Library Preparation for Illumina Sequencing

Transcription

1 Materials Library Preparation for Illumina Sequencing Cleanup Kits: Ampure Store in +4 o C: Fermentas 1kb Ladder, Low Mass Ladder Phusion DNA polymerase, NEB Cat# F-531 (-20 o C for long term storage) Store in C: Fragmentase Enzyme, NEB Cat# M0348S End Repair Module, NEB Cat# E6050S Klenow Fragment, NEB Cat# M0212S Quick Ligation Kit, NEB Cat# M2200S 100mM datp PE Adapters 1 aaccc 9 acacg 17 acgat 25 agcca 33 aggtt 41 gtcgc 2 caact 10 ccatc 18 cgcta 26 ctagt 34 ctgct 42 tgtac 3 gaatc 11 gagta 19 gattg 27 gccat 35 ggact 43 atgca 4 taagc 12 tagct 20 tccac 28 tctgg 36 tgcgt 44 gtgag 5 aagcg 13 accta 21 actac 29 agctc 37 agtcg 45 ttagg 6 catag 14 cctct 22 cgtat 30 ctctg 38 ggtaa 46 attgc 7 gacac 15 gatgt 23 gcaga 31 gcgtt 39 tggag 47 gttac 8 tacag 16 tcaag 24 tcgaa 32 tgatg 40 atcgg 48 tttcc 5 -P-abcdeAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG-3 >adb2_xxxxx 5 -ACACTCTTTCCCTACACGACGCTCTTCCGATCTedcba-T-3 PE Enrichment Primers >PrBpe 5'- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3 >PrApe 5'-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT-3 PE Sequencing Primer 5'-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3 5'-CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT-3 All primer sequences are copyright of Illumina. Version 3 Page 1 of 6

2 I. Spike PCR Pools Spike 1ng lambda DNA to every 1.5µg PCR this will serve as a means to detect library swapping or contamination. Figure 1. Map of spikes orientation II. Initial Cleanup of PCR Pools Start with 500ng of pooled PCR products. Primer-dimers must be removed prior to fragmentation. Purify using (1.8 X pool volume) of Ampure. Use freshly made 70% ethanol. Elute in 40µl EB. III. DNA Fragmentation 1. Start the PCR machine and allow to warm up. 2. Combine and mix the following components: 3. Incubate the reaction at 37 o C for 45 minutes. 4. Take out the reaction and run 2µl on agarose with 3µl of 1kb ladder. Do this step quickly because you need to put the reaction in the -20 o C to pause the reaction. 5. If most of the sample is concentrated in the bp region (see Figure 1), stop the reaction with 5µl of 0.5M EDTA. If the sample looks under-digested, then put in the PCR machine for another 5-15 minutes at 37 o C. Repeat until the sample appears properly digested. 6. Purify using Ampure. Elute in 40µl EB. DNA (40) --- Water X Fragmentase Buffer X BSA dsdna Fragmentase 3 78 Reaction volume = 50µl Dispense 10µl per reaction 30 min Figure 1. Example of good fragmentase rxn. The ladder on the right is the 1kb ladder Version 3 Page 2 of 6 45 min

3 IV. Perform End Repair This protocol converts the overhangs resulting from fragmentation into blunt ends, using T4 DNA polymerase and E. coli DNA polymerase I Klenow fragment. The 3 to 5 exonuclease activity of theses enzymes removes 3 overhangs and the polymerase activity fills in the 5 overhangs. 1. Combine and mix the following components: DNA (40) --- Water X Buffer* Enzyme Mix TOTAL reaction volume = 100µl, dispense 60µl per reaction * Because there is ATP in the buffer, make aliquots to reduce the number of freezing/thawing 3. Incubate at room temperature for 30 minutes. 4. Purify using Ampure. Elute in 40µl EB. V. Add A Bases to the 3 End of the DNA Fragments This protocol adds an A base to the 3 end of the blunt phosphorylated DNA fragments, using the polymerase activity of the Klenow fragment (3 to 5 exo minus). This prepares the DNA fragments for ligation to the adapters, which have a single T base overhang at their 3 end. 1. Combine and mix the following components: DNA from step 3 (40) --- Water Klenow buffer = NEB Buffer mm datp (will have to make this up) Klenow fragment (3 to 5 exo minus) TOTAL reaction volume = 50µl, dispense 10.1µl per reaction 2. Incubate for 30 min at 37 C. 3. Purify using Ampure. Elute in 9µl EB. Version 3 Page 3 of 6

4 VI. Ligate Adapters to DNA Fragments This protocol ligates adapters to the ends of the DNA fragments, preparing them to be hybridized to a flow cell. 500ng of 250bp fragments = 6pmoles of ends.45 µl of 50µM adapters = 25 pmoles We want 1-DNA to 4-adapter. 1. Pipette 5µl of the 5µM ada+adb adapter mix of corresponding wells into a PCR plate as described below: Combine and mix the following components: 5 µm ada+adb adapter mix (5) --- DNA (9) --- 2X DNA Ligase Buffer DNA Ligase TOTAL reaction volume = 30µl, dispense 16µl per reaction 3. Incubate for 15 min at room temperature. 4. Heat kill enzyme at 70 o C for 10 minutes with PCR machine. Version 3 Page 4 of 6

5 VII. Purify Ligation Products with Ampure This protocol purifies the products of the ligation reaction using Ampure to remove all unligated adapters and remove any adapters that may have ligated to one another. Additionally, it allows for the size-selection of templates to go on the cluster generation platform. Desired Minimum Fragment Size (bp) Ratio of AMPure:Sample 200 1: : : : : :1 Double (size selection) Magic AMPure: Example select regions bp 1. Make the upper cut (0.7:1) a. Add 50µl sample to 35µl Ampure b. Incubate mixture for 10 minutes c. Let the sample separate on the magnet for 10 minutes (or until clear) d. Of the 85µl reaction, keep 75µl of the supernatant (try not to get any beads here!) 2. Make the lower cut (300bp): a. Add 56µl water and 49µl Ampure to the 75µl supernatant b. Incubate mixture for 10 minutes c. Let the sample separate on the magnet for 10 minutes (or until clear) 3. Regular cleanup: a. Discard supernatant and keep magnetic beads b. Wash magnetic beads with 200µl of 70% ethanol twice c. Remove excess ethanol and allow beads to dry for 10 minutes d. Elute beads in 30µl (this will be ready for enrichment) [50µl sample] x 0.7 = [35µl Ampure] By taking 75 of 85µl, the real sample and Ampure volumne will be: - Sample = (75/85) x 50 = 44µl - Ampure = (75/85) x 35 = 31µl The next reaction volume will be 180µl so you want a total volume of sample to be 100µl (ratio of 1) and the Ampure to be 80µl (ratio of 0.8). - Sample = = 56µl - Ampure = = 49µl Version 3 Page 5 of 6

6 VIII. Enrich the Adapter-Modified DNA Fragments by PCR This protocol uses PCR to selectively enrich those DNA fragments that have adapter molecules on both ends, and to amplify the amount of DNA in the library. The PCR performed with two primers that anneal to the ends of the adapters. Excessive PCR cycles can skew the representation of the library. 1. Combine and mix the following components: DNA from Step 4 (amount can vary) (3) --- Water X Phusion HF polymerase master mix Includes a mixture of buffer, dntps, and polymerase 5 µm, PrApe+PrBpe TOTAL reaction volume = 25µl, dispense 22µl per reaction 2. Amplify using the following PCR protocol (solexapcr14): 30 sec at 98 C 14 cycles 10 sec at 98 C, 30 sec at 65 C, 30 sec at 72 C 5 min at 72 C Hold at 10 C 3. Preload 5µl/1.25µl low mass ladder and run for 15 minutes. 4. On the same gel, run 3µl of 1kb ladder and 2µl of product on agarose and run for 5 minutes. Take a picture on the UV Imager. 5. Run on samples on agarose for another 25 minutes and take another picture. If amplification is successful, purify the remaining samples using Ampure. Elute in 40µl EB. 6. Quantify by using SYBR Green I. For each sample, run duplicate or triplicate reactions to avoid pipetting errors. 7. Normalize samples and run at least 10ng on agarose with 2.5µl low mass ladder. If samples look normalized, pool equally to make one final pool. 8. BioAnalyze the final library. The library is now ready for Illumina sequencing. Version 3 Page 6 of 6