Report Issue Date: December 1, Round 64 Results. Dear EMPAT Program Participant,

Transcription

1 Report Issue Date: December, 7 Round 64 Results Dear EMPAT Program Participant, Please find your organization's Environmental Microbiology Proficiency Analytical Testing results for round EMPAT Culture 64. The following three reports are included for the shipment of: 3-October-7. Individual Scores. All Labs Summary Report 3. Organism Profiles Scoring - Scoring is based on the following point system: +9 Points = Correctly identified at the genus level + Point = Correctly identified at the species level - Point = Incorrectly identified at the species level Points = Incorrectly identified at the genus level NOTE: BLANK SAMPLES ARE NOT SCORED The proficiency demonstrated by the results of the EMPAT round is valid until retest round results are available, if a participant chooses to enroll, or until the next EMPAT round report is available. Unacceptable performance may be improved by correctly identifying organisms in the retest round. If you require a retest for the round, you may download the retest form available at The completed form and payment must be received by December 9th, 7. It is the participant's responsibility to thoroughly review results and to immediately contact the AIHA Proficiency Testing Programs in writing, if any errors are found in your results. Scoring Deviations N/A Educational Comments N/A AIHA Proficiency Analytical Testing Programs 34 Fairview Park Drive, Suite 777, Falls Church, VA 4 USA main fax info.patllc@aiha.org web

2 Participant Proficiency The Proficiency Analytical Testing (PAT) Board oversees EMPAT proficiency testing. A participant will be rated proficient for the applicable PT if the participant passes a minimum of two out of the last three consecutive EMPAT rounds. A passing round score in either PT category (Fungi, Bacteria) will require a minimum scoring percentage of 85%. Your organization's score over the last three rounds is presented both numerically and graphically as part of the result report in order to show your organization's current progress towards proficiency. Next Round The next round, Round 65, will ship on February st, 8. If applicable, please check import permits to verify that they are current. Result booklets must be received by the due date. Results received after this deadline will not be accepted. Participant Updates Please contact Anthony Hodge via with any changes to your mailing and/or contact information. Questions Please direct all EMPAT questions and correspondence to: Angela Oler (Result) Director AIHA PAT Programs aoler@aiha.org Anthony Hodge (Enrollment) Manager of Operations AIHA Affiliate Laboratory Programs ahodge@aiha.org AIHA Proficiency Analytical Testing Programs encourages you to write with any feedback or questions. Applied Environmental, Inc. is a private company working on behalf of AIHA Proficiency Analytical Testing Programs to manage the data collection and analysis of the microbiological sample results for the EMPAT program. Important! Please ensure that you have downloaded your results for this and all previous rounds. The deadline to download your organization s results is quickly approaching. AIHA PAT Programs is moving to a new database. When this switch occurs you will be unable to access your previous results. Please do so now. Sincerely, Marcia B. McConnell EMPAT Database Management Coordinator ext. 4 empat@appenv.com AIHA Proficiency Analytical Testing Programs 34 Fairview Park Drive, Suite 777, Falls Church, VA 4 USA main fax info.patllc@aiha.org web

3 AIHA EMPAT Individual Scoring Summary /7 Round 64 Results as of:/4/7 3:4 PM Lab ID Number:34 Lab Type:Fungi Only Fungal Isolates Genus Species Sample Challenge Organism(s) You Reported Correct Score Correct Score Total 3F-7. Curvularia geniculata. Curvularia YES 9. NA. 9. 3F-7. Cladosporium sphaerospermum. Cladosporium YES 9. NA. 9. 3F3-7. Penicillium restrictum. Penicillium YES 9. NA. 9. Your Total Score Maximum Possible Score Proficiency for Round 9.% AIHA PAT Programs EMPAT Testing Scores for the /7 Shipment Proficiency Summary 7. ( 9. % ) 7 Round ( 9. % ) 7 Round ( 9. % ) 7 Round 6 Lab Number:34 P F P F 85% Bacterial Scores Fungal Scores Pass Fail Laboratory Proficiency Status: The Proficiency Analytical Testing (PAT) Board oversees EMPAT proficiency testing. A laboratory will be rated proficient for the applicable PT category if the laboratory passes a minimum of two out of the last three consecutive EMPAT rounds. A passing round score in either PT category (Fungi, Bacteria) will require a minimum scoring percentage of 85%. 9. % P R o u n d 6 4 Fungi = Proficient 7 9. % P R o u n d % P R o u n d 6 7 Bacteria = Not Rated Scoring Notes: Fungi Bacteria SGS Galson Laboratories, Inc. 66 Kirkville Road East Syracuse, NY 357

4 Bacteria Laboratory Response Summary Report - All Labs Results as of: /6/7 /7 Round 64 EMPAT Sample Number: 3B-7. Enterococcus faecalis Identification Frequency ** EMPAT Sample Number: 3B-7. Streptomyces intermedius Identification Frequency ** EMPAT Sample Number: 3B3-7. Pseudomonas fluorescens Identification Frequency ** Freq. Organism Freq. Organism Freq. Organism 7 Enterococcus faecalis 8 Enterococcus Identification Summary Streptomyces Nocardia Streptomyces griseus Dermatophilus Streptomyces intermedius Other 7 Pseudomonas fluorescens 8 Pseudomonas Identification Summary Genus Level Number of Labs Responding: 35 Number of Labs Responding Correctly: 35 Percent of Labs Responding Correctly:.% Species Level Number of Labs Responding: 7 Percent of Labs Responding: 75.7% Number of Labs Responding Correctly: 7 Percent of Labs Responding Correctly:.% Identification Summary Genus Level Number of Labs Responding: 35 Number of Labs Responding Correctly: 8 Percent of Labs Responding Correctly: 8.% Species Level Number of Labs Responding: 9 Percent of Labs Responding: 5.7% Number of Labs Responding Correctly: 4 Percent of Labs Responding Correctly: 44.4% Genus Level Number of Labs Responding: 35 Number of Labs Responding Correctly: 35 Percent of Labs Responding Correctly:.% Species Level Number of Labs Responding: 7 Percent of Labs Responding: 75.7% Number of Labs Responding Correctly: 7 Percent of Labs Responding Correctly:.% ** Please note: "Other" category in identification frequencies may include identifications where genus is correct but species is incorrect. Page of

5 FUNGI Laboratory Response Summary Report - All Labs Results as of: /6/7 /7 Round 64 EMPAT Sample Number: 3F-7. Curvularia geniculate Identification Frequency ** EMPAT Sample Number: 3F-7. Cladosporium sphaerospermum Identification Frequency ** EMPAT Sample Number: 3F3-7. Penicillium restrictum Identification Frequency ** Freq. Organism Freq. Organism Freq. Organism Curvularia Curvularia geniculate Curvularia lunata Curvularia pallescens Other 4 Cladosporium 3 Cladosporium sphaerospermum 5 Cladosporium cladosporioides Identification Summary 44 4 Penicillium Penicillium restrictum Other Identification Summary Identification Summary Genus Level Number of Labs Responding: Number of Labs Responding Correctly: 7 68 Genus Level Number of Labs Responding: Number of Labs Responding Correctly: Percent of Labs Responding Correctly: 7 7.% Genus Level Number of Labs Responding: Number of Labs Responding Correctly: Percent of Labs Responding Correctly: % Percent of Labs Responding Correctly: 97.% Species Level Number of Labs Responding: 8 Percent of Labs Responding: 5.7% Number of Labs Responding Correctly: 7 Percent of Labs Responding Correctly: 38.9% Species Level Number of Labs Responding: 8 Percent of Labs Responding: 4.% Number of Labs Responding Correctly: 3 Percent of Labs Responding Correctly: 8.% Species Level Number of Labs Responding: 3 Percent of Labs Responding: 3.9% Number of Labs Responding Correctly: Percent of Labs Responding Correctly: 95.7% ** Please note: "Other" category in identification frequencies may include identifications where genus is correct but species is incorrect. Page of

6 Organism Profiles AIHA EMPAT Culture Round 64 Bacteria 3B-7: Enterococcus faecalis ATCC 9433 Included 3B-7: Streptomyces intermedius ATCC 339 Included 3B3-7: Pseudomonas fluorescens ATCC 355 Included Fungi 3F-7: Curvularia geniculata ATCC 53 Included 3F-7: Cladosporium sphaerospermum ATCC 88 Included 3F3-7: Penicillium restrictum CBS

7 Description Enterococcus faecalis (ATCC 9433 ) Frozen: 8 C or Freeze Dried: C Designation: NCTC 775 [DSM 478, JCM 876, NCDO 58, Tissier] Deposited Name: Streptococcus faecalis Andrewes and Horder Product Description: Type strain. Control strain for Group D. Quality control strain for Difco products. Medium ATCC Medium 44: Brain Heart Infusion Agar/Broth Growth Conditions Temperature: 37 C Atmosphere: Aerobic Procedure. Open vial according to enclosed instructions.. From a single tube of #44 broth (5 to 6 ml), withdraw approximately.5 to. ml with a Pasteur or. ml pipette. Rehydrate the entire pellet. 3. Aseptically transfer this aliquot back into the broth tube. Mix well. 4. Use several drops of the suspension to inoculate a #44 agar slant and/or plate. 5. Incubate the tubes and plate at 37 C for 4 hours. Notes Additional information on this culture is available on the ATCC web site at. References manner: Enterococcus faecalis (ATCC 9433 ) References and other information relating to this product are available online at. : Appropriate safety procedures should always be used with this material. Laboratory safety is discussed in the current publication of the Biosafety in Microbiological and Biomedical Laboratories from the U.S. Department of Health and Human Services Centers for Disease Control and Prevention and National Institutes for Health. ATCC Warranty ATCC products are warranted for 3 days from the date of shipment, and this warranty is valid only if the product is stored and handled according to the information included on this product information sheet. If the ATCC product is a living cell or microorganism, ATCC lists the media formulation that has been found to be effective for this product. While other, unspecified media may also produce satisfactory results, a change in media or the absence of an additive from the ATCC recommended media may affect recovery, growth and/or function of this product. If an alternative medium formulation is used, the ATCC warranty for viability is no longer valid. Disclaimers PO Box 549 Manassas, VA 8 USA or Fax: This product is intended for laboratory research purposes only. It is not intended for use in humans. While ATCC uses reasonable efforts to include accurate and up to date information on this product sheet, ATCC makes no warranties or representations as to its accuracy. Citations from scientific literature and patents are provided for informational purposes only. ATCC does not warrant that such information has been confirmed to be accurate. This product is sent with the condition that you are responsible for its safe storage, handling, and use. ATCC is not liable for any damages or injuries arising from receipt and/or use of this product. While reasonable effort is made to insure authenticity and reliability of materials on deposit, ATCC is not liable for damages arising from the misidentification or misrepresentation of such materials. Please see the enclosed Material Transfer Agreement (MTA) for further details regarding the use of this product. The MTA is also available on our Web site at Additional information on this culture is available on the ATCC web site at. Page of

8 ATCC 5. All rights reserved. ATCC is a registered trademark of the. [4/5] Enterococcus faecalis (ATCC 9433 ) Frozen: 8 C or Freeze Dried: C manner: Enterococcus faecalis (ATCC 9433 ) PO Box 549 Manassas, VA 8 USA or Fax: Page of

9 Description Streptomyces intermedius (ATCC 339 ) Designation: [ATCC 546, CBS., CBS , ETH 675, IFO 349, PSA 96, RIA 4] Deposited Name: Actinomyces intermedius (Kruger) Wollenweber Medium ATCC Medium 96: Yeast malt extract agar Growth Conditions Temperature: 6. C References References and other information relating to this product are available online at. : manner: Streptomyces intermedius (ATCC 339 ) Appropriate safety procedures should always be used with this material. Laboratory safety is discussed in the current publication of the Biosafety in Microbiological and Biomedical Laboratories from the U.S. Department of Health and Human Services Centers for Disease Control and Prevention and National Institutes for Health. ATCC Warranty ATCC products are warranted for 3 days from the date of shipment, and this warranty is valid only if the product is stored and handled according to the information included on this product information sheet. If the ATCC product is a living cell or microorganism, ATCC lists the media formulation that has been found to be effective for this product. While other, unspecified media may also produce satisfactory results, a change in media or the absence of an additive from the ATCC recommended media may affect recovery, growth and/or function of this product. If an alternative medium formulation is used, the ATCC warranty for viability is no longer valid. Disclaimers This product is intended for laboratory research purposes only. It is not intended for use in humans. While ATCC uses reasonable efforts to include accurate and up to date information on this product sheet, ATCC makes no warranties or representations as to its accuracy. Citations from scientific literature and patents are provided for informational purposes only. ATCC does not warrant that such information has been confirmed to be accurate. This product is sent with the condition that you are responsible for its safe storage, handling, and use. ATCC is not liable for any damages or injuries arising from receipt and/or use of this product. While reasonable effort is made to insure authenticity and reliability of materials on deposit, ATCC is not liable for damages arising from the misidentification or misrepresentation of such materials. Please see the enclosed Material Transfer Agreement (MTA) for further details regarding the use of this product. The MTA is also available on our Web site at Additional information on this culture is available on the ATCC web site at. ATCC 3. All rights reserved. ATCC is a registered trademark of the. [/3] PO Box 549 Manassas, VA 8 USA or Fax: Page of

10 Description Pseudomonas fluorescens (ATCC 355 ) Designation: NCTC 38 [8/5, CCEB 546, DSM 59, NCIB 946, NCPPB 964, PJ39, R. Hugh 88, R.Y. Stanier 9, Biotype A] Deposited Name: Pseudomonas fluorescens Migula Product Description: Type strain. This strain is recommended by ATCC for use in the tests described in ASTM Standard Test Method E979 9 where only the taxon is specified. Used to assay antimicrobial preservatives. Frozen: 8 C or Freeze Dried: C Medium ATCC Medium 3: Nutrient agar or nutrient broth Growth Conditions Temperature: 6 C Atmosphere: Aerobic Procedure. Open the vial according to the enclosed instructions.. Using a single tube of #3 broth (5 to 6 ml), withdraw approximately.5 to. ml with a Pasteur or. ml pipette. Rehydrate the entire pellet. 3. Aseptically transfer this aliquot back into the primary broth tube. Mix well. 4. Use several drops of the suspension to inoculate a #3 agar slant and/or plate. 5. Incubate the tubes and plate at 6 C for 4 48 hours. Notes manner: Pseudomonas fluorescens (ATCC 355 ) This strain produces fluorescein pigment. Additional information on this culture is available on the ATCC web site at. References References and other information relating to this product are available online at. : Appropriate safety procedures should always be used with this material. Laboratory safety is discussed in the current publication of the Biosafety in Microbiological and Biomedical Laboratories from the U.S. Department of Health and Human Services Centers for Disease Control and Prevention and National Institutes for Health. ATCC Warranty ATCC products are warranted for 3 days from the date of shipment, and this warranty is valid only if the product is stored and handled according to the information included on this product information sheet. If the ATCC product is a living cell or microorganism, ATCC lists the media formulation that has been found to be effective for this product. While other, unspecified media may also produce satisfactory results, a change in media or the absence of an additive from the ATCC recommended media may affect recovery, growth and/or function of this product. If an alternative medium formulation is used, the ATCC warranty for viability is no longer valid. Disclaimers PO Box 549 Manassas, VA 8 USA or Fax: This product is intended for laboratory research purposes only. It is not intended for use in humans. While ATCC uses reasonable efforts to include accurate and up to date information on this product sheet, ATCC makes no warranties or representations as to its accuracy. Citations from scientific literature and patents are provided for informational purposes only. ATCC does not warrant that such information has been confirmed to be accurate. This product is sent with the condition that you are responsible for its safe storage, handling, and use. ATCC is not liable for any damages or injuries arising from receipt and/or use of this product. While reasonable effort is made to insure authenticity and reliability of materials on deposit, ATCC is not liable for damages arising from the misidentification or misrepresentation of such materials. Page of

11 Please see the enclosed Material Transfer Agreement (MTA) for further details regarding the use of this product. The MTA is also available on our Web site at Additional information on this culture is available on the ATCC web site at. ATCC 7. All rights reserved. ATCC is a registered trademark of the. [/] Pseudomonas fluorescens (ATCC 355 ) Frozen: 8 C or Freeze Dried: C manner: Pseudomonas fluorescens (ATCC 355 ) PO Box 549 Manassas, VA 8 USA or Fax: Page of

12 Description Curvularia geniculata (ATCC 53 ) Frozen: 8 C or Freeze Dried: C manner: Curvularia geniculata (ATCC 53 ) Strain Designation: CBS 87.5 Deposited Name: Curvularia geniculata (Tracy et Earle) Boedijn Product Description: An ampoule containing viable cells (may include spores and mycelia) suspended in cryoprotectant. The information recommended in this section is to assist users in obtaining living culture(s) for their studies. The recommendation does not imply that the conditions or procedures provided below are optimum. Experienced researchers may initiate the growth of a culture in their own way. ATCC Medium : YM agar or YM broth ATCC Medium 3: Czapek's agar ATCC Medium 336: Potato dextrose agar (PDA) Growth Conditions Temperature: 4 C to 6 C Atmosphere: Typical aerobic Recommended Procedure For freeze dry (lyophilized) ampoules:. Open an ampoule according to enclosed instructions.. From a single test tube of sterile distilled water (5 to 6 ml), withdraw approximately.5 to. ml with a sterile pipette and apply directly to the pellet. Stir to form a suspension. 3. Aseptically transfer the suspension back into the test tube of sterile distilled water. 4. Let the test tube sit at room temperature (5 C) undisturbed for at least hours; longer (e.g., overnight) rehydration might increase viability of some fungi. 5. Mix the suspension well. Use several drops (or make dilutions if desired) to inoculate recommended solid or liquid medium. Include a control that receives no inoculum. 6. Incubate the inoculum at the propagation conditions recommended. 7. Inspect for growth of the inoculum/strain regularly. The sign of viability is noticeable typically after 4 days of incubation. However, the time necessary for significant growth will vary from strain to strain. Notes Additional information on this culture is available on the ATCC web site at. DNA Sequence 8S ribosomal RNA gene, partial sequence; internal transcribed spacer, 5.8S ribosomal RNA gene, and internal transcribed spacer, complete sequence; and 8S ribosomal RNA gene, partial sequence GGTCTCCGTAGGTGAACCTGCGGAGGGATCATTACACAATAAACATATGAAGGCTGCACCGCCAACA GGCGGCAAGGCTGGAGTATTTTATTACCCTTGTCTTTTGCGCACTTGTTGTTTCCTGGGCGGGTTCGCCC GCCTCCAGGACCACATGATAAACCTTTTTTATGCAGTTGCAATCAGCGTCAGTACAACAAATGTAAATC ATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACG TAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAA AGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTTTTTTGTCTTTGGT TTTGTCCAAAGACTCGCCTTAAAACGATTGGCAGCCGGCCTACTGGTTTCGCAGCGCAGCACATTTTTG CGCTTGCAATCAGCAAAAGAGGACGGCACTCCATCAAGACTCTATATCACTTTTGACCTCGGATCAGG TAGGGATACCCGCTGAACTTAAGCATATCAATAA PO Box 549 Manassas, VA 8 USA or Fax: DD region of the 8S ribosomal RNA gene ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAC AGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGC AGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCTATT GCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTT CTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTT TGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCA GTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGCAGGCAGGCCAGCATCAGTTTGGGCGGTGGGA TAAAGGTCTCTGACACGTTCCTTCCTTCGGGTTGGCCATATAGGGGAGACGTCATACCACCAGCCTGGA CTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGC Page of

13 Isolation Seed of Andropogon sorghum, Indonesia Curvularia geniculata (ATCC 53 ) References References and other information relating to this product are available online at. : Frozen: 8 C or Freeze Dried: C manner: Curvularia geniculata (ATCC 53 ) Appropriate safety procedures should always be used with this material. Laboratory safety is discussed in the current publication of the Biosafety in Microbiological and Biomedical Laboratories from the U.S. Department of Health and Human Services Centers for Disease Control and Prevention and National Institutes for Health. ATCC Warranty ATCC products are warranted for 3 days from the date of shipment, and this warranty is valid only if the product is stored and handled according to the information included on this product information sheet. If the ATCC product is a living cell or microorganism, ATCC lists the media formulation that has been found to be effective for this product. While other, unspecified media may also produce satisfactory results, a change in media or the absence of an additive from the ATCC recommended media may affect recovery, growth and/or function of this product. If an alternative medium formulation is used, the ATCC warranty for viability is no longer valid. Disclaimers This product is intended for laboratory research purposes only. It is not intended for use in humans. While ATCC uses reasonable efforts to include accurate and up to date information on this product sheet, ATCC makes no warranties or representations as to its accuracy. Citations from scientific literature and patents are provided for informational purposes only. ATCC does not warrant that such information has been confirmed to be accurate. This product is sent with the condition that you are responsible for its safe storage, handling, and use. ATCC is not liable for any damages or injuries arising from receipt and/or use of this product. While reasonable effort is made to insure authenticity and reliability of materials on deposit, ATCC is not liable for damages arising from the misidentification or misrepresentation of such materials. Please see the enclosed Material Transfer Agreement (MTA) for further details regarding the use of this product. The MTA is also available on our Web site at Additional information on this culture is available on the ATCC web site at. ATCC 7. All rights reserved. ATCC is a registered trademark of the. [/3] PO Box 549 Manassas, VA 8 USA or Fax: Page of

14 Description Cladosporium sphaerospermum (ATCC 88 ) Frozen: 8 C or Freeze Dried: C manner: Cladosporium sphaerospermum (ATCC 88 ) Strain Designation: CBS [CBS 9.54, IMI 49636] Deposited Name: Cladosporium sphaerospermum Penzig, anamorph Product Description: An ampoule containing viable cells (may include spores and mycelia) suspended in cryoprotectant. The information recommended in this section is to assist users in obtaining living culture(s) for their studies. The recommendation does not imply that the conditions or procedures provided below are optimum. Experienced researchers may initiate the growth of a culture in their own way. ATCC Medium : YM agar or YM broth ATCC Medium 336: Potato dextrose agar (PDA) ATCC Medium 337: Potato, dextrose, yeast agar (PDY) Growth Conditions Temperature: 4 C to 6 C Atmosphere: Typical aerobic Recommended Procedure For freeze dry (lyophilized) ampoules:. Open an ampoule according to enclosed instructions.. From a single test tube of sterile distilled water (5 to 6 ml), withdraw approximately.5 to. ml with a sterile pipette and apply directly to the pellet. Stir to form a suspension. 3. Aseptically transfer the suspension back into the test tube of sterile distilled water. 4. Let the test tube sit at room temperature (5 C) undisturbed for at least hours; longer (e.g., overnight) rehydration might increase viability of some fungi. 5. Mix the suspension well. Use several drops (or make dilutions if desired) to inoculate recommended solid or liquid medium. Include a control that receives no inoculum. 6. Incubate the inoculum at the propagation conditions recommended. 7. Inspect for growth of the inoculum/strain regularly. The sign of viability is noticeable typically after 3 days of incubation. However, the time necessary for significant growth will vary from strain to strain. DNA Sequence 8S ribosomal RNA gene, partial sequence; internal transcribed spacer, 5.8S ribosomal RNA gene, and internal transcribed spacer, complete sequence; and 8S ribosomal RNA gene, partial sequence GGTCTCCGTAGGTGAACCTGCGGAGGGATCATTACAAGTGACCCCCGGCTCCGGCCGGGGATGTTCAT AACCCTTTGTTGTCCGACTCTGTTGCCTCCGGGGCGACCCTGCCTTTTCACGGGCGGGGGCCCCGGGTG GACACATCAAAACTCTTGCGTAACTTTGCAGTCTGAGTAAATTTAATTAATAAATTAAAACTTTCAACA ACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGA ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCG AGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCGACGCGGTCCGCCGCGCGCCTCAAATCGAC CGGCTGGGTCTTCTGTCCCCTCAGCGTTGTGGAAACTATTCGCTAAAGGGTGCCACGGGAGGCCACGC CGAAAAACAAACCCATTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATAT CAATAA PO Box 549 Manassas, VA 8 USA or Fax: Page of DD region of the 8S ribosomal RNA gene ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCTCTAGTAACGGCGAGTGAAGCAGCAAT AGCTCAAATTTGAAATCTGGCGTCTTCGGCGTCCGAGTTGTAATTTGTAGAGGATGCTTCTGGGCAGCC ACCGACCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGTCGGAAAGGCA CCCTACACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCT TCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACT TTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGGGATTGCAACCAGACTTGCTCGC GGTGTTCCGCCGGTCTTCTGACCGGTTCACTCGCCGCGTTGCAGGCCAGCATCGTCTGGTGCCGCTGGA TAAGACTGGAGGAATGTAGCTCCCTCGGGAGTGTTGTAGCCTCTAGTGATGCAGCGAGCGCCGGGCG AGGTCCGCGCTTCGGCTAGGATGCTGGCGTAATGGTCGTAATCCGC Isolation Human nails

15 References References and other information relating to this product are available online at. Cladosporium sphaerospermum (ATCC 88 ) : Appropriate safety procedures should always be used with this material. Laboratory safety is discussed in the current publication of the Biosafety in Microbiological and Biomedical Laboratories from the U.S. Department of Health and Human Services Centers for Disease Control and Prevention and National Institutes for Health. ATCC Warranty Frozen: 8 C or Freeze Dried: C ATCC products are warranted for 3 days from the date of shipment, and this warranty is valid only if the product is stored and handled according to the information included on this product information sheet. If the ATCC product is a living cell or microorganism, ATCC lists the media formulation that has been found to be effective for this product. While other, unspecified media may also produce satisfactory results, a change in media or the absence of an additive from the ATCC recommended media may affect recovery, growth and/or function of this product. If an alternative medium formulation is used, the ATCC warranty for viability is no longer valid. Disclaimers This product is intended for laboratory research purposes only. It is not intended for use in humans. While ATCC uses reasonable efforts to include accurate and up to date information on this product sheet, ATCC makes no warranties or representations as to its accuracy. Citations from scientific literature and patents are provided for informational purposes only. ATCC does not warrant that such information has been confirmed to be accurate. This product is sent with the condition that you are responsible for its safe storage, handling, and use. ATCC is not liable for any damages or injuries arising from receipt and/or use of this product. While reasonable effort is made to insure authenticity and reliability of materials on deposit, ATCC is not liable for damages arising from the misidentification or misrepresentation of such materials. Please see the enclosed Material Transfer Agreement (MTA) for further details regarding the use of this product. The MTA is also available on our Web site at Additional information on this culture is available on the ATCC web site at. ATCC 5. All rights reserved. ATCC is a registered trademark of the. [/5] manner: Cladosporium sphaerospermum (ATCC 88 ) PO Box 549 Manassas, VA 8 USA or Fax: Page of