetics Human genome variants and methods to detect them Rare
More informationHuman linkage analysis. fundamental concepts
Human linkage analysis fundamental concepts Genes and chromosomes Alelles of genes located on different chromosomes show independent assortment (Mendel s 2nd law) For 2 genes: 4 gamete classes with equal
More informationIntroducing combined CGH and SNP arrays for cancer characterisation and a unique next-generation sequencing service. Dr. Ruth Burton Product Manager
Introducing combined CGH and SNP arrays for cancer characterisation and a unique next-generation sequencing service Dr. Ruth Burton Product Manager Today s agenda Introduction CytoSure arrays and analysis
More informationGenetics II: Linkage and the Chromosomal Theory
Genetics II: Linkage and the Chromosomal Theory An individual has two copies of each particle of inheritance (gene). These two copies separate during the formation of gametes and come together when the
More informationPapers for 11 September
Papers for 11 September v Kreitman M (1983) Nucleotide polymorphism at the alcohol-dehydrogenase locus of Drosophila melanogaster. Nature 304, 412-417. v Hishimoto et al. (2010) Alcohol and aldehyde dehydrogenase
More informationGermline variant calling and joint genotyping
talks Germline variant calling and joint genotyping Applying the joint discovery workflow with HaplotypeCaller + GenotypeGVCFs You are here in the GATK Best PracDces workflow for germline variant discovery
More informationBasic Concepts of Human Genetics
Basic Concepts of Human Genetics The genetic information of an individual is contained in 23 pairs of chromosomes. Every human cell contains the 23 pair of chromosomes. One pair is called sex chromosomes
More informationQTL Mapping, MAS, and Genomic Selection
QTL Mapping, MAS, and Genomic Selection Dr. Ben Hayes Department of Primary Industries Victoria, Australia A short-course organized by Animal Breeding & Genetics Department of Animal Science Iowa State
More informationHow to use Variant Effects Report
How to use Variant Effects Report A. Introduction to Ensembl Variant Effect Predictor B. Using RefSeq_v1 C. Using TGACv1 A. Introduction The Ensembl Variant Effect Predictor is a toolset for the analysis,
More informationLinkage & Genetic Mapping in Eukaryotes. Ch. 6
Linkage & Genetic Mapping in Eukaryotes Ch. 6 1 LINKAGE AND CROSSING OVER! In eukaryotic species, each linear chromosome contains a long piece of DNA A typical chromosome contains many hundred or even
More information7.03 Problem Set 1 Solutions
7.03 Problem Set 1 Solutions 1. a. Crossing each yeast haploid mutant to wild-type will tell you whether the mutation is recessive or dominant to wild-type. If the diploid is wild-type phenotype, then
More informationCITATION FILE CONTENT / FORMAT
CITATION 1) For any resultant publications using single samples please cite: Matthew A. Field, Vicky Cho, T. Daniel Andrews, and Chris C. Goodnow (2015). "Reliably detecting clinically important variants
More informationHuman Genetic Variation. Ricardo Lebrón Dpto. Genética UGR
Human Genetic Variation Ricardo Lebrón rlebron@ugr.es Dpto. Genética UGR What is Genetic Variation? Origins of Genetic Variation Genetic Variation is the difference in DNA sequences between individuals.
More informationRP1: AN EXAMPLE OF REVERSE GENETICS APPROACH TO DESCRIBE COMMON RECESSIVE DEFECTS
RP1: AN EXAMPLE OF REVERSE GENETICS APPROACH TO DESCRIBE COMMON RECESSIVE DEFECTS C. Grohs GABI, INRA, AgroParisTech, Université Paris Saclay 28 / 08 / 2017 Outbreaks of recessive defects as a consequence
More informationANNOVAR Variant Annotation and Interpretation
1 ANNOVAR Variant Annotation and Interpretation Copyrighted 2018 Isabelle Schrauwen and Suzanne M. Leal This exercise touches on several functionalities of the program ANNOVAR to annotate and interpret
More informationLesson Overview. What would happen when genetics answered questions about how heredity works?
17.1 Darwin developed his theory of evolution without knowing how heritable traits passed from one generation to the next or where heritable variation came from. What would happen when genetics answered
More informationThe Evolution of Populations
The Evolution of Populations What you need to know How and reproduction each produce genetic. The conditions for equilibrium. How to use the Hardy-Weinberg equation to calculate allelic and to test whether
More informationSupplementary information ATLAS
Supplementary information ATLAS Vivian Link, Athanasios Kousathanas, Krishna Veeramah, Christian Sell, Amelie Scheu and Daniel Wegmann Section 1: Complete list of functionalities Sequence data processing
More informationFrom Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow
From Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow Technical Overview Import VCF Introduction Next-generation sequencing (NGS) studies have created unanticipated challenges with
More informationMendel & Inheritance. SC.912.L.16.1 Use Mendel s laws of segregation and independent assortment to analyze patterns of inheritance.
Mendel & Inheritance SC.912.L.16.1 Use Mendel s laws of segregation and independent assortment Mendel s Law of Segregation: gene pairs separate when gametes (sex cells) are formed; each gamete as only
More informationBriefly, this exercise can be summarised by the follow flowchart:
Workshop exercise Data integration and analysis In this exercise, we would like to work out which GWAS (genome-wide association study) SNP associated with schizophrenia is most likely to be functional.
More informationPopulation and Community Dynamics. The Hardy-Weinberg Principle
Population and Community Dynamics The Hardy-Weinberg Principle Key Terms Population: same species, same place, same time Gene: unit of heredity. Controls the expression of a trait. Can be passed to offspring.
More informationWhole Genome Sequencing. Biostatistics 666
Whole Genome Sequencing Biostatistics 666 Genomewide Association Studies Survey 500,000 SNPs in a large sample An effective way to skim the genome and find common variants associated with a trait of interest
More informationNormal-Tumor Comparison using Next-Generation Sequencing Data
Normal-Tumor Comparison using Next-Generation Sequencing Data Chun Li Vanderbilt University Taichung, March 16, 2011 Next-Generation Sequencing First-generation (Sanger sequencing): 115 kb per day per
More information1. A dihybrid YyZz is test crossed. The following phenotypic classes are observed:
Problem Set 4 Genetics 371 Winter 2010 1. A dihybrid YyZz is test crossed. The following phenotypic classes are observed: 442 Yz 458 yz 46 YZ 54 yz (a) What is the parental type of the heterozygous parent?
More informationRuns of Homozygosity Analysis Tutorial
Runs of Homozygosity Analysis Tutorial Release 8.7.0 Golden Helix, Inc. March 22, 2017 Contents 1. Overview of the Project 2 2. Identify Runs of Homozygosity 6 Illustrative Example...............................................
More informationSNPassoc: an R package to perform whole genome association studies
SNPassoc: an R package to perform whole genome association studies Juan R González, Lluís Armengol, Xavier Solé, Elisabet Guinó, Josep M Mercader, Xavier Estivill, Víctor Moreno November 16, 2006 Contents
More informationRelease Notes for Genomes Processed Using Complete Genomics Software
Release Notes for Genomes Processed Using Complete Genomics Software Software Version 2.4 Related Documents... 1 Changes to Version 2.4... 2 Changes to Version 2.2... 4 Changes to Version 2.0... 5 Changes
More information7.012 Problem Set 2. c) If an HhAa unicorn mates with an hhaa unicorn, what fraction of the progeny will be short and brown?
Name 7.012 Problem Set 2 Section Question 1 In unicorns, coat color (brown or white) is controlled by a single gene with two alleles, A and a. The brown phenotype is dominant over the white phenotype.
More information