Size: px
Start display at page:

Download ""

Transcription

1 1

2 Direct Detection of Genotype about gene testing: about sickle cell:

3 direct detection of genotype: A glu à val missense mutation in the β hemoglobin gene causes sickle cell anemia Loss-of-function mutations cause β thalassemias (form of anemia) 3

4 You are a clinical geneticist and you want to determine the genotype of an individual at a particular locus -- such as the β globin gene or study a the β globin gene in a group of individuals You have a tube of genomic DNA prepared from spit or blood or whatever. Total Genomic DNA It is a complex heterogeneous mixture of sequences How are you going to examine your gene of interest? 4

5 PROBLEM: β hemoglobin gene 3 kb/3 million kb: 1 part in 1 million of the genome Small quantity of your gene and it s contaminated with all of these other sequences WANT A TUBE LABELED: PURE β hemoglobin sequences 5

6 How to purify the gene sequences that you want to study? If you were trying to purify a protein what would you do? 6

7 Can take advantage of natural systems to amplify specific DNA sequences in vivo (see pg 27 of this lecture) or in vitro amplification Two methods of isolating and amplifying a gene are: (a) in vivo, using the replication machinery of a bacterium to amplify recombinant DNA containing the gene (typically in the form of plasmids) (b) in vitro, in the test tube using the polymerase chain reaction technique. 7

8 Amplify the gene or sequence using PCR -- an in vitro process PCR = polymerase chain reaction Very sophisticated molecular technologies have developed based on our understanding of the enzymology of DNA replication, transcription and translation PCR is an in vitro DNA replication technology that has revolutionized basic research in molecular biology and genetics PCR involves exponential amplification* of a specific gene or region of DNA from a complex mixture of DNA * an old principle in a new context: see end of lecture The Secret of the Persian Chessboard by Carl Sagan 8

9 How do we target amplification to our specific sequences of interest? How come only the red sequence is amplified from the starting template: 9

10 Specificity of amplification is controlled by the primers added to the reaction WHY? What are the other components of a PCR Reaction? 10

11 11

12 PCR animations See pg 23 for more detailed schematic What is temperature scale in o C? Melt = denature DNA with heat Anneal = allow primer to hydrogen bond with complementary sequences on the template DNA Replicate = allow DNA polymerase to extend primer and synthesize complementary copy of template 12

13 The complete sequence of human beta globin gene is shown below Conventions for displaying gene sequences: Sequence reads 5 to 3 Only the mrna like strand is displayed (complementary strand not shown) >ref NG_ : Homo sapiens beta globin (HBB) on chromosome 11 CACACATATATATATATATTTTTTCTTTTCTTACCAGAAGGTTTTAATCCAAATAAGGAGAAGATATGCT TAGAACCGAGGTAGAGTTTTCATCCATTCTGTCCTGTAAGTATTTTGCATATTCTGGAGACGCAGGAAGA GATCCATCTACATATCCCAAAGCTGAATTATGGTAGACAAAACTCTTCCACTTTTAGTGCATCAACTTCT TATTTGTGTAATAAGAAAATTGGGAAAACGATCTTCAATATGCTTACCAAGCTGTGATTCCAAATATTAC GTAAATACACTTGCAAAGGAGGATGTTTTTAGTAGCAATTTGTACTGATGGTATGGGGCCAAGAGATATA TCTTAGAGGGAGGGCTGAGGGTTTGAAGTCCAACTCCTAAGCCAGTGCCAGAAGAGCCAAGGACAGGTAC GGCTGTCATCACTTAGACCTCACCCTGTGGAGCCACACCCTAGGGTTGGCCAATCTACTCCCAGGAGCAG GGAGGGCAGGAGCCAGGGCTGGGCATAAAAGTCAGGGCAGAGCCATCTATTGCTTACATTTGCTTCTGAC ACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGT TACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGTTGGTATCAAGG TTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCATGTGGAGACAGAGAAGACTCTTGGGTTTCTG ATAGGCACTGACTCTCTCTGCCTATTGGTCTATTTTCCCACCCTTAGGCTGCTGGTGGTCTACCCTTGGA CCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAA GGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACC TTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGGTGAGTCTAT GGGACGCTTGATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTTCATGTCATAGGAAGGGGATAAGTAA CAGGGTACAGTTTAGAATGGGAAACAGACGAATGATTGCATCAGTGTGGAAGTCTCAGGATCGTTTTAGT TTCTTTTATTTGCTGTTCATAACAATTGTTTTCTTTTGTTTAATTCTTGCTTTCTTTTTTTTTCTTCTCC In blue: transcription start site Highlighted ATG: start of translation TATA box part of the promoter: mutations here cause loss-of-function phenotype (thalassemia) Sickle cell mutation CCT-GAG-GAG à CCT-GTG-GAG. 13

14 Design primers to amplify a region spanning the sickle cell mutation -- between the // s but not extending beyond the symbols in either direction: Both primer sequences must read in the 5 to 3 direction. Primers are typically bases long >ref NG_ : Homo sapiens beta globin (HBB); and hemoglobin on chromosome 11 CACACATATATATATATATTTTTTCTTTTCTTACCAGAAGGTTTTAATCCAAATAAGGAGAAGATAT GCTTAGAACCGAGGTAGAGTTTTCATCCATTCTGTCCTGTAAGTATTTTGCATATTCTGGAGACGCA GGAAGAGATCCATCTACATATCCCAAAGCTGAATTATGGTAGACAAAACTCTTCCACTTTTAGTGCA TCAACTTCTTATTTGTGTAATAAGAAAATTGGGAAAACGATCTTCAATATGCTTACCAAGCTGTGAT TCCAAATATTACGTAAATACACTTGCAAAGGAGGATGTTTTTAGTAGCAATTTGTACTGATGGTATG GGGCCAAGAGATATATCTTAGAGGGAGGGCTGAGGGTTTGAAGTCCAACTCCTAAGCCAGTGCCAGA AGAGCCAAGGACAGGTACGGCTGTCATCACTTAGACCTCACCCTGTG//GAGCCACACCCTAGGGTT GGCCAATCTACTCCCAGGAGCAGGGAGGGCAGGAGCCAGGGCTGGGCATAAAAGTCAGGGCAGAGCC ATCTATTGCTTACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTG CATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTG GTGGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTG GGCATGTGGAGACAGAGAAGACTCTTGGGTTTCTGATAGGCACTGACTCTCTCTGCCTATTGGTCTA TTTTCCCACCCTTAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTG//AGTCCTTTGGGG ATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGG TGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTG CACTGTG 14

15 Left primer: 5 GAGCCACACCCTAGGGTT etc. Right primer: 5 CAAAGAACCTCTGGGT etc. What do you do with your PCR product once you make it? 15

16 Wells where DNA is loaded - pole Gel Electrophoresis + pole DNA size standards (or ladder) in first and last lanes Agarose Slab Gel stained with ethidium bromine and photographed on UV transilluminator BUT, how can you determine genotype using your PCR product? How do we know if the globin sequence is CCT-GAG-GAG OR CCT-GTG-GAG 16

17 Restriction enzyme = restriction endonuclease nuclease = enzyme that hydrolyzes phosphodiester bond endo = cuts internally in the DNA polymer (vs. exo that cleaves from the end restriction = nuclease activity restricted to a site with a specific DNA sequence 17

18 The Aà T transversion mutation in the sickle-cell allele removes an Mst II restriction site Mst II recognizes CCTNAGG where N = A, C, G or T Note that at this level of examination the two alleles are codominant 18

19 The SCN9a gene codes for a subunit of a neuronal sodium ion channel involved in the transmission of pain signals On left: dideoxy sequence display of PCR Product* On right: restriction digest of product of PCR targeting the SCN9A gene Hph I recognition site: 5 TCACC 3 T2573A = T to A transversion at nucleotide number 2573 removes HphI restriction site Figure 3 Mutations in SCN9A in patients with primary erythermalgia** (A) Affected members in the family are heterozygous for a T2573A mutation. (B) Restriction endonuclease Hph I digestion for the identification of the T2573A mutation in the family. Mutation T2573A abolishes a recognition site for restriction endonuclease Hph I. Three fragments of 470 bp, 303 bp, and 167 bp are found in patients, and two fragments of 303 bp and 167 bp fragments are found in unaffected members. * Read about Sanger dideoxy sequencing in your textbook **characterized by red, warm and burning extremities 19

20 Nature Genetics 38: : R-spondin1 is essential in sex determination, skin differentiation and malignancy Here is the abstract of the paper: R-spondins are a recently characterized small family of growth factors. Here we show that human R- spondin1 (RSPO1) is the gene disrupted in a syndrome characterized by XX sex reversal, palmoplantar hyperkeratosis and predisposition to squamous cell carcinoma of the skin. Our data show, for the first time, that disruption of a single gene can lead to complete female-to-male sex reversal in the absence of the testis-determining gene, SRY. Here is an exerpt from the introduction to the paper: We have previously described a large consanguineous Italian family that includes four 46,XX (SRY-negative) brothers. In the same family, palmoplantar hyperkeratosis (PPK) and predisposition to squamous cell carcinoma of the skin (SCC) segregate as recessive traits. All members of the family with PPK are phenotypic males (46,XY or 46,XX), whereas seven XX sibs are healthy phenotypic females with no signs of PPK (Fig. 1a). We proposed that homozygosity for a single mutational event causes both PPK and SCC in XYand XX individuals and sex reversal in XX individuals. PEDIGREES on the next page. 20

21 R-spondin1 is essential in sex determination, skin differentiation and malignancy VOLUME 38 [ NUMBER 11 [ NOVEMBER 2006 NATURE GENETICS 21

22 22

23 a. Mutation analysis in family F. The guanine insertion at nucleotide 896 of exon 5 is shown by an arrow. WT refers to an individual lacking the insertion. WT/ refers to a heterozygote / refers to an individual homozygous for the insertion 23

24 24 (b) Mutation analysis in individual AN. The locations of primers for five separate PCRs are indicated by arrows (3, 4a, 4b, 5 and del). The 4a and 4b amplifications are included in the AN deletion. The primers for the del reaction could not amplify the genomic region in control DNA, as the expected size is too large for the applied PCR conditions. Exon ( Ex ) and intron sizes, as well as primer localization, are not to scale.

25 Taking advantage of natural systems to amplify specific DNA sequences Use recombinant DNA techniques to generate a molecular clone of the DNA: use a cell such as E. coli to make lots of copies of your gene -- put it in a DNA molecule that is easy to recover in a pure form from the cell 25

26 The Secret of the Persian Chessboard by Carl Sagan Parade Magazine Februrary 1989 The basic idea behind population growth, AIDS, nuclear weapons and much else (PCR) The way I first heard this story, it happened in ancient Persia. But it might have been India or even China. Anyway, it happened a long time ago. The Grand Vizier, the principal advisor to the King, had invented a new game. It was played with moving pieces on a board of 64 squares. The most important piece was the King. The next most important was the Grand Vizier. The object of the game was to capture the enemy King, and so the game was called in Persian shahmat -- shah for king and mat for dead, Death to the King. In Russian it is still called shakhmaty, which perhaps conveys a lingering revolutionary ardor. Even in English there is an echo of this name --- the final move is called checkmate. The game, of course, is chess. 26

27 As time passed, the pieces, their moves and the rules evolved. There is, for example, no longer a piece called the Grand Vizier -- it has become transmorgrifeed into a queen, which much more formidable powers. Why a king should delight in the creation of a game called death to the king is a mystery. But as the story goes, he was so pleased that he asked the Grand Vizier to name his own reward for such a splendid invention. The Grand Vizier had his answer ready. He was a humble man, he told the king. He wished only for a humble reward. Gesturing to the 8 columns and 8 rows of squares on the board he had devised, he asked that he be given a single grain of wheat on the first square, twice that on the second square, twice that on the third square and so on, until each square had its complement of wheat. No, the king remonstrated. This is too modest a prize for so important an invention. He offered jewels, dancing girls, palaces. But the grand vizier, his eyes becomingly lowered refused them all.. Eventually the king consented. When the Master of the Royal Granary began to count out the grains, however, the King was in for rude surprise a: 1, 2, 4, 8, 16, 32, 64, 128, 256, 512, = 9 X = 9 million trillion grains of wheat on the last square.. An account of what happened next has not come down to us. But, how much would all of this wheat weigh? If each grain were 2 millimeters in size, then all of the grains together would weigh about 75 billion metric tons the equivalent of about 150 years of the world s present wheat production. A sequence of numbers like this - where each is a fixed multiple of the previous one -- is called a geometric progression and the process is called exponential increase. Exponentials show up in all sorts of places compound interest and, of course, the Polymerase Chain Reaction. 27

Recombinant DNA recombinant DNA DNA cloning gene cloning

Recombinant DNA recombinant DNA DNA cloning gene cloning DNA Technology Recombinant DNA In recombinant DNA, DNA from two different sources, often two species, are combined into the same DNA molecule. DNA cloning permits production of multiple copies of a specific

More information

http://fire.biol.wwu.edu/trent/trent/direct_detection_of_genotype.html 1 Like most other model organism Arabidopsis thaliana has a sequenced genome? What do we mean by sequenced genome? What sort of info

More information

Biology PPA2 (Term 3!)

Biology PPA2 (Term 3!) Biology PPA2 (Term 3!) -Compiled by Jing En- Polymerase chain reaction - In vitro* enzymatic reaction to amplify a specific DNA segment whose two ends of the sequences are known. - To obtain sufficient

More information

Polymerase Chain Reaction PCR

Polymerase Chain Reaction PCR Polymerase Chain Reaction PCR What is PCR? An in vitro process that detects, identifies, and copies (amplifies) a specific piece of DNA in a biological sample. Discovered by Dr. Kary Mullis in 1983. A

More information

DNA Technology. Asilomar Singer, Zinder, Brenner, Berg

DNA Technology. Asilomar Singer, Zinder, Brenner, Berg DNA Technology Asilomar 1973. Singer, Zinder, Brenner, Berg DNA Technology The following are some of the most important molecular methods we will be using in this course. They will be used, among other

More information

Problem Set 8. Answer Key

Problem Set 8. Answer Key MCB 102 University of California, Berkeley August 11, 2009 Isabelle Philipp Online Document Problem Set 8 Answer Key 1. The Genetic Code (a) Are all amino acids encoded by the same number of codons? no

More information

Overview: The DNA Toolbox

Overview: The DNA Toolbox Overview: The DNA Toolbox Sequencing of the genomes of more than 7,000 species was under way in 2010 DNA sequencing has depended on advances in technology, starting with making recombinant DNA In recombinant

More information

B. Incorrect! Ligation is also a necessary step for cloning.

B. Incorrect! Ligation is also a necessary step for cloning. Genetics - Problem Drill 15: The Techniques in Molecular Genetics No. 1 of 10 1. Which of the following is not part of the normal process of cloning recombinant DNA in bacteria? (A) Restriction endonuclease

More information

BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.

BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY. !! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which

More information

Chapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering

Chapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering Chapter 8 Recombinant DNA and Genetic Engineering Genetic manipulation Ways this technology touches us Criminal justice The Justice Project, started by law students to advocate for DNA testing of Death

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

Chapter 10 Genetic Engineering: A Revolution in Molecular Biology

Chapter 10 Genetic Engineering: A Revolution in Molecular Biology Chapter 10 Genetic Engineering: A Revolution in Molecular Biology Genetic Engineering Direct, deliberate modification of an organism s genome bioengineering Biotechnology use of an organism s biochemical

More information

7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau

7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau 7.1 Techniques for Producing and Analyzing DNA SBI4U Ms. Ho-Lau What is Biotechnology? From Merriam-Webster: the manipulation of living organisms or their components to produce useful usually commercial

More information

Genetics and Genomics in Medicine Chapter 3. Questions & Answers

Genetics and Genomics in Medicine Chapter 3. Questions & Answers Genetics and Genomics in Medicine Chapter 3 Multiple Choice Questions Questions & Answers Question 3.1 Which of the following statements, if any, is false? a) Amplifying DNA means making many identical

More information

Bi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8

Bi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8 Bi 8 Lecture 4 DNA approaches: How we know what we know Ellen Rothenberg 14 January 2016 Reading: from Alberts Ch. 8 Central concept: DNA or RNA polymer length as an identifying feature RNA has intrinsically

More information

Human Chromosomes Section 14.1

Human Chromosomes Section 14.1 Human Chromosomes Section 14.1 In Today s class. We will look at Human chromosome and karyotypes Autosomal and Sex chromosomes How human traits are transmitted How traits can be traced through entire families

More information

Molecular Biology (2)

Molecular Biology (2) Molecular Biology (2) Restriction endonucleases, RFLP, and gene cloning Mamoun Ahram, PhD Second semester, 2017-2018 Resources This lecture Cooper, pp 120-124 Endonucleases Enzymes that degrade DNA within

More information

Enzyme that uses RNA as a template to synthesize a complementary DNA

Enzyme that uses RNA as a template to synthesize a complementary DNA Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Comparison of two or more protein or DNA sequence to ascertain similarities in sequences. If two genes have

More information

XXII DNA cloning and sequencing. Outline

XXII DNA cloning and sequencing. Outline XXII DNA cloning and sequencing 1) Deriving DNA for cloning Outline 2) Vectors; forming recombinant DNA; cloning DNA; and screening for clones containing recombinant DNA [replica plating and autoradiography;

More information

PCR in the Classroom. UC Davis - PCR Workshop Friday, September 26, 2003

PCR in the Classroom. UC Davis - PCR Workshop Friday, September 26, 2003 PCR in the Classroom UC Davis - PCR Workshop Friday, September 26, 2003 A little history In 1983, Kary B. Mullis conceived the procedure. He went on to Cetus Corp in Emeryville, CA where it was developed

More information

Polymerase chain reaction

Polymerase chain reaction Core course BMS361N Genetic Engineering Polymerase chain reaction Prof. Narkunaraja Shanmugam Dept. Of Biomedical Science School of Basic Medical Sciences Bharathidasan University The polymerase chain

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer

More information

Computational Biology I LSM5191

Computational Biology I LSM5191 Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA

More information

Biotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for

Biotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for Chapter 20 Biotechnology PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright

More information

BIO 304 Fall 2000 Exam II Name: ID #: 1. Fill in the blank with the best answer from the provided word bank. (2 pts each)

BIO 304 Fall 2000 Exam II Name: ID #: 1. Fill in the blank with the best answer from the provided word bank. (2 pts each) 1. Fill in the blank with the best answer from the provided word bank. (2 pts each) incomplete dominance conditional mutation penetrance expressivity pleiotropy Southern blotting hybridization epistasis

More information

Molecular Genetics Techniques. BIT 220 Chapter 20

Molecular Genetics Techniques. BIT 220 Chapter 20 Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant

More information

Lecture Four. Molecular Approaches I: Nucleic Acids

Lecture Four. Molecular Approaches I: Nucleic Acids Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single

More information

Genetics module. DNA Structure, Replication. The Genetic Code; Transcription and Translation. Principles of Heredity; Gene Mapping

Genetics module. DNA Structure, Replication. The Genetic Code; Transcription and Translation. Principles of Heredity; Gene Mapping Genetics module Lectures DNA Structure, Replication The Genetic Code; Transcription and Translation Principles of Heredity; Gene Mapping Controlling Gene Expression Mutation and Cancer Textbook: Introduction

More information

Practical 4: PCR in Molecular Diagnosis

Practical 4: PCR in Molecular Diagnosis PRINCIPLES What is PCR Practical 4: PCR in Molecular Diagnosis Instructors: Dr. Valerie C.L. Lin and Dr. Sze Chun Chau PCR stands for polymerase chain reaction. The PCR method was devised and named by

More information

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can

More information

Test Bank for Molecular Cell Biology 7th Edition by Lodish

Test Bank for Molecular Cell Biology 7th Edition by Lodish Test Bank for Molecular Cell Biology 7th Edition by Lodish Link download full: http://testbankair.com/download/test-bank-formolecular-cell-biology-7th-edition-by-lodish/ Chapter 5 Molecular Genetic Techniques

More information

Chapter 20 Biotechnology

Chapter 20 Biotechnology Chapter 20 Biotechnology Manipulation of DNA In 2007, the first entire human genome had been sequenced. The ability to sequence an organisms genomes were made possible by advances in biotechnology, (the

More information

The Biotechnology Toolbox

The Biotechnology Toolbox Chapter 15 The Biotechnology Toolbox Cutting and Pasting DNA Cutting DNA Restriction endonuclease or restriction enzymes Cellular protection mechanism for infected foreign DNA Recognition and cutting specific

More information

Biology 105: Introduction to Genetics PRACTICE FINAL EXAM Part I: Definitions. Homology: Reverse transcriptase. Allostery: cdna library

Biology 105: Introduction to Genetics PRACTICE FINAL EXAM Part I: Definitions. Homology: Reverse transcriptase. Allostery: cdna library Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Reverse transcriptase Allostery: cdna library Transformation Part II Short Answer 1. Describe the reasons for

More information

1) (15 points) Next to each term in the left-hand column place the number from the right-hand column that best corresponds:

1) (15 points) Next to each term in the left-hand column place the number from the right-hand column that best corresponds: 1) (15 points) Next to each term in the left-hand column place the number from the right-hand column that best corresponds: natural selection 21 1) the component of phenotypic variance not explained by

More information

Genomics and Biotechnology

Genomics and Biotechnology Genomics and Biotechnology Expansion of the Central Dogma DNA-Directed-DNA-Polymerase RNA-Directed- DNA-Polymerase DNA-Directed-RNA-Polymerase RNA-Directed-RNA-Polymerase RETROVIRUSES Cell Free Protein

More information

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing

More information

The Techniques of Molecular Biology: Forensic DNA Fingerprinting

The Techniques of Molecular Biology: Forensic DNA Fingerprinting Revised Fall 2016 The Techniques of Molecular Biology: Forensic DNA Fingerprinting **Lab coat, eye goggles and gloves (nitrile or latex) are required for this lab. You will not be allowed to participate

More information

PBG 430/530 Exam

PBG 430/530 Exam 1 PBG 430/530 Exam 2 2013 1. In a deoxyribonucleotide, 5 and 3 refer to the a. start site for transcription. b. start site for translation. c. carbons where (respectively) the phosphate and hydroxyl groups

More information

Gene Cloning and DNA Analysis: An introduction

Gene Cloning and DNA Analysis: An introduction Gene Cloning and DNA Analysis: An introduction T. A. Brown. 6th edition 2010 Published by Blackwell Science Ltd & 140.128.147.174/yclclass/ =>2011 Part I The Basic Principles of Gene Cloning and DNA Analysis

More information

Fundamentals of Genetics. 4. Name the 7 characteristics, giving both dominant and recessive forms of the pea plants, in Mendel s experiments.

Fundamentals of Genetics. 4. Name the 7 characteristics, giving both dominant and recessive forms of the pea plants, in Mendel s experiments. Fundamentals of Genetics 1. What scientist is responsible for our study of heredity? 2. Define heredity. 3. What plant did Mendel use for his hereditary experiments? 4. Name the 7 characteristics, giving

More information

Moayyad Al-shafei. Mohammad Tarabeih. Dr Ma'mon Ahram. 1 P a g e

Moayyad Al-shafei. Mohammad Tarabeih. Dr Ma'mon Ahram. 1 P a g e 3 Moayyad Al-shafei Mohammad Tarabeih Dr Ma'mon Ahram 1 P a g e In this sheet, we are going to discuss 2 main topics: 1- The advantages of restriction endonucleases. 2- DNA replication. Before we start

More information

DESIGNER GENES SAMPLE TOURNAMENT

DESIGNER GENES SAMPLE TOURNAMENT DESIGNER GENES SAMPLE TOURNAMENT PART ONE- GENETICS PROBLEMS In dogs, the inheritance of hair color involves a gene (B) for black hair and a gene (b) for brown hair. A dominant (C) is also involved. It

More information

AP Biology Review Chapters Review Questions Chapter 11: Mendelian Patterns of Inheritance Chapter 12: Molecular Biology of the Gene

AP Biology Review Chapters Review Questions Chapter 11: Mendelian Patterns of Inheritance Chapter 12: Molecular Biology of the Gene AP Biology Review Chapters 11-12 Review Questions Chapter 11: Mendelian Patterns of Inheritance a) Know genotypes and phenotypes of a monohybrid cross in the P, F1, and F2 generations. Be familiar with

More information

Amplifying the ALU intron for Hardy- Weinberg Analysis Part 1

Amplifying the ALU intron for Hardy- Weinberg Analysis Part 1 Bio 212 Lab Name: Amplifying the ALU intron for Hardy- Weinberg Analysis Part 1 OBJECTIVES: Review the following terms and concepts presented in Biology 211: enzymes, DNA structure and replication, role

More information

Restriction Enzymes (endonucleases)

Restriction Enzymes (endonucleases) In order to understand and eventually manipulate DNA (human or otherwise) an array of DNA technologies have been developed. Here are some of the tools: Restriction Enzymes (endonucleases) In order to manipulate

More information

Chapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc.

Chapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc. Chapter 20 Recombinant DNA Technology Copyright 2009 Pearson Education, Inc. 20.1 Recombinant DNA Technology Began with Two Key Tools: Restriction Enzymes and DNA Cloning Vectors Recombinant DNA refers

More information

Appendix A DNA and PCR in detail DNA: A Detailed Look

Appendix A DNA and PCR in detail DNA: A Detailed Look Appendix A DNA and PCR in detail DNA: A Detailed Look A DNA molecule is a long polymer consisting of four different components called nucleotides. It is the various combinations of these four bases or

More information

Bootcamp: Molecular Biology Techniques and Interpretation

Bootcamp: Molecular Biology Techniques and Interpretation Bootcamp: Molecular Biology Techniques and Interpretation Bi8 Winter 2016 Today s outline Detecting and quantifying nucleic acids and proteins: Basic nucleic acid properties Hybridization PCR and Designing

More information

BS 50 Genetics and Genomics Week of Oct 24

BS 50 Genetics and Genomics Week of Oct 24 BS 50 Genetics and Genomics Week of Oct 24 Additional Practice Problems for Section Question 1: The following table contains a list of statements that apply to replication, transcription, both, or neither.

More information

Recitation CHAPTER 9 DNA Technologies

Recitation CHAPTER 9 DNA Technologies Recitation CHAPTER 9 DNA Technologies DNA Cloning: General Scheme A cloning vector and eukaryotic chromosomes are separately cleaved with the same restriction endonuclease. (A single chromosome is shown

More information

C. Incorrect! Second Law: Law of Independent Assortment - Genes for different traits sort independently of one another in the formation of gametes.

C. Incorrect! Second Law: Law of Independent Assortment - Genes for different traits sort independently of one another in the formation of gametes. OAT Biology - Problem Drill 20: Chromosomes and Genetic Technology Question No. 1 of 10 Instructions: (1) Read the problem and answer choices carefully, (2) Work the problems on paper as needed, (3) Pick

More information

Chapter 6 - Molecular Genetic Techniques

Chapter 6 - Molecular Genetic Techniques Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting

More information

Genetics Lecture 21 Recombinant DNA

Genetics Lecture 21 Recombinant DNA Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of

More information

Chapter 20 DNA Technology & Genomics. If we can, should we?

Chapter 20 DNA Technology & Genomics. If we can, should we? Chapter 20 DNA Technology & Genomics If we can, should we? Biotechnology Genetic manipulation of organisms or their components to make useful products Humans have been doing this for 1,000s of years plant

More information

i. This type of DNA damage will result in (circle all correct answers) b. a transversion mutation

i. This type of DNA damage will result in (circle all correct answers) b. a transversion mutation Biol 321 Winter 2010 Quiz 5 40 points NAME ANSWERS IN RED COMMENTS IN BLUE 1. (2 pts.) Recall the article entitled: Human Genetic Variation By each statement circle True/False/Not addressed in the paper.

More information

From DNA to Protein: Genotype to Phenotype

From DNA to Protein: Genotype to Phenotype 12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each

More information

E. Incorrect! The four different DNA nucleotides follow a strict base pairing arrangement:

E. Incorrect! The four different DNA nucleotides follow a strict base pairing arrangement: AP Biology - Problem Drill 10: Molecular and Human Genetics Question No. 1 of 10 Instructions: (1) Read the problem and answer choices carefully, (2) Work the problems on paper as 1. Which of the following

More information

Genomic Sequencing. Genomic Sequencing. Maj Gen (R) Suhaib Ahmed, HI (M)

Genomic Sequencing. Genomic Sequencing. Maj Gen (R) Suhaib Ahmed, HI (M) Maj Gen (R) Suhaib Ahmed, HI (M) The process of determining the sequence of an unknown DNA is called sequencing. There are many approaches for DNA sequencing. In the last couple of decades automated Sanger

More information

What is a chromosome and where is it located and what does it

What is a chromosome and where is it located and what does it What is a chromosome and where is it located and what does it do? A general overview for neophytes A chromosome is one of the components of the cell inside the nucleus which codes for proteins and controls

More information

GENETICS. Chapter 1: Cell cycle. Thème 1 : La Terre dans l Univers A. Expression, stabilité et variation du patrimoine génétique.

GENETICS. Chapter 1: Cell cycle. Thème 1 : La Terre dans l Univers A. Expression, stabilité et variation du patrimoine génétique. Introduction: GENETICS 3M = first look at genetics (study of inheritance, discovery of chromosomes, genes, dominant and recessive alleles and the DNA molecule within chromosomes) 2D = not much in fact,

More information

MCB 102 University of California, Berkeley August 11 13, Problem Set 8

MCB 102 University of California, Berkeley August 11 13, Problem Set 8 MCB 102 University of California, Berkeley August 11 13, 2009 Isabelle Philipp Handout Problem Set 8 The answer key will be posted by Tuesday August 11. Try to solve the problem sets always first without

More information

NCERT. 2. An enzyme catalysing the removal of nucleotides from the ends of DNA is: a. endonuclease b. exonuclease c. DNA ligase d.

NCERT. 2. An enzyme catalysing the removal of nucleotides from the ends of DNA is: a. endonuclease b. exonuclease c. DNA ligase d. BIOTECHNOLOGY PRINCIPLES AND PROCESSES 75 CHAPTER 11 BIOTECHNOLOGY: PRINCIPLES AND PROCESSES 1. Rising of dough is due to: MULTIPLE-CHOICE QUESTIONS a. Multiplication of yeast b. Production of CO 2 c.

More information

DETERMINATION OF THE Rh FACTOR BY PCR

DETERMINATION OF THE Rh FACTOR BY PCR DETERMINATION OF THE Rh FACTOR BY PCR Ref.: PCR2 1. EXPERIMENT OBJECTIVE The aim of this experiment is to introduce students to the principles and practice of the Polymerase Chain Reaction (PCR) by studying

More information

CHAPTER 5 Principle of Genetics Review

CHAPTER 5 Principle of Genetics Review CHAPTER 5 Principle of Genetics Review I. Mendel s Investigations Gregor Johann Mendel Hybridized peas 1856-1864 Formulated Principles of Heredity published in 1866 II. Chromosomal Basis of Inheritance

More information

Molecular Genetics of Disease and the Human Genome Project

Molecular Genetics of Disease and the Human Genome Project 9 Molecular Genetics of Disease and the Human Genome Project Fig. 1. The 23 chromosomes in the human genome. There are 22 autosomes (chromosomes 1 to 22) and two sex chromosomes (X and Y). Females inherit

More information

The Techniques of Molecular Biology: Forensic DNA Fingerprinting

The Techniques of Molecular Biology: Forensic DNA Fingerprinting The Techniques of Molecular Biology: Forensic DNA Fingerprinting Revised Fall 2017 Laboratory Safety: Lab coat, long pants, closed-toe shoes, safety goggles, and nitrile or latex gloves are required. Learning

More information

Biology Evolution Dr. Kilburn, page 1 Mutation and genetic variation

Biology Evolution Dr. Kilburn, page 1 Mutation and genetic variation Biology 203 - Evolution Dr. Kilburn, page 1 In this unit, we will look at the mechanisms of evolution, largely at the population scale. Our primary focus will be on natural selection, but we will also

More information

Chapter 10 (Part II) Gene Isolation and Manipulation

Chapter 10 (Part II) Gene Isolation and Manipulation Biology 234 J. G. Doheny Chapter 10 (Part II) Gene Isolation and Manipulation Practice Questions: Answer the following questions with one or two sentences. 1. What does PCR stand for? 2. What does the

More information

From DNA to Protein: Genotype to Phenotype

From DNA to Protein: Genotype to Phenotype 12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each

More information

Bi 8 Lecture 5. Ellen Rothenberg 19 January 2016

Bi 8 Lecture 5. Ellen Rothenberg 19 January 2016 Bi 8 Lecture 5 MORE ON HOW WE KNOW WHAT WE KNOW and intro to the protein code Ellen Rothenberg 19 January 2016 SIZE AND PURIFICATION BY SYNTHESIS: BASIS OF EARLY SEQUENCING complex mixture of aborted DNA

More information

Regulation of enzyme synthesis

Regulation of enzyme synthesis Regulation of enzyme synthesis The lac operon is an example of an inducible operon - it is normally off, but when a molecule called an inducer is present, the operon turns on. The trp operon is an example

More information

Q1 (1 point): Explain why a lettuce leaf wilts when it is placed in a concentrated salt solution.

Q1 (1 point): Explain why a lettuce leaf wilts when it is placed in a concentrated salt solution. Short questions 1 point per question. Q1 (1 point): Explain why a lettuce leaf wilts when it is placed in a concentrated salt solution. Q2 (1 point): Put a cross by the correct answer(s) below. The Na

More information

Q2 (1 point). How many carbon atoms does a glucose molecule contain?

Q2 (1 point). How many carbon atoms does a glucose molecule contain? Q1 (1 point). Name three amino acids that are typically found at the surface of integrated membrane proteins.. Q2 (1 point). How many carbon atoms does a glucose molecule contain? Q3 (1 point). What do

More information

Biology From gene to protein

Biology From gene to protein Biology 205 5.3.06 From gene to protein Shorthand abbreviation of part of the DNA sequence of the SRY gene >gi 17488858 ref XM_010627.4 Homo sapiens SRY (sex determining region Y chromosome) GGCATGTGAGCGGGAAGCCTAGGCTGCCAGCCGCGAGGACCGCACGGAGGAGGAGCAGG

More information

Molecular Cloning. Genomic DNA Library: Contains DNA fragments that represent an entire genome. cdna Library:

Molecular Cloning. Genomic DNA Library: Contains DNA fragments that represent an entire genome. cdna Library: Molecular Cloning Genomic DNA Library: Contains DNA fragments that represent an entire genome. cdna Library: Made from mrna, and represents only protein-coding genes expressed by a cell at a given time.

More information

Concepts: What are RFLPs and how do they act like genetic marker loci?

Concepts: What are RFLPs and how do they act like genetic marker loci? Restriction Fragment Length Polymorphisms (RFLPs) -1 Readings: Griffiths et al: 7th Edition: Ch. 12 pp. 384-386; Ch.13 pp404-407 8th Edition: pp. 364-366 Assigned Problems: 8th Ch. 11: 32, 34, 38-39 7th

More information

Ch 10 Molecular Biology of the Gene

Ch 10 Molecular Biology of the Gene Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read

More information

PLNT2530 (2018) Unit 6b Sequence Libraries

PLNT2530 (2018) Unit 6b Sequence Libraries PLNT2530 (2018) Unit 6b Sequence Libraries Molecular Biotechnology (Ch 4) Analysis of Genes and Genomes (Ch 5) Unless otherwise cited or referenced, all content of this presenataion is licensed under the

More information

Overview. Background ~30 min. Lab activity ~50 min. DNA profiling Polymerase Chain Reaction (PCR) Gel Electrophoresis PCR

Overview. Background ~30 min. Lab activity ~50 min. DNA profiling Polymerase Chain Reaction (PCR) Gel Electrophoresis PCR Overview Day 1: Tuesday Introduction to DNA profiling How do we use DNA to solve crimes? Background Polymerase Chain Reaction (PCR) Gel Electrophoresis Set up PCR Day 2: Wednesday Make and Run Agarose

More information

DNA REPLICATION & BIOTECHNOLOGY Biology Study Review

DNA REPLICATION & BIOTECHNOLOGY Biology Study Review DNA REPLICATION & BIOTECHNOLOGY Biology Study Review DNA DNA is found in, in the nucleus. It controls cellular activity by regulating the production of, which includes It is a very long molecule made up

More information

Fun with DNA polymerase

Fun with DNA polymerase Fun with DNA polymerase Why would we want to be able to make copies of DNA? Can you think of a situation where you have only a small amount and would like more? Enzymatic DNA synthesis To use DNA polymerase

More information

Family Secrets Genetic Testing PowerPoint Script

Family Secrets Genetic Testing PowerPoint Script Family Secrets Genetic Testing PowerPoint Script *Notes on use: Each bulleted portion goes with a mouse click advance on the PowerPoint. Sometimes, the mouse click advances a slide, and sometimes the mouse

More information

13-2 Manipulating DNA Slide 1 of 32

13-2 Manipulating DNA Slide 1 of 32 1 of 32 The Tools of Molecular Biology The Tools of Molecular Biology How do scientists make changes to DNA? Scientists use their knowledge of the structure of DNA and its chemical properties to study

More information

Explain why the scientists used the same restriction endonuclease enzymes on each DNA sample

Explain why the scientists used the same restriction endonuclease enzymes on each DNA sample Q1.Some populations of flies are becoming resistant to insecticides intended to kill them. Scientists developed a method for finding out whether a fly was carrying a recessive allele, r, that gives resistance

More information

Chapter 8. Microbial Genetics. Lectures prepared by Christine L. Case. Copyright 2010 Pearson Education, Inc.

Chapter 8. Microbial Genetics. Lectures prepared by Christine L. Case. Copyright 2010 Pearson Education, Inc. Chapter 8 Microbial Genetics Lectures prepared by Christine L. Case Structure and Function of Genetic Material Learning Objectives 8-1 Define genetics, genome, chromosome, gene, genetic code, genotype,

More information

objective To Study basics of DNA Structure Properties Replication Transcription Translation

objective To Study basics of DNA Structure Properties Replication Transcription Translation Basics of DNA Dr. Amol Kharat objective To Study basics of DNA Structure Properties Replication Transcription Translation Cellular composition DNA is contained in nucleus of cell Phospho-lipids and proteins

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

What would this eye color phenomenon be called?

What would this eye color phenomenon be called? Name: School: Total Score: / 50 1 1. Which nitrogenous bases present in DNA are purines, and which are pyrimidines? What is the main difference between a purine and a pyrimidine? (2 points) 2. To the right

More information

1. (a) Define sex linkage... State one example of sex linkage... Key. 1st generation. Male. Female

1. (a) Define sex linkage... State one example of sex linkage... Key. 1st generation. Male. Female 1. Define sex linkage. State one example of sex linkage. Draw a simple pedigree chart that clearly shows sex linkage in humans. Use conventional symbols. Start with an affected woman and an unaffected

More information

Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction

Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain

More information

2/25/15. The Experiment. Griffith. GO Avery! Avery TRANSFORMATION. o animations.html

2/25/15. The Experiment. Griffith. GO Avery! Avery TRANSFORMATION. o   animations.html o http://www.hhmi.org/biointeractive/dna/ animations.html o Revisit the difference b/w a contagious and a genetic disease Griffith The Experiment o Isolated two strains (versions) of pneumonia bacteria

More information

Bio 101 Sample questions: Chapter 10

Bio 101 Sample questions: Chapter 10 Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information

More information

Genetic Technologies.notebook March 05, Genetic Technologies

Genetic Technologies.notebook March 05, Genetic Technologies Genetic Testing Genetic Technologies Tests can be used to diagnose disorders and/or identify those individuals with an increased risk of inheriting a disorder. Prenatal Screening A fetus may be screened

More information

AP Biology Review Chapters Review Questions Chapter 11: Mendelian Patterns of Inheritance Chapter 12: Molecular Biology of the Gene

AP Biology Review Chapters Review Questions Chapter 11: Mendelian Patterns of Inheritance Chapter 12: Molecular Biology of the Gene AP Biology Review Chapters 11-12 Review Questions Chapter 11: Mendelian Patterns of Inheritance a) Know genotypes and phenotypes of a monohybrid cross in the P, F1, and F2 generations. Be familiar with

More information

Biotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for

Biotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for Chapter 20 Biotechnology PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright

More information

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next.

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. 1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. 2. True or False? The sequence of

More information

BC2004 Review Sheet for Lab Exercises 7-11 Spring Semester 2005

BC2004 Review Sheet for Lab Exercises 7-11 Spring Semester 2005 BC2004 Review Sheet for Lab Exercises 7-11 Spring Semester 2005 Lab Exercise 7 Drosophila crosses, three weeks Vocabulary: phenotype, genotype, gene, allele, locus (loci), sex chromosomes, autosomes, homozygous,

More information

Biotechnology. Biotechnology is difficult to define but in general it s the use of biological systems to solve problems.

Biotechnology. Biotechnology is difficult to define but in general it s the use of biological systems to solve problems. MITE 2 S Biology Biotechnology Summer 2004 Austin Che Biotechnology is difficult to define but in general it s the use of biological systems to solve problems. Recombinant DNA consists of DNA assembled

More information

4/3/2013. DNA Synthesis Replication of Bacterial DNA Replication of Bacterial DNA

4/3/2013. DNA Synthesis Replication of Bacterial DNA Replication of Bacterial DNA 4/3/03 3 4 5 6 7 8 9 0 Chapter 8 Microbial Genetics Terminology Genetics: The study of what genes are, how they carry information, how information is expressed, and how genes are replicated Gene: A segment

More information