I-SAGE Long Kit. For constructing Long SAGE (Serial Analysis of Gene Expression) libraries. Catalog no. T

Transcription

1 I-SAGE Long Kit Version D 19 October I-SAGE Long Kit For constructing Long SAGE (Serial Analysis of Gene Expression) libraries Catalog no. T tech_service@invitrogen.com

2 ii

3 Table of Contents Acknowledgements...v Shipping and Storage... vii Kit Contents... viii Introduction...1 Overview...1 Procedural Overview...4 Procedure...6 Day 1: Preparing Adapter-Linked cdna... 6 Isolating RNA...7 Binding mrna to Magnetic Beads...9 Synthesizing cdna...11 Digesting the cdna with Nla III...13 Day 2: Preparing Ditags Ligating LS Adapters to the cdna...15 Cleaving with Tagging Enzyme...17 Creating Ditags...18 Days 3 4: Amplifying Ditags...20 Optimizing PCR Conditions...21 Scale-Up PCR...24 Day 5: Isolating the 130-bp Ditag Gel-Purifying the 130-bp Ditag...26 Day 6: Isolating the 34-bp Ditags Digesting the 130-bp Ditag with Nla III...30 Gel-Purifying the 34-bp Ditag...31 Day 7: Forming Concatemers and Cloning Ligating the 34-bp Ditag to Yield Concatemers...34 Cloning Concatemers into pzero Transforming One Shot TOP10 Electrocomp E. coli...39 Days 8 9: Screening and Sequencing of Clones Screening Transformants...41 Sequencing...44 Analyzing Data...47 Appendix...48 Recipes...48 Troubleshooting...49 Verifying cdna Synthesis and Nla III Digestion...53 Verifying LS Adapter Ligation...55 Description of pzero Map of pzero iii

4 Table of Contents, Continued Features of pzero Control Reactions for pzero Polyacrylamide Gel Electrophoresis...61 Zeocin...63 Accessory Products...65 Purchaser Notification...66 Technical Service...68 References...70 LongSAGE Commercial Limited License Agreement...72 iv

5 Acknowledgements Invitrogen would like to thank all beta testing sites for their help in testing the I-SAGE protocols and procedures. Special thanks to Dr. Steven Madden of Genzyme Molecular Oncology and Drs. Victor Velculescu and Kenneth Kinzler of Johns Hopkins University for certain recommendations on the I-SAGE Long protocol v

6 vi

7 Shipping and Storage Shipping and Storage The I-SAGE Long kit (Catalog no. T ) is shipped on dry ice. Sufficient reagents are provided in the kit for constructing 5 libraries. Store individual modules of the kit as follows: Module cdna Synthesis Module (1A) cdna Synthesis Module (1B) Cleavage Module Ditag Formation Module Ditag PCR Module Concatemer Module Nla III Module Performance Check Module Zero Background Cloning Kit One Shot TOP10 Electrocomp E coli S.N.A.P. Columns and Collection Tubes Storage Temperature +4 C -20 C -20 C -20 C -20 C -20 C -80 C -20 C -20 C -80 C Room temperature vii

8 Kit Contents Introduction The I-SAGE Long kit is grouped into modules; each module contains the reagents and materials required for a particular part of the procedure. This section lists the contents of each module of the kit. cdna Synthesis Module (1A) Reagents included in the cdna Synthesis Module (1A) are described in the table below. Item Formulation Amount DEPC Water Sterile, DEPC-treated water ml Dynal Oligo(dT) Magnetic Beads 5 mg/ml in PBS containing 0.02% sodium azide Wash Buffer A 10 mm Tris-HCl, ph M LiCl 1 mm EDTA 0.1% lithium dodecyl sulfate 10 µg/ml glycogen Wash Buffer B 10 mm Tris-HCl, ph mm LiCl 1 mm EDTA 10 µg/ml glycogen Wash Buffer C 5 mm Tris, ph mm EDTA 1 M NaCl 1% sodium dodecyl sulfate (SDS) 10 µg/ml mussel glycogen Wash Buffer D 5 mm Tris, ph mm EDTA 1 M NaCl 200 µg/ml bovine serum albumin (BSA) Lysis/Binding Buffer 100 mm Tris-HCl, ph mm LiCl 10 mm EDTA 1% lithium dodecyl sulfate 5 mm DTT 600 µl 12 ml 6 ml 9 ml 18 ml 9 ml 0.5 M EDTA 0.5 M EDTA in deionized water 250 µl Continued on next page viii

9 Kit Contents, Continued cdna Synthesis Module (1B) Reagents included in the cdna Synthesis Module (1B) are described in the table below. Item Composition Amount 5X First Strand Buffer 250 mm Tris-HCl, ph µl 375 mm KCl 15 mm MgCl M Dithiothreitol (DTT) in DEPC water 55 µl dntp Mix 10 mm datp 120 µl (10 mm each) 10 mm dgtp 10 mm dctp 10 mm dttp in DEPC water 5X Second Strand Buffer 100 mm Tris-HCl, ph mm KCl 900 µl 23 mm MgCl mm β NAD + 50 mm ammonium sulfate 1X First Strand Buffer 50 mm Tris-HCl, ph mm KCl ml RNaseOUT SuperScript II Reverse Transcriptase (RT) 3 mm MgCl 2 10 µg/ml mussel glycogen 40 U/µl in: 20 mm Tris-HCl, ph 8 50 mm KCl 0.5 mm EDTA 8 mm DTT 50% glycerol (w/v) 200 U/µl in: 20 mm Tris-HCl, ph mm NaCl 0.1 mm EDTA 1 mm DTT 0.01% Nonidet-40 (v/v) 50% glycerol (w/v) 6 µl 18 µl Continued on next page ix

10 Kit Contents, Continued cdna Synthesis Module (1B), continued Item Composition Amount 1X Buffer 4 20 mm Tris-acetate, ph mm magnesium acetate 50 mm potassium acetate 1 mm DTT 200 µg/ml BSA 4 ml E. coli DNA Ligase 10 U/µl in: 10 mm Tris-HCl, ph mm KCl 0.1 mm EDTA 1m M DTT 200 µg/ml BSA 50% glycerol (w/v) 0.1% Triton X-100 E. coli DNA Polymerase 10 U/µl in: 50 mm potassium phosphate, ph mm KCl 1 mm DTT 50% glycerol (w/v) E. coli RNase H 2 U/µl in: 20 mm Tris-HCl, ph mm KCl 10 mm MgCl mm EDTA 0.1 mm DTT 50 µg/ml BSA 50% glycerol (w/v) 30 µl 120 µl 30 µl Control HeLa Total RNA 500 ng/µl in DEPC-treated water 10 µg Continued on next page x

11 Kit Contents, Continued Cleavage Module The following reagents are supplied in the Cleavage Module. For the sequences of the LS adapters, see page xvii. Item Formulation Amount 10X Buffer mm Tris-acetate, ph mm magnesium acetate 500 mm potassium acetate 10 mm DTT 325 µl 1X Buffer 4 20 mm Tris-acetate, ph mm magnesium acetate 50 mm potassium acetate 1 mm DTT 2 2 ml SAM 32 mm S-adenosylmethionine 12.5 µl Mme I 2 U/µl in: 50 mm NaCl 10 mm Tris-HCl, ph mm EDTA 1 mm DTT 200 µg/ml BSA 50% glycerol (w/v) 100 µl Mussel Glycogen 20 mg/ml in DEPC water 30 µl 10X Ligase Buffer 60 mm Tris-HCl, ph mm MgCl 2 50 mm NaCl 1 mg/ml BSA 70 mm β-mercaptoethanol 1 mm ATP 20 mm DTT 10 mm spermidine 1X Ligase Buffer T4 DNA Ligase 10X Ligase Buffer is diluted to 1X in DEPC water 4.0 Weiss units/µl in: 10 mm Tris-HCl, ph mm potassium chloride 1 mm DTT 50% glycerol (w/v) 20 µl ml 25 µl DEPC water Sterile, DEPC-treated water 1.5 ml Continued on next page xi

12 Kit Contents, Continued Cleavage Module, continued Item Formulation Amount Wash Buffer C 5 mm Tris, ph mm EDTA 1 M NaCl 1% sodium dodecyl sulfate (SDS) 10 µg/ml mussel glycogen Wash Buffer D 5 mm Tris, ph mm EDTA 1 M NaCl 200 µg/ml BSA 8 ml 40 ml 7.5 M Ammonium Acetate in DEPC-treated water 1.4 ml LoTE 3 mm Tris-HCl, ph mm EDTA, ph ml LS Adapter A 40 ng/µl double-strand DNA in LoTE 10 µl LS Adapter B 40 ng/µl double-strand DNA in LoTE 10 µl Nla III Module The Nla III Module contains the following reagents: Nla III 10 U/µl in 200 mm KCl 10 mm Tris-HCl, ph mm EDTA 1 mm DTT 500 µg/ml BSA 50% glycerol (w/v) 100X BSA 10 mg/ml BSA in 20 mm potassium phosphate, ph 7 50 mm NaCl 0.1 mm EDTA 5% glycerol (w/v) 5 43 µl 65 µl Continued on next page xii

13 Kit Contents, Continued Ditag Formation Module The Ditag Formation Module contains the following reagents: Item Formulation Amount 10X Ligase Buffer 60 mm Tris-HCl, ph mm MgCl 2 50 mm NaCl 1 mg/ml BSA 70 mm β-mercaptoethanol 1 mm ATP 20 mm DTT 10 mm spermidine 15 µl T4 DNA Ligase 4.0 Weiss units/µl in: 10 mm Tris-HCl, ph mm potassium chloride 1 mm DTT 50% glycerol (w/v) LoTE 3 mm Tris-HCl, ph mm EDTA, ph µl 1.1 ml DEPC Water Sterile, DEPC-treated water 1.75 ml 7.5 M Ammonium Acetate in DEPC-treated water 930 µl 3 mm Tris/HCl 3 mm Tris-HCl, ph µl Mussel Glycogen 20 mg/ml in DEPC-treated water 21 µl Continued on next page xiii

14 Kit Contents, Continued Ditag PCR Module The Ditag PCR Module contains the following reagents. For sequence of the primers, see page xviii. To order the Ditag PCR Module separately from Invitrogen, see page 65. Items Formulation Amount dntp Mix 10 mm datp ml (10 mm each) 10 mm dgtp 10 mm dctp 10 mm dttp in DEPC water 10X BV Buffer 166 mm ammonium sulfate 5 ml 670 mm Tris-HCl, ph mm MgCl mm β-mercaptoethanol DMSO -- 3 ml DEPC Water Sterile, DEPC-treated water 27 ml LS Control Template 10 pg/µl in DEPC-treated water 15 µl LS Ditag Primer-1 (LS DTP-1) 175 ng/µl in DEPC-treated water LS Ditag Primer-2 (LS DTP-2) 175 ng/µl in DEPC-treated water 2 1 ml 2 1 ml Performance Check Module The components of the Performance Check Module are described in the table below. For sequence of the primers, see page xviii. Item Formulation Amount 10X BV Buffer 166 mm ammonium sulfate 670 mm Tris-HCl, ph mm MgCl mm β-mercaptoethanol 310 µl dntp Mix (10 mm each) 10 mm datp 10 mm dgtp 10 mm dctp 10 mm TTP in DEPC-treated water 310 µl DMSO µl GAPDH Primer Set 100 ng/µl in DEPC-treated water 44 µl EF Sense Primer 100 ng/µl in DEPC-treated water 22 µl EF Anti-sense Primer 100 ng/µl in DEPC-treated water 102 µl LS DTP ng/µl in DEPC-treated water 40 µl LS DTP ng/µl in DEPC-treated water 40 µl DEPC Water Sterile, DEPC-treated water 2 1 ml Continued on next page xiv

15 Kit Contents, Continued Concatemer Module The Concatemer Module contains the following reagents: Item Formulation Amount 10X Ligase Buffer 60 mm Tris-HCl, ph mm MgCl 2 50 mm NaCl 1 mg/ml BSA 70 mm β-mercaptoethanol 1 mm ATP 20 mm DTT 10 mm spermidine 5 µl T4 DNA Ligase 100X BSA 4.0 Weiss units/µl in: 10 mm Tris-HCl, ph mm potassium chloride 1 mm DTT 50% glycerol (w/v) 10 mg/ml BSA in: 20 mm potassium phosphate 50 mm NaCl 0.1 mm EDTA 5% glycerol (w/v) 10X Buffer mm Tris-acetate, ph mm magnesium acetate 500 mm potassium acetate 10 mm DTT 25 µl 30 µl 225 µl Mussel Glycogen 20 mg/ml in DEPC-treated water 621 µl 10X Buffer mm Tris-HCl, ph µl Sph I 10 mm MgCl 2 50 mm NaCl 1 mm DTT 5 U/µl in: 100 mm NaCl 10 mm Tris-HCl, ph mm EDTA 1 mm DTT 100 µg/ml BSA 50% glycerol (w/v) 10 µl Continued on next page xv

16 Kit Contents, Continued Concatemer Module, continued Item Formulation Amount DEPC Water Sterile, DEPC-treated water 33 µl 7.5 M Ammonium Acetate in DEPC-treated water 29 ml LoTE 3 mm Tris-HCl, ph mm EDTA, ph ml Zero Background Cloning Kit The Zero Background Cloning Kit contains the following reagents. Item Concentration Amount pzero -1 vector, supercoiled 1 µg/µl in TE buffer, ph µg Sterile Water Nuclease-free water 1 ml 10X Ligation Buffer 60 mm Tris-HCl, ph mm MgCl 2 50 mm NaCl 1 mg/ml BSA 70 mm β-mercaptoethanol 1 mm ATP 20 mm dithiothreitol 10 mm spermidine T4 DNA Ligase 4.0 Weiss units/µl in: 10 mm Tris-HCl, ph mm potassium chloride 1 mm DTT 50% glycerol TE Buffer 10 mm Tris-HCl, ph mm EDTA 100 µl 25 µl 2 ml Zeocin antibiotic 100 mg/ml in water 125 mg Test Inserts, Blunt Ended φx174 Hae III DNA 20 ng/µl in TE buffer, ph µl Continued on next page xvi

17 Kit Contents, Continued One Shot Reagents Each One Shot TOP10 Electrocomp E. coli kit contains sufficient reagents for 20 transformations. Two kits are provided with each I-SAGE Long kit. Store at -80 C. Item Concentration Amount SOC Medium (may be stored at room temperature or +4 C) 2% tryptone 0.5% yeast extract 10 mm NaCl 2.5 mm KCl 10 mm MgCl 2 10 mm MgSO 4 20 mm glucose 100 ml 2 TOP10 E. coli µl (3 boxes) 2 puc19 Control DNA 10 pg/µl in 5 mm Tris- HCl, 0.5 mm EDTA, ph 8 50 µl 2 Genotype of TOP10 E. coli TOP10: F - mcra (mrr-hsdrms-mcrbc) ϕ80lacz M15 lacx74 reca1 arad139 (ara-leu)7697 galu galk rpsl enda1 nupg S.N.A.P. Columns and Collection Tubes The kit includes micron cellulose acetate microcentrifuge spin columns and sterile microcentrifuge collection tubes. The columns are sterilized and RNase-free. After opening, store the collection tubes and columns in a sterile container. Invitrogen Magnetic Stand A magnetic stand is available separately from Invitrogen (Catalog no. R670-01). For ordering information, see page 65. LS Adapter Sequences The LS adapters are modified with an amino group at the 3 end to prevent self-ligation. Note that two LS adapters are used to prevent snap-back of templates when the ditags are amplified. LS Adapter A (40 ng/µl) 5 TTTGGATTTGCTGGTGCAGTACAACTAGGCTTAATATCCGACATG 3 3 amino(c7) CCTAAACGACCACGTCATGTTGATCCGAATTATAGGCT PO 4 5 LS Adapter B (40 ng/µl) 5 TTTCTGCTCGAATTCAAGCTTCTAACGATGTACGTCCGACATG 3 3 amino(c7) GACGAGCTTAAGTTCGAAGATTGCTACATGCAGGCT PO 4 5 Continued on next page xvii

18 Kit Contents, Continued Primer Sequences The table below lists the sequence and concentration of the primers included in this kit. Primer Sequence Concentration LS DTP-1 5 -GTGCTCGTGGGATTTGCTGGTGCAGTACA ng/µl LS DTP-2 5 -GAGCTCGTGCTGCTCGAATTCAAGCTTCT ng/µl EF (Elongation Factor-1α) Sense Primer EF (Elongation Factor-1α) Anti-sense Primer GAPDH (Glyceraldehyde-3- phosphate dehydrogenase) Primer Set 5 -CATGTGTGTTGAGAGCTTC-3 5 -GAAAACCAAAGTGGTCCAC-3 Forward: 5 -TTAGCACCCCTGGCCAAGG-3 Reverse: 5 -CTTACTCCTTGGAGGCCATG ng/µl 100 ng/µl 100 ng/µl 100 ng/µl It is normal to have some leftover reagents in the kit after constructing five I-SAGE Long libraries. These reagents are supplied in excess to ensure that you have enough reagents to perform your experiments. Product Qualification The I-SAGE Long Kit is qualified in a functional protocol using kit components, starting with total HeLa RNA and proceeding through binding of the mrna to magnetic beads (page 9), cdna synthesis using SuperScript II RT (page 11), Nla III digestion (page 13), adapter ligation (page 15), Mme I cleavage (page 17), ditag creation (page 18), ditag PCR (page 21), and analysis of the PCR product (page 23). The yield of the ditag is compared to that of the LS Control Template. xviii

19 Introduction Overview Introduction The I-SAGE Long kit provides a method to construct Long SAGE libraries for quantitative analysis of gene expression. The I-SAGE Long kit is based on the technique developed by Velculescu et al, 1995, St. Croix et al, 2000, and Saha et al, 2001, and modified by Saha et al, 2002, for obtaining a digital genome-wide expression profile of the genes involved in normal and disease processes. The Long SAGE technique generates a unique bp tag for each transcript, as opposed to the bp tag generated by the original SAGE method. This longer sequence allows for the identification of more unique transcripts and the design of more efficient PCR primers and hybridization probes for use in downstream gene-isolation applications. The I-SAGE Long protocol has been modified from the original technique to increase efficiency of the various enzymatic reactions and permit analysis of gene expression from small amounts of sample. The I-SAGE Long technology enables you to analyze every transcript in a cell without the need for any prior knowledge of the transcript and is unaffected by any PCR or cloning bias. A description of the I-SAGE Long technique is provided below. For more details on SAGE, please refer to published reviews (Bertelsen and Velculescu, 1998; Velculescu et al., 2000). For a glossary of terms used in this manual, please see page 3. Applications The I-SAGE Long kit can be used to: Obtain a comprehensive gene expression profile for a specific tissue or cell type Identify novel genes Characterize transcriptomes Study gene expression patterns in normal, developmental, or disease states Eliminate matches to multiple unigene clusters identified by traditional SAGE techniques Identify more sequence information to facilitate full-length cloning of novel targets Provide sufficient sequence information for direct mapping to genomic DNA Concept I-SAGE Long is based on three principles: A sequence tag obtained from a defined region within each transcript contains sufficient information to uniquely identify a transcript. Sequence tags can be linked together to form long DNA molecules (concatemers) that can be cloned and sequenced. Sequencing of the concatemer clones results in the identification of individual tags. The expression level of the transcript is quantified by the number of times a particular tag is observed. Continued on next page 1

20 Overview, Continued Description The I-SAGE Long procedure is illustrated below: 1. Bind your RNA sample or cell lysate to oligo(dt) magnetic beads. The beads capture poly A + RNA directly from your sample. AAAAAA TTTTTT 2. Synthesize double stranded cdna on the beads containing your mrna using SuperScript II Reverse Transcriptase and E. coli DNA polymerase. Since all the enzymatic steps are performed in one tube, the efficiency of cdna synthesis increases and sample loss is reduced. AAAAAA TTTTTT 3. Digest the double stranded cdna with a sequence-specific restriction enzyme (an anchoring enzyme) that cleaves most transcripts at least once. Nla III is used as an anchoring enzyme since Nla III sites are known to occur approximately every 250 bp. GTAC AAAAAA TTTTTT 4. Divide the cdna into two fractions and ligate with two adapters (LS Adapter A and LS Adapter B, ~40 bp each). The LS adapters contain cohesive 4-bp overhangs complementary to the Nla III digested cdna, a Type IIS restriction enzyme (tagging enzyme) recognition site at the 3 end, and priming sites for PCR amplification. A CATG AAAAAA TTTTTT B CATG AAAAAA TTTTTT 5. Cleave with Mme I, a Type IIS restriction enzyme (tagging enzyme). Mme I binds to a recognition sequence in the adapter adjacent to the CATG site and cleaves the cdna 21 bp downstream from the adapter, releasing a ~60-bp tag with a 2-bp overhang. The tag consists of ~40 bp of adapter sequence and 21 bp of unique sequence from a single transcript. A CATG AAAAAA TTTTTT 6. Ligate the two fractions of tags to form ~130-bp ditags. CATG A GTAC B 7. Amplify the ~130-bp ditags using primers specific for the primer binding sites in the LS adapters to produce sufficient ditags for subsequent generation of concatemers. Since the tags are of short, uniform (~130 bp) size and the majority of sequence is similar due to adapters, there is no PCR bias. A 130 bp Ditag B Continued on next page 2

21 Overview, Continued Description, continued 8. Cleave the ~130-bp ditags with the anchoring enzyme that was used to cleave the original cdna (Nla III) to release 34-bp ditags. These ditags are comprised entirely of sequences derived from transcript cdnas. Each ditag is punctuated by Nla III recognition sequence. The 34-bp ditags are purified away from the LS adapters by polyacrylamide gel electrophoresis. CATG GTAC 9. Ligate the 34-bp ditags to form concatemers. Gel-purify fractions containing bp-length concatemers. CATG CATG GTAC CATG GTAC GTAC 10. Clone the concatemers into the pzero -1 vector to obtain a Long SAGE library. Sequence a representative number of clones. Each transcript is identified by its unique 17-bp sequence tag and is quantified by the number of times the tag occurs within a given population of clones. CATG CATG CATG GTAC pzero Analyze the sequence data using the SAGE2000 analysis software. The software extracts tag sequences from the concatemer sequences, tabulates the occurrence of each tag, and creates a report of each tag and its abundance. See the SAGE2000 software manual for instructions on downloading Long SAGE reference sequence databases and using them to analyze your sequence data. Note that the terms 130-bp ditag and 34-bp ditag are shorthand terms and do not necessarily describe the exact length of the ditag. The actual length of the 130-bp ditag will vary slightly. The ditag nomenclature (130 bp and 34 bp) is based on nomenclature used in descriptions of the original Long SAGE technique. Glossary The different terms used in this manual are defined below: Tag or Long SAGE Tag: bp sequence from a given cdna containing a 3 proximal Nla III recognition site. Ditag: Two tags joined together end to end. Concatemer: Ditags joined together end to end. Anchoring Enzyme: A restriction endonuclease with a 4-bp recognition site that cleaves most transcripts at least once. Nla III is used as an anchoring enzyme in this kit. Tagging Enzyme: A Type IIS restriction endonuclease that cleaves at a defined distance downstream from the recognition site. Mme I is used as the tagging enzyme in this kit. Adapter: Annealed oligonucleotides (~40 bp) containing a Type IIS restriction site at the 3 end, cohesive overhangs complementary to the Nla III recognition site, and priming sites for PCR amplification. 3

22 Procedural Overview Introduction The experimental steps necessary to perform the I-SAGE Long protocol are outlined below. You will need a minimum of 9 days to complete the entire I-SAGE Long protocol, starting from RNA preparation to screening the clones. Sequencing of selected clones will require additional time. Please refer to the indicated page(s) for more details. We recommend that you read through the entire protocol before beginning. It is important to quickly reach the PCR amplification step (preferably by day 3) to obtain the best results. Day Step Action Page Isolate total RNA or mrna using a method of choice and check the quality of your RNA preparation. 2 Prepare oligo(dt) beads and bind your RNA sample to the beads Synthesize cdna from the mrna bound on the beads Cleave the cdna with an anchoring enzyme, Nla III Divide the cdna into two tubes, and ligate LS Adapters A and B to the cdna Cleave the cdna with a tagging enzyme, Mme I, to release each LS adapter with a short piece of DNA. 7 Ligate the adapter-linked cdna with T4 DNA ligase to form 130-bp ditags Amplify the 130-bp ditags using PCR Perform scale-up PCR ( PCR reactions) of the 130-bp ditag After scale-up, purify the 130-bp PCR product using polyacrylamide gel 26 electrophoresis. 11 Excise the 130-bp ditags from the polyacrylamide gel and purify the DNA 28 using spin columns. 12 Digest the purified 130-bp ditags with Nla III to yield 34-bp ditags Purify the 34-bp ditags on a polyacrylamide gel Ligate the 34-bp ditags to form concatemers Purify the concatemers by polyacrylamide gel electrophoresis Linearize pzero -1 with Sph I Clone gel-purified concatemers into pzero -1 digested with Sph I Transform the ligation reaction into One Shot TOP10 Electrocomp E. coli and select transformants on low salt LB plates containing 50 µg/ml Zeocin Analyze transformants by restriction enzyme digestion or colony PCR Sequence the selected clones using M13 forward sequencing primers Analyze sequences using SAGE2000 Version 4.5 analysis software Continued on next page 4

23 Procedural Overview, Continued Starting Materials You should have the following items on hand before using the I-SAGE Long kit. Microcentrifuge Vortex mixer Agarose gel electrophoresis apparatus and buffers Polyacrylamide vertical gel electrophoresis apparatus for nucleic acid analysis using large format gels (15 17 cm) Thermocycler Platinum Taq DNA Polymerase (see Recommendation below) Aerosol resistant pipette tips 70% ethanol 100% ethanol Phenol/chloroform Electroporator and electroporation cuvettes Water baths or incubators Laminar flow hood at two separate locations (see Recommendation below) Centrifuge suitable for 50-ml tubes RECOMMENDATION Thermostable Polymerase: We strongly recommend using a hot-start Taq DNA polymerase such as Platinum Taq DNA Polymerase to avoid the amplification of spurious bands or primer dimers (~40 bp). Please note that all PCR steps in the I-SAGE Long kit have been optimized using Platinum Taq DNA Polymerase (not included in the kit) and 10X BV Buffer (included). Ordering information for Platinum Taq DNA Polymerase is provided on page 65. Separate PCR Locations to Prevent Cross-Contamination: In addition to the bench area where the SAGE tags are synthesized, we recommend having three separate locations for the PCR process to prevent any cross contamination. Location 1: preferably in a PCR or laminar flow hood where the pre-pcr reagents are assembled and negative controls are set up. Location 2: preferably in a PCR or laminar flow hood where the diluted ditag template is added to the PCR reactions. Location 3: a separate room in which post-pcr products are analyzed and purified. General Molecular Biology Techniques You must be familiar with standard molecular biology techniques to successfully use the I-SAGE Long kit. For protocols and guidance on cdna synthesis, RNA isolation, DNA ligations, E. coli transformations, restriction enzyme analysis, DNA sequencing, polyacrylamide gel electrophoresis, and DNA biochemistry, refer to Molecular Cloning: a Laboratory Manual (Sambrook et al., 1989) or Current Protocols in Molecular Biology (Ausubel et al., 1994). 5

24 Procedure Day 1: Preparing Adapter-Linked cdna Experimental Outline The experimental steps and the time necessary to complete each step on Day 1 are outlined below. We recommend performing all the steps described below in one day to achieve the best results. The total experimental time on Day 1 is ~6 hours, not including the optional verification reaction for cdna synthesis and Nla III digestion. Isolating RNA will require additional time. Step Action Time 1 RNA Isolation varies 2 Checking the RNA Quality 30 min 3 Preparing the Oligo(dT) Beads 2 5 min 4 mrna Binding 20 min 5 First-Strand cdna Synthesis 60 min 6 Second-Strand cdna Synthesis 140 min 7 Nla III Digestion 70 min 8 Optional: Verifying cdna Synthesis and Nla III Digestion (see page 53). 120 min 6

25 Isolating RNA Introduction You will need to isolate high-quality RNA using a method of choice prior to using this kit. You may use cells ( ), total RNA (5 50 µg), or mrna ( ng) as your starting material. Please follow the guidelines provided below to avoid RNase contamination. RECOMMENDATION Aerosol resistant pipette tips are recommended for all procedures. See below for general recommendations for handling RNA. General Handling of RNA When working with RNA: Use disposable, individually wrapped, sterile plasticware. Use only sterile, new pipette tips and microcentrifuge tubes. Wear latex gloves while handling reagents and RNA samples to prevent RNase contamination from the surface of the skin. Always use proper microbiological aseptic technique when working with RNA. You may use RNase Away Reagent, a non-toxic solution available from Invitrogen (Catalog no ) to remove RNase contamination from surfaces. For further information on controlling RNase contamination, see Ausubel, et al., 1990, Unit 4 or Sambrook, et al., 1989, Chapter 7. RNA Isolation The starting material can either be cells, total RNA, or mrna. In general, as little as 5 µg of total RNA or 100 ng of mrna is sufficient to construct I-SAGE Long libraries of 100,000 tags or more. However, we recommend using 10 µg of total RNA, if you have enough of the RNA sample. You may isolate mrna or total RNA using the method of choice prior to using this kit. We recommend isolating mrna using the Micro-FastTrack 2.0 (Catalog no. K ) or FastTrack 2.0 (Catalog no. K ) mrna Isolation kits. To isolate total RNA, we recommend TRIzol Reagent (Catalog no ) or the S.N.A.P. Total RNA Isolation kit (Catalog no. K ). After you have isolated the RNA, check the quality of your RNA preparation (see next page). After preparing the RNA, we recommend that you proceed directly to mrna Binding (see page 10). Important It is very important to use the highest quality of RNA possible to ensure success. Check the integrity and purity of your RNA before starting (see next page). Continued on next page 7

26 Isolating RNA, Continued Check the RNA Quality To check the RNA integrity, analyze 500 ng of your RNA by agarose/ethidium bromide gel electrophoresis. You may use a regular 1% agarose gel (i.e., E-Gels, page 65) or a denaturing agarose gel (Ausubel et al., 1994). For total RNA using a regular agarose gel, you should see the 28S and 18S rrna bands (see figure below). The 28S band should be twice the intensity of the 18S band. The 28S band should run at 4.5 kb and the 18S band should run at 1.9 kb. If you do not load enough RNA, the 28S band may appear to be diffuse. If you are using a denaturing gel, the rrna bands should be very clear and sharp. mrna will appear as a smear from 0.5 to 12 kb. If you do not detect any RNA or the RNA is a lower molecular weight smear, you will need to repeat RNA isolation. Be sure to follow the recommendations listed on the previous page to prevent RNase contamination. Please refer to the Troubleshooting section on page kb ladder 5 µg 10 28S An example of total RNA isolated from peripheral blood mononuclear cells and analyzed on 1% E-Gel is shown in the figure. 18S RECOMMENDATION If you are using the I-SAGE Long kit for the first time, we recommend that you prepare only one Long SAGE library to avoid contamination between libraries. After you are familiar with all the steps in the protocol, you can process more than one library at a time, if desired. 8

27 Binding mrna to Magnetic Beads Introduction After you have isolated your RNA and checked the quality of your RNA preparation, you are ready to bind the RNA to the oligo(dt) magnetic beads. Be sure to follow the recommendations provided below to prevent sample loss due to drying or clumping of the beads. Before Starting Be sure to have the following items on hand before starting: Total RNA (5 50 µg) or mrna ( ng) or cells ( ) 1.5-ml sterile siliconized microcentrifuge tubes (Ambion, Catalog no , see Recommendation below) Magnetic stand (available from Invitrogen; see page 65 to order) Reagents from the cdna Synthesis Module (1A) RECOMMENDATION There are many mixing and washing steps of the magnetic beads throughout this protocol. We highly recommend mixing the beads by flicking with your finger or using a slow speed vortex (use a setting of 5 6). A low speed centrifuge pulse may be required to remove beads stuck in the tube cap. Do not mix by pipetting up and down as this may result in the loss of beads. During all wash steps, add buffer to the tube containing the beads while the tube is still on a magnetic stand to prevent the beads from drying. Close the cap of the tube, remove it from the magnet, and resuspend the beads as described above. Do not allow the beads to dry out, as that will reduce the efficiency of the beads. We recommend using siliconized microcentrifuge tubes to prevent the beads from sticking to the tubes. If you are using non-siliconized microcentrifuge tubes, be sure to gently scrape the sides of the tubes with a pipette tip to remove any beads stuck to the sides of the tube during transfer of the beads to another tube. Do not submerge the magnetic stand in water. To clean the magnetic stand, spray the stand with ethanol and wipe it with a paper towel. Binding Capacity One milliliter of oligo(dt) beads bind approximately 10 µg of polya+ mrna. Preparing Oligo(dT) Beads 1. Thoroughly resuspend the oligo(dt) beads and transfer 100 µl to an RNase-free 1.5-ml siliconized microcentrifuge tube. 2. Place the tube on a magnetic stand for 1 2 minutes and carefully remove the supernatant and discard it. 3. Wash beads by resuspending them in 500 µl of Lysis/Binding buffer as described on the next page (see Washing the Beads). Note: If there is a precipitate in the Lysis/Binding Buffer, warm the buffer to 37 C to dissolve the precipitate. 4. Place the tube on a magnetic stand for 1 2 minutes. 5. Prepare your RNA sample for binding to the beads (see Steps 1 and 2, mrna Binding, next page). 6. Carefully remove the supernatant and immediately add your RNA sample to the beads as described in mrna Binding (see next page). Continued on next page 9

28 Binding mrna to Magnetic Beads, Continued Washing the Beads Please follow the steps below for washing the beads throughout the I-SAGE Long protocol: 1. Place the tube on a magnetic stand for 1 2 minutes. Place the pipette tip at the opposite side of the tube, away from the beads, and slowly slide the pipette tip to the bottom of the tube. Carefully remove the supernatant and discard. Do not disturb or remove any beads. 2. Add the appropriate volume of buffer. 3. Remove the tube from the stand and mix the contents of the tube by gentle vortexing or flicking the tube with a finger. 4. Centrifuge briefly to collect any beads that may stick to the cap of the tube. 5. Return the tube to the magnetic stand for 1 2 minutes and carefully remove the supernatant. 6. Repeat Steps 2 5 until all the washing steps are complete. 7. After the last wash, resuspend the beads in an appropriate buffer. mrna Binding 1. If you are using total RNA (5 50 µg) or mrna ( ng), adjust the volume to 1.0 ml with Lysis/Binding buffer. 2. If you are using cells as your starting material, lyse the cells using a method of choice. Adjust the volume of the cell lysate with 1.0 ml of Lysis/Binding buffer. Be sure to reduce the viscosity of the sample by passing the cell lysate 2 3 times through a sterile 21-gauge needle fitted to a sterile syringe. 3. Load the entire 1.0 ml of RNA sample or cell lysate to oligo(dt) magnetic beads equilibrated with Lysis/Binding Buffer (Step 4, above). 4. Mix the beads and the RNA sample by slowly rocking the tube on a rocking platform or vortexing the tube intermittently on a slow vortex for minutes at room temperature. 5. Place the tube on a magnetic stand for 1 2 minutes and carefully remove the supernatant. 6. Wash the beads twice with 1.0 ml of Wash Buffer A as described above (see Washing the Beads). 7. Wash with 1.0 ml of Wash Buffer B as described above (see Washing the Beads). 8. Wash the beads four times with 100 µl of 1X First Strand Buffer by placing the tube on magnetic stand for 1 2 minutes and removing the supernatant between washes. On the fourth wash, DO NOT remove the supernatant. Proceed to Step Before removing the supernatant after the fourth wash, prepare the first-strand cdna synthesis reaction as described on the next page in Step Remove the supernatant after the fourth wash and proceed immediately to First- Strand cdna Synthesis, next page. We do not recommend storing the beads at this point. 10

29 Synthesizing cdna Introduction Synthesize cdna using mrna bound to the magnetic beads as a template with SuperScript II Reverse Transcriptase (RT). Before Starting You will need the following items on hand before starting: Water baths set at 16 C, 37 C or 42 C, and 75 C Ice Platinum Taq DNA Polymerase Magnetic stand 1.5-ml sterile siliconized microcentrifuge tubes Reagents from the cdna Synthesis Module (1B) and the Performance Check Module Control HeLa Total RNA Control HeLa Total RNA is included in the kit as a positive control for cdna synthesis. We strongly recommend that you perform cdna synthesis with the control RNA, if you are not familiar with cdna synthesis. This will verify that the cdna reactions are working well. First-Strand cdna Synthesis 1. Mix the following reagents for the first-strand synthesis on ice. 5X First Strand Buffer 18.0 µl RNaseOUT 1.0 µl DEPC Water 54.5 µl 0.1 M DTT 9.0 µl dntp Mix (10 mm each) 4.5 µl Total Volume 87.0 µl 2. Resuspend the beads containing the mrna sample (from Step 10, page 10) in the first strand mix (87 µl). 3. Mix gently by flicking the tube with a finger or by slow vortexing. 4. Place the tube at 37 C for 2 minutes to equilibrate the reagents. 5. Add 3 µl SuperScript II Reverse Transcriptase. Mix gently and incubate at C for 1 hour. Mix gently every minutes by flicking the tube with your finger or using a slow vortex. Note: You may perform the cdna synthesis at 42 C if your RNA is known to contain more secondary structure and to prevent oligo(dt) mispriming at internal sites. 6. Meanwhile, equilibrate another water bath to 16 C for second strand synthesis. 7. Chill the first strand reaction on ice for 2 minutes and proceed to Second-Strand cdna Synthesis, next page. Important It is difficult to inactivate and wash out E. coli DNA Polymerase, especially when there is some clumping of the beads. The exonuclease activity of this enzyme may interfere with subsequent reactions by digesting single stranded overhangs used for subsequent cohesive ligations. This may result in incomplete Nla III digestion after the scale-up PCR step. We recommend inactivating the enzyme immediately after the cdna synthesis and Nla III digestion by adding Wash Buffer C and heating. Continued on next page 11

30 Synthesizing cdna, Continued Second-Strand cdna Synthesis 1. Add the following second-strand reagents in order to the tube containing 90 µl of the first-strand reaction (Step 7, page 11). DEPC Water 465 µl 5X Second Strand Buffer 150 µl dntp Mix (10 mm each) 15 µl E. coli DNA Ligase 5 µl E. coli DNA Polymerase 20 µl E. coli RNase H 5 µl 2. Mix the contents by vortexing and centrifuge the tube briefly in a microcentrifuge. 3. Incubate the reaction mixture at 16 C for 2 hours, mixing gently every minutes to resuspend the beads. During incubation, preheat Wash Buffer C to 75 C. 4. Place the reaction tube on ice and add 45 µl 0.5 M EDTA to stop the reaction. 5. Place the tube on a magnetic stand for 1 2 minutes and carefully remove the supernatant. Add 750 µl of warm Wash Buffer C to inactivate the E. coli DNA polymerase (see Important note, previous page). 6. Mix well and heat the sample to 75 C for minutes with intermittent mixing to completely inactivate the polymerase. Place the tube on a magnetic stand for 1 2 minutes. Remove the supernatant and wash again with 750 µl of Wash Buffer C. Perform the wash steps quickly to prevent precipitation of SDS, which may trap the beads. 7. Wash sample three times with 750 µl of Wash Buffer D, and then resuspend the beads in 750 µl of Wash Buffer D. If bead clumping occurs, you can perform an additional wash. Refer to Troubleshooting on page 49 for more tips on preventing bead clumping. Optional: Remove 5 µl of the resuspended beads for use in a PCR procedure to determine the efficiency of the cdna synthesis reaction. This optional procedure takes approximately 2 hours and may be performed at the end of Day 1 or at any time on Day 2 or 3. Store the 5-µl sample at 4 C until you are ready to perform the procedure. See Verifying cdna Synthesis and Nla III Digestion on page Place sample tube on a magnetic stand for 1 2 minutes and carefully remove the supernatant. 9. Add 200 µl of 1X Buffer 4 to the tube and gently resuspend the beads. Transfer the contents of the tube to a new microcentrifuge tube to avoid any traces of exonuclease activity from E. coli DNA polymerase (see Important note, previous page). If the beads are sticking to the sides of the tube, gently scrape off the beads from the tube using a pipette tip. Wash the old tube once with 200 µl of the same buffer and transfer the contents to the new tube containing the reaction mix. 10. Place the tube on a magnetic stand for 1 2 minutes. 11. Remove the supernatant and discard it. Wash the tube once with 200 µl of 1X Buffer Remove the supernatant and proceed to Nla III Digestion (next page). Note: If you do not have enough time to complete the next step, store the beads in 1X Buffer 4 at 4 C overnight. The next day, proceed to Nla III Digestion. 12

31 Digesting the cdna with Nla III Introduction Once the cdna synthesis is complete and you have checked the integrity of your cdna, you are ready to cleave the cdna with an anchoring enzyme, Nla III. Before Starting You will need the following items before starting: Water bath set at 37 C Magnetic stand 1.5-ml sterile siliconized microcentrifuge tubes Reagents from the Cleavage Module and Nla III Module Nla III is extremely sensitive to high temperatures. Do not keep the enzyme at room temperature or +4 C for long periods. Use immediately upon removal from -80 C and return the enzyme to -80 C as soon as possible. Nla III Digestion 1. Resuspend the beads from Step 12, page 12, in the following mix: LoTE 172 µl 100X BSA 2 µl 10X Buffer 4 20 µl Nla III 6 µl Total Volume 200 µl 2. Incubate at 37 C for 1 hour. Mix occasionally by flicking the tube with a finger or slow vortexing. 3. Place the bottle containing Wash Buffer C in a water bath set at 37 C to prevent precipitation of SDS. 4. After the reaction is complete, place the tube containing the beads on a magnetic stand for 1 2 minutes and carefully discard the supernatant. Inactivate Nla III by washing the tube twice with 750 µl of warm Wash Buffer C. 5. Wash sample three times with 750 µl of Wash Buffer D, and then resuspend the beads in 750 µl of Wash Buffer D. If bead clumping occurs, you can increase the number of washes to 5 or 6. Refer to Troubleshooting on page 49 for more tips on preventing bead clumping. Optional: Remove 5 µl of the resuspended beads for use in a PCR procedure to determine the efficiency of the Nla III digestion. This optional procedure takes approximately 2 hours and may be performed at the end of Day 1 or at any time on Day 2 or 3. Store the 5-µl sample at 4 C until you are ready to perform the procedure. See Verifying cdna Synthesis and Nla III Digestion on page Store sample at 4 C overnight. The next day, proceed to Ligating LS Adapters to the cdna (page 15). 13

32 Day 2: Preparing Ditags Experimental Outline The experimental steps and the time necessary to complete each step on Day 2 are outlined below. The total experimental time on Day 2 is 7 8 hours. Step Action Time 1 Ligating LS adapters to the cdna 2.5 hours 2 Mme I Digestion 2.5 hours 3 Ethanol Precipitation 80 min 4 Ligating the Tags to Create Ditags overnight 5 Optional: Verifying LS Adapter Ligation (see page 55). 120 min 14

33 Ligating LS Adapters to the cdna Introduction After digesting the cdna with Nla III, ligate one cdna pool to LS Adapter A and the other to LS Adapter B, each containing the recognition site for a Type IIS restriction enzyme, Mme I. Cleavage of the ligation products with Mme I releases the LS adapters with a short piece of the cdna (tag) from the beads. LS Adapters A and B The LS adapters contain a Type IIS restriction endonuclease (Mme I) site at the 3 end, cohesive overhangs complementary to the Nla III recognition site, and priming sites for PCR amplification. The 3 end of the adapters is modified with an amino group to prevent self-ligation. Note that two adapters are used to prevent snap-back of templates when the ditags are amplified. Before Starting You will need the following items on hand before starting: Water baths set at 50 C, 37 C, and 16 C Ice Magnetic stand 1.5-ml sterile siliconized microcentrifuge tubes Reagents from the Cleavage Module The optimal amount of LS adapters used in the ligation reaction (see below) is dependent on the amount of cdna present on the beads. A certain amount of adapter is necessary to drive the ligation; however, an excess can result in an increase of a nonspecific band (100 bp) following PCR amplification. The adapter concentration suggested below is optimized for samples between to cells, 5 50 µg of total RNA, or ng of mrna. If your sample is not within this range or you get a high amount of non-specific band, you may need to adjust the adapter concentration. See Troubleshooting on page 49. Continued on next page 15

34 Ligating LS Adapters to the cdna, Continued Ligating LS Adapters to the cdna 1. Place sample tube from Step 6, page 13, on a magnetic stand for 1 2 minutes and carefully remove the supernatant. 2. Wash the beads twice with 150 µl of 1X Ligase Buffer. Immediately after the final wash, resuspend the beads in 100 µl of 1X Ligase Buffer and divide the sample equally into two new tubes, labeled A and B. Be careful to divide the beads while they are resuspended, as the beads may stick to the original tube or pipette tips. 3. Wash each tube (A and B) once with 50 µl of 1X Ligase Buffer. Resuspend the beads in each tube in 1X Ligase Buffer. 4. Place tubes A and B on a magnetic stand for 1 2 minutes and carefully remove the supernatant. 5. Transfer to the tubes to ice and add the following reagents to the beads on ice: Reagent Tube A Tube B LS Adapter A (40 ng/µl) 1.5 µl LS Adapter B (40 ng/µl) 1.5 µl LoTE 14.0 µl 14.0 µl 10X Ligase Buffer 2.0 µl 2.0 µl Total Volume 17.5 µl 17.5 µl 6. Resuspend the beads by flicking each tube with a finger. Heat the tubes in a water bath for at least 2 minutes at 50 C. 7. Cool the tubes at room temperature for 15 minutes and then chill on ice. 8. Add 2.5 µl of T4 DNA ligase to each tube and mix well. 9. Incubate for 2 hours at 16 C. Mix each tube every 15 minutes by flicking with a finger. 10. Wash each tube three times with 500 µl of Wash Buffer D, and then resuspend the beads in 500 µl of Wash Buffer D. Optional: Remove 5 µl of the resuspended beads from each tube for use in a PCR procedure to determine the efficiency of the adapter ligation. This optional procedure takes approximately 2 hours and may be performed at any time on Day 2 or 3. Store the 5-µl samples at 4 C until ready for use. See Verifying LS Adapter Ligation on page 55. Proceed directly to Cleaving with Tagging Enzyme, page

35 Cleaving with Tagging Enzyme Introduction Cleavage of the ligation products with the tagging enzyme Mme I results in release of the adapter with a short tag of the cdna from the beads. Before Starting You will need the following items on hand before starting: Water bath set at 37 C 1.5-ml sterile microcentrifuge tubes Dry ice 70% and 100% ethanol Reagents from the Cleavage Module 10X SAM (400 µm, prepared from 32-mM SAM; see below) 1X Buffer 4/1X SAM (prepared from 32-mM SAM and 1X Buffer 4; see below) Preparing 10X SAM Prepare a fresh dilution of 10X SAM (400 µm) from the kit-supplied 32-mM SAM for use in the Mme I digestion. You will need 20 µl of 10X SAM per library; the following dilution prepares 80 µl to enable easy pipetting. Discard excess dilution if you will not use it immediately. The 10X SAM should be prepared fresh shortly before use to ensure stability. Component Amount 32-mM SAM 1 µl DEPC water to 80 µl Preparing 1X Buffer 4/1X SAM Prepare a 1X Buffer 4/1X SAM solution from the kit-supplied 32-mM SAM and 1X Buffer 4 for use in the Mme I digestion. You will need 800 µl of this solution per library. The solution should be prepared fresh shortly before use to ensure stability. Component Amount 32-mM SAM 1 µl 1X Buffer 4 to 800 µl Mme I Digestion 1. Place each tube from Step 10, previous page, on a magnetic stand for 1 2 minutes and remove the supernatant. 2. Wash each tube twice with 200 µl of 1X Buffer 4/1X SAM (see preparation instructions above). Carefully remove and discard the supernatant, and place the tubes on ice. 3. Add the following reagents to each tube: LoTE 70 µl 10X Buffer 4 10 µl 10X SAM (400 µm) (prepare as above) 10 µl Mme I 10 µl Total Volume 100 µl 4. Incubate tubes at 37 C for 2.5 hours with occasional gentle mixing. 5. Place tubes on a magnetic stand for 1 2 minutes. Do not discard the supernatant! Carefully remove the supernatant from each tube and transfer supernatant to a new microcentrifuge tube. The tags are present in the supernatant after Mme I digestion. Proceed directly to Creating Ditags, next page. 17

36 Creating Ditags Introduction After Mme I digestion, the tags are ligated to form 130-bp ditags. Before Starting You will need the following reagents and equipment on hand before starting: Water bath set at 16 C and 37 C 1.5-ml sterile microcentrifuge tubes Dry ice 70% and 100% ethanol Phenol/chloroform (see page 65 for ordering information) Reagents from the Ditag Formation Module Ethanol Precipitation 1. Pool the tags by transferring 100 µl from Tube A to Tube B (200 µl total). 2. Wash Tube A with 100 µl of LoTE and transfer it to Tube B to yield a total of 300 µl total. 3. Add 300 µl of Phenol/Chloroform to Tube B and vortex thoroughly. Centrifuge for 5 minutes at maximum speed in a microcentrifuge at room temperature. 4. Transfer 300 µl of the aqueous (top) phase to a new microcentrifuge tube, and mix thoroughly. 5. Remove 200 µl of the aqueous (top) phase from the previous step into another tube and set aside. This is your sample. 6. Add 100 µl of DEPC water to the remaining 100 µl to yield a final volume of 200 µl. This will be used as a negative control (no ligase). Note: If you are constructing two I-SAGE Long libraries, you may pool the two negative controls from each library to yield a final volume of 200 µl. 7. To each tube (200 µl of sample and 200 µl of negative control), add 133 µl of 7.5 M ammonium acetate, 3 µl of mussel glycogen, and 1 ml of 100% ethanol. Mix vigorously. 8. Place the tubes on dry ice for minutes and then centrifuge at maximum speed in a microcentrifuge for minutes at 4 C. 9. Carefully remove the supernatant from each tube and discard it. Be careful not to disturb the pellet. 10. Wash each pellet twice with 1 ml of cold 70% ethanol. 11. After the final wash, centrifuge each tube again to collect any residual ethanol. 12. Carefully remove the ethanol by pipet and air-dry the pellet for 5 10 minutes. 13. Resuspend the sample pellet in 4 µl of LoTE and the negative control pellet in 2 µl of LoTE and incubate at 37 C for minutes to aid in solubilization. Proceed directly to Ligating the Tags to Create Ditags, next page. Continued on next page 18

37 Creating Ditags, Continued Ligating the Tags to Create Ditags 1. Prepare the following on ice in two sterile microcentrifuge tubes: 2X Ditag Reaction 2X Negative Control 3 mm Tris-HCl, ph µl 2.25 µl 10X Ligase Buffer 0.9 µl 0.75 µl DEPC Water 0.9 µl 0.75 µl T4 DNA Ligase 1.2 µl 2. Add 4 µl of 2X Ditag Reaction Mix to the tags resuspended in 4 µl LoTE from Step 13, previous page. Add 2 µl of 2X Negative Control Mix to the negative control (no ligase) from Step 13, previous page. 3. Incubate the tubes overnight at 16 C. The next day, proceed to Optimizing PCR Conditions (page 21). 19

38 Days 3 4: Amplifying Ditags Experimental Outline The experimental steps and the time necessary to complete each step on Days 3 and 4 are outlined below. Day Step Action Time 3 1 Optimizing the Ditag PCR ~2 3 hours 2 Analyzing the PCR Product 60 min 3 Performing Scale-up PCR ( 200 reactions) ~3 4 hours 4 4 If you need to set up more than 200 PCR reactions, you may need to perform the remaining PCR reactions on Day 4. 20

39 Optimizing PCR Conditions Introduction In this step, you will determine the optimal dilution of ligated product (template) to use for the ditag scale-up PCR. LS Control Template A control template is included in the kit as a positive control to help you determine the quality and quantity of your 130-bp ditag (see below). The LS Control Template is produced by TOPO cloning 130-bp ditags into a pcr 4-TOPO vector and transforming the TOPO reaction into One Shot TOP10 Electrocomp E. coli. Appropriate clones were used for preparing plasmid DNA. The plasmid DNA is provided as an LS Control Template at 10 pg/µl. Instructions for using the LS Control Template are provided on the next page. Ditag Yield You can determine the yield of the ditag by comparing the ditag intensity to the intensity of the LS Control Template after gel electrophoresis. The 130-bp ditag yield should be between ng per 50-µl PCR volume after 27 cycles. You can also use the Low DNA Mass Ladder (Catalog no ) to determine the ditag yield. You will need µg of the ditag for further processing. Perform scale-up PCR to obtain the desired yield (see page 24). Before Starting You will need the following reagents on hand before starting: Platinum Taq DNA Polymerase (see page 5) PCR tubes of appropriate size Mineral oil Ice 96-well plates for scale-up PCR (PE Applied Biosystems, Catalog no. N ) 10 20% polyacrylamide gels or 4% agarose gels DNA molecular weight markers Reagents from the Ditag PCR Module Set up the PCRs on ice. Please review the information provided on page 5 for thermostable polymerase. Always set up the negative control reactions (no template and no ligase) first, and then overlay with µl of mineral oil before adding the template to prevent any accidental contamination from the template. You will need three separate locations (Locations 1, 2, and 3) for the PCR process to prevent any cross contamination (see page 5). If you decide to perform all the optional PCRs for verifying the various enzymatic reactions on Day 3, set up the PCRs using instructions provided on page 53 for Verifying cdna Synthesis and Nla III Digestion, and page 55 for Verifying LS Adapter Ligation. Continued on next page 21

40 Optimizing PCR Conditions, Continued Optimizing the Ditag PCR 1. After the overnight incubation from Step 3, page 19, add 6 µl LoTE to the template (ligated product) reaction and 10 µl LoTE to the negative control (no ligase) reaction. 2. To avoid cross-contamination, transfer the negative control to Location 1 and the template to the PCR or laminar flow hood in Location 2 (see page 5). 3. Dilute the following with sterile water: Negative control (no ligase) to 1/20 at Location 1. Template (ligated product) to 1/20, 1/40, and 1/80 at Location 2. LS Control Template (supplied at 10 pg/µl) to 1/10 4. Set up on ice the following 50-µl PCRs using six sterile PCR tubes in Location 1: Tubes 1 3: Different dilutions of the template Tube 4: LS Control Template (diluted to 1 pg/µl) Tube 5: Negative control (no template) Tube 6: Negative control (no ligase) Be sure to add the template at Location 2 Reagent X BV Buffer 5 µl 5 µl 5 µl 5 µl 5 µl 5µl DMSO 3 µl 3 µl 3 µl 3 µl 3 µl 3 µl dntp Mix (10 mm each) 7.5 µl 7.5 µl 7.5 µl 7.5 µl 7.5 µl 7.5 µl LS DTP-1 2 µl 2 µl 2 µl 2 µl 2 µl 2 µl LS DTP-2 2 µl 2 µl 2 µl 2 µl 2 µl 2 µl DEPC Water 29 µl 29 µl 29 µl 29 µl 30 µl 29 µl Platinum Taq DNA Polymerase 5. Mix briefly and amplify using the following cycling parameters: Temperature Time Cycles 95 C 2 minutes 1 95 C 30 seconds 55 C 1 minute C 1 minute 70 C 5 minutes µl 0.5 µl 0.5 µl 0.5 µl 0.5 µl 0.5 µl 1/20 Diluted Template 1 µl /40 Diluted Template -- 1 µl /80 Diluted Template µl LS Control Template µl /20 Diluted Negative Control µl Continued on next page 22

41 Optimizing PCR Conditions, Continued Analyze the PCR Product After PCR, load 10% of the sample on a 10 20% polyacrylamide or 4% agarose gel to analyze the PCR products at Location 3. In general, you should see a strong, clear 130-bp ditag band and a faint 100-bp band (contains only adapter sequences without any transcript sequence) at a 1:40 template dilution (see figure below). Use the guidelines below to evaluate your PCR results. If you obtain the expected results and all negative controls show no bands, proceed to Scale-up PCR, next page. If the amount or quality of the PCR product is not satisfactory (see figure below), you may need to optimize the number of cycles (25 35 cycles). In general, we have found that 27 cycles give the best results using the cycling and reaction conditions described on the previous page, but this may vary depending on your brand of thermocycler. If you see higher molecular weight bands, reduce the amount of template or reduce the number of PCR cycles. Evaluate the presence of any contamination using the negative control reactions as follows: Presence of a 130-bp band in the no template control (lane 1) and in the no ligase control (lane 2) indicates contamination of reagents during the PCR set-up. You need to repeat the PCR reactions as described on the previous page using fresh reagents for PCR. Presence of a 130-bp band in the no ligase control (lane 2) and absence of a band in the no template control (lane 1) indicates contamination of the template. You need to discard the ditag library and restart the I-SAGE Long protocol using fresh RNA sample. Determine the yield of the 130-bp ditag by comparing the intensity of the ditag at a particular dilution to that of the LS Control Template: If the yield of the 130-bp ditag is reasonably close to that of the LS Control Template, perform at least PCR reactions for the scale-up. If the yield of the 130-bp ditag is significantly less than that of the LS Control Template, perform at least PCR reactions. Lane: bp 100 bp Gel Legend The samples were amplified as described on the previous page. Lane 1: Negative control, no template Lane 2: Negative control, no ligase Lanes 3 and 7: 100-bp ladder Lanes 4 6: 1/20, 1/40 and 1/80 dilution of the template, respectively Lane 8: LS Control Template, 1pg/ul 23

42 Scale-Up PCR Introduction In this step, you perform a scale-up PCR using the conditions determined in the previous section to generate a sufficient amount of ditags for forming concatemers. Enough reagents are supplied in the Ditag PCR Module to perform 200 scale-up PCR reactions for each of five I-SAGE libraries (1,000 PCR reactions). If you need to perform additional PCRs, the Ditag PCR Module is also available as a separate kit from Invitrogen. Ordering information is provided on page 65. Performing Scale-up PCR Depending on the number of PCR reactions you need to perform, you may complete the scale-up PCR step in one ( reactions) or two ( reactions) days. 1. Prepare a PCR cocktail by combining the following components in order. Examples are provided below for one reaction and 100 reactions. Calculate the volume of reagents you will need based on the number of PCRs you will be performing. Component 1 Rxn 100 Rxns 10X BV Buffer 5.0 µl 500 µl DMSO 3.0 µl 300 µl dntp Mix (10 mm each) 7.5 µl 750 µl LS DTP µl 200 µl LS DTP µl 200 µl Platinum Taq DNA Polymerase 0.5 µl 50 µl DEPC Water to 44.0 µl to 4400 µl 2. Add 44 µl of the cocktail mixture to each well of a 96-well PCR plate at Location 1 (see page 5). Add 6 µl of sterile water to each negative control well and cover all negative control wells with 30 µl of mineral oil to prevent any accidental contamination with the template. 3. Select a dilution based on Analysis of the PCR Product, previous page. Note that you will be using 6 µl of diluted template in the scale-up PCR. For example, if you observed a strong 130-bp product with 1 µl of a 1:40 template dilution, dilute the template 1:240 and use 6 µl of this diluted template in the scale-up PCR. 4. At Location 2, add 6 µl of the appropriately diluted template to each well containing the PCR cocktail using a repeater pipette with aerosol resistant tips. 5. Use the thermocycling parameters and post-pcr analysis as described in Optimizing the Ditag PCR (page 22) and Analysis of the PCR Product (previous page). After analysis of the PCR product, proceed to Gel-Purifying the 130-bp Ditag, page

43 Day 5: Isolating the 130-bp Ditag Experimental Outline The experimental steps and the time necessary to complete each step on Day 5 are outlined below. The total experimental time on Day 5 is approximately 9 hours. Step Action Time 1 Pooling the Ditags and Gel Electrophoresis ~5 7 hours 2 Eluting DNA from the Gel 150 min 3 Ethanol Precipitation 60 min 25

44 Gel-Purifying the 130-bp Ditag Introduction This section describes the purification of the 130-bp ditag produced after scale-up PCR. The PCR reaction is electrophoresed on a 12% polyacrylamide gel to separate the 130-bp ditag from a 100-bp contaminant. The 130-bp ditags are excised, eluted from the gel, and purified using spin columns. Before Starting You will need the following items on hand before starting: 50-ml sterile conical tubes 50-ml Oak Ridge centrifuge tubes 0.5-ml and 1.5-ml sterile microcentrifuge tubes 18-gauge needle Dry ice Phenol/chloroform (see page 65 for ordering information) 70% and 100% ethanol 12% polyacrylamide gel (see page 61 for recipe), with comb for 100 µl wells. TBE running buffer and 5X TBE sample buffer (see page 62) DNA molecular weight markers New razor blades µg/ml ethidium bromide solution for staining Water bath set at 65 C Reagents from the Concatemer Module RECOMMENDATION We recommend using large format gels (15 17 cm) for vertical gel electrophoresis and to completely electrophorese the gel to achieve good separation of the 130-bp and 100-bp bands. Use combs that produce 100-µl wells. Do not use mini-gels. Continued on next page 26

45 Gel-Purifying the 130-bp Ditag, Continued Pooling the Ditags and Gel Electrophoresis 1. Pool the PCR product from each well of the 96-well PCR plate (from Step 4, page 24) into one or more 50-ml sterile conical tubes. Note that each tube should contain no more than 12.5 ml of ditag product. 2. Add an equal volume of phenol/chloroform to the tube. Centrifuge at 2,400 g for 10 minutes at room temperature and transfer the aqueous (top) phase to a separate 50-ml Oak Ridge centrifuge tube. The top phase contains the ditags. 3. For ~12.5 ml of sample, add 3.2 ml of 7.5 M ammonium acetate, 48 µl of mussel glycogen, and 34 ml of 100% ethanol to the centrifuge tube. For smaller sample volumes, decrease amounts proportionally. Mix vigorously. 4. Place the tube on dry ice for minutes and centrifuge at 12,000 g for 30 minutes at +4 C. 5. Carefully remove and discard the supernatant. Wash the pellet 2 3 times with 25 ml of cold 70% ethanol. 6. Carefully remove the ethanol and air-dry the pellet for minutes. 7. Resuspend the pellet in 300 µl LoTE and incubate at 37 C for 5 10 minutes to aid in solubilization. 8. Add 72 µl of 5X TBE Sample Buffer and load ~40 µl per well on a 12% polyacrylamide gel, 1.5-mm thick (see page 61 for recipe). We recommend loading the entire ditag sample on one gel. Using a 100-µl well, you can load PCR reactions per well. 9. Electrophorese until the bromophenol blue dye front runs out of the gel and the xylene cyanol dye front reaches 1 2 cm from the bottom. Please refer to the manufacturer s instructions for electrophoresis conditions for your apparatus. 10. After electrophoresis, stain the gel in µg/ml ethidium bromide and visualize the bands under UV light. You should see a strong 130-bp band and a faint 100-bp band (see below). 100-bp Ladder 130 bp 100 bp Continued on next page 27

46 Gel-Purifying the 130-bp Ditag, Continued Eluting DNA from the Gel 1. Make a hole through the bottom of a 0.5-ml sterile microcentrifuge tube using an 18-gauge needle. You will need 2 tubes per lane. Caution: Use caution when piercing the tubes with a needle. 2. Using a new razor blade, excise the 130-bp product from each lane of the gel from Step 10, previous page. Cut each gel band into 2 pieces and place each piece into one 0.5-ml microcentrifuge tube prepared as above. 3. Place each 0.5-ml microcentrifuge tube in a sterile 1.5-ml microcentrifuge tube and centrifuge at maximum speed in a microcentrifuge for 2 3 minutes (be careful not to rip off the lids of the tubes). The excised bands will be broken into small pieces and collected in the 1.5-ml microcentrifuge tube. 4. Discard the 0.5-ml microcentrifuge tubes. 5. Prepare 150 µl of LoTE/7.5 M ammonium acetate (125:25) mix and add this mix to the 1.5-ml microcentrifuge tube containing the gel pieces. Make sure that all gel pieces are covered with the buffer. Mix well by vortexing. 6. Incubate at 65 C for 2 hours to elute the DNA from the gel. You may incubate at +4 C overnight followed by 65 C for 15 minutes if there is not enough time to complete the elution. 7. Combine the contents of up to three tubes into a single S.N.A.P column fitted to a collection tube. (Note: S.N.A.P columns can hold up to 500 µl. Combining three tubes into one column is recommended to ensure that you have enough columns for all reactions.) Centrifuge at maximum speed in a microcentrifuge for 2 minutes. 8. Combine all the eluates. Aliquot ~300 µl volumes into new 1.5-ml microcentrifuge tubes. Proceed directly to Ethanol Precipitation, below. Ethanol Precipitation 1. To each 300 µl of eluate from Step 8, above, add 133 µl of 7.5 M ammonium acetate, 3 µl of mussel glycogen, and 1000 µl of 100% ethanol. Mix well and incubate the tube on dry ice for minutes. 2. Centrifuge at maximum speed in a microcentrifuge at 4 C for 30 minutes. 3. Carefully remove and discard the supernatant. Wash the pellet twice with 500 µl of cold 70% ethanol. 4. Carefully remove the ethanol and air-dry the pellet for 15 minutes. 5. Resuspend each pellet in 14 µl LoTE. 6. Combine all samples (~126 µl) and store at -20 C overnight. Proceed to Digesting the 130-bp Ditag with Nla III, page

47 Day 6: Isolating the 34-bp Ditags Experimental Outline The experimental steps and the time necessary to complete each step on Day 6 are outlined below. The total experimental time on Day 6 is approximately 9 hours. Step Action Time 1 Nla III Digestion 60 min 2 Ethanol Precipitation 60 min 3 Gel Electrophoresis ~ 4 hours 4 Eluting DNA from the Gel 120 min 5 Ethanol Precipitation 60 min 29

48 Digesting the 130-bp Ditag with Nla III Introduction Digesting the 130-bp ditag with Nla III produces a 34-bp ditag. It is important to achieve > 80% digestion efficiency with Nla III to obtain a good yield of 34-bp ditags. Before Starting You will need the following reagents and equipment on hand before starting: Dry ice 70% and 100% ethanol Phenol/chloroform (see page 65 for ordering information) Water bath set at 37 C 1.5-ml sterile microcentrifuge tubes Reagents from the Nla III Module and the Concatemer Module Nla III Digestion 1. Divide the 126 µl of product from Step 6, page 28, equally into three sterile microcentrifuge tubes. Prepare each tube as follows: 130-bp Ditag 42 µl 10X Buffer 4 15 µl 100X BSA 2 µl Nla III 12 µl DEPC Water 79 µl Total Volume 150 µl 2. Mix the contents well and incubate at 37 C for 1 2 hours. 3. Adjust the volume in each tube to 200 µl with LoTE. 4. Analyze 5 µl of the reaction by agarose gel electrophoresis to check the efficiency of Nla III digestion. You should obtain >80% of the 130-bp ditags cleaved to yield 34-bp ditags (see figure on the next page). If you observe more 130-bp ditags, you may perform an overnight digestion with Nla III after ethanol precipitating the Nla III reaction. 5. If the Nla III digestion is efficient, proceed to Ethanol Precipitation, below. Ethanol Precipitation 1. Add an equal volume of phenol/chloroform to each tube and centrifuge at maximum speed in a microcentrifuge for 5 minutes at room temperature. 2. Transfer the aqueous (top) phase (200 µl) to a new tube and add 90 µl of 7.5 M ammonium acetate, 3 µl of mussel glycogen, and 850 µl of 100% ethanol. Mix well. 3. Place the tube on dry ice for minutes and centrifuge at maximum speed in a microcentrifuge for 30 minutes at +4 C. 4. Wash the pellet twice with 1.0 ml of cold 70% ethanol and air-dry the pellet for 5 10 minutes. 5. Combine the pellets and resuspend in a total volume of 32 µl using LoTE. Make sure the pellets are completely dissolved and then proceed to Gel-Purifying the 34-bp Ditag, next page. 30

49 Gel-Purifying the 34-bp Ditag Introduction The 34-bp ditag is purified using polyacrylamide gel electrophoresis. Before Starting You will need the following reagents and equipment on hand before starting: Water bath set or incubator at 37 C 12% polyacrylamide gel (see page 61 for recipe) DNA molecular weight markers 0.5-ml and 1.5-ml sterile microcentrifuge tubes 18-gauge needle New razor blades TBE running buffer and 5X TBE sample buffer (see page 62) Dry ice Ice 70% and 100% ethanol µg/ml of ethidium bromide solution for staining Reagents from the Concatemer Module Gel Electrophoresis 1. Add 7.8 µl of 5X TBE Sample Buffer to the sample from Ethanol Precipitation, Step 5, previous page. Load 13 µl of sample per lane on a 12% polyacrylamide gel. 2. Electrophorese until the bromophenol blue dye front reaches 2 3 cm from the bottom. Please refer to the manufacturer s instructions for electrophoresis conditions for your apparatus. 3. After electrophoresis is complete, stain the gel with µg/ml ethidium bromide. Visualize the bands under UV light. 4. You should observe a 34-bp band, a 40-bp band (LS adapters), and bp bands (resulting from incomplete Nla III digestion). See the figure below for an example of 34-bp ditag gel electrophoresis. 100 bp 60 bp 40 bp 34 bp Continued on next page 31

50 Gel-Purifying the 34-bp Ditag, Continued Eluting DNA from the Gel 1. Make a hole in the bottom of a 0.5-ml sterile microcentrifuge tube using an 18-gauge needle. You will need 2 tubes per well of the gel. Use caution when piercing the tubes with a needle. 2. Using a new razor blade, excise the 34-bp product from one lane of the gel. Cut the gel band into 2 pieces and place each piece into one 0.5-ml microcentrifuge tube prepared as above. Repeat these steps until all the bands from the remaining lanes are excised. 3. Place the 0.5-ml microcentrifuge tube in a sterile 1.5-ml microcentrifuge tube and centrifuge at maximum speed in a microcentrifuge for 2 3 minutes (be careful not to rip the lids off of the tubes). The excised bands will be broken into small pieces and collected in the 1.5-ml microcentrifuge tube. 4. Discard the 0.5-ml microcentrifuge tubes. 5. Prepare 150 µl of a LoTE/7.5 M ammonium acetate (125:25) mix. Add this mix to the 1.5-ml microcentrifuge tube containing the gel pieces. Make sure that all gel pieces are covered with the buffer. Mix well by vortexing. 6. Incubate at 37 C for 2 hours to elute the DNA from the gel. You may incubate at +4 C overnight if there is not enough time to complete the elution. 7. Combine the contents of up to three tubes into a single S.N.A.P column fitted to a collection tube. (Note: S.N.A.P columns can hold up to 500 µl. Combining three tubes into one column is recommended to ensure that you have enough columns for all reactions.) Centrifuge at maximum speed in a microcentrifuge for 2 minutes. 8. Combine all the eluates. You should have about ~900 µl of eluate depending on the gel size. Aliquot ~200 µl volumes into new tubes and proceed to Ethanol Precipitation, below. Ethanol Precipitation 1. To each 200 µl of sample, add the following reagents: 7.5 M Ammonium Acetate 90 µl Mussel Glycogen 3 µl 100% Ethanol 850 µl Note: You can now store the gel-purified 34-bp ditag at -20 C overnight, if you do not have enough time to complete the remaining steps. The next day, proceed with ethanol precipitation as described below. 2. Mix well and place each tube on dry ice for minutes. 3. Centrifuge tubes at maximum speed in a microcentrifuge for 30 minutes at +4 C. 4. Carefully remove and discard the supernatant. Wash each pellet twice with 1 ml of cold 70% ethanol. 5. Air-dry each pellet for 5 10 minutes on ice. 6. Pool and resuspend the pellets in a total volume of 7.75 µl LoTE plus 1 µl of 10X ligase buffer on ice. Proceed immediately to Ligation Reaction (see page 34). 32

51 Day 7: Forming Concatemers and Cloning Experimental Outline The experimental steps and the time necessary to complete each step on Day 7 are outlined below. The total experimental time on Day 7 is approximately 9 10 hours. Step Action Time 1 Ligation Reaction ~1 2 hours 2 Gel Electrophoresis ~2 3 hours 3 DNA Elution 140 min 4 Ethanol Precipitation 60 min 5 Linearizing pzero -1 with Sph I (this step can be performed while you are electrophoresing the concatemers) ~1 2 hours 6 Ligating into pzero min 7 Transformation Reaction ~2 hours 33

52 Ligating the 34-bp Ditag to Yield Concatemers Introduction After you have gel-purified the 34-bp ditags, you are ready to ligate them to form concatemers. The concatemer bands of various sizes are separated on a polyacrylamide gel. The high molecular weight bands are excised and purified from the gel. Before Starting You will need the following items on hand before starting: Water baths or incubaters set at 16 C and 65 C 2% agarose gel (UltraPure Agarose, Cat. no ) or 8% polyacrylamide gel (recipe on page 61) 0.5-ml and 1.5-ml sterile microcentrifuge tube 18-gauge needle TBE running buffer and 5X TBE sample buffer (see page 62) µg/ml ethidium bromide solution for staining New razor blades Dry ice Phenol/chloroform (see page 65 for ordering information) 70% and 100% ethanol Reagents from the Concatemer Module Ligation Reaction 1. Set up a ligation reaction on ice using the gel-purified 34-bp DNA from Ethanol Precipitation, Step 6, page 32: 34-bp DNA 8.75 µl T4 DNA Ligase 1.25 µl Total Volume 10 µl 2. Incubate for 1 3 hours at 16 C depending on the yield of the 34-bp ditag. Note: If the intensity of your 34-bp band is similar to the intensity of the 34-bp band shown in the figure on page 31, you can perform the ligation for 1 hour. Increase the incubation time of the ligation to 3 hours if the intensity of your 34-bp band is lower. 3. After ligation is complete, add 2.4 µl of 5X TBE Sample Buffer to the ligation mix and heat at 65 C for 10 minutes. Proceed to Gel Electrophoresis, below. Gel Electrophoresis 1. Briefly centrifuge the ligation mix at maximum speed in a microcentrifuge and load all the sample into one well of a 2% agarose gel or an 8% polyacrylamide gel. 2. Electrophorese until the bromophenol blue dye front reaches approximately onehalf or three-quarters of the distance down the lane. For specific conditions, please refer to the manufacturer s instructions for your electrophoresis apparatus. 3. After electrophoresis is complete, stain the gel with µg/ml ethidium bromide. Visualize the bands under UV light. 4. You should observe a smear ranging from ~100 bp to > 1 kb (see next page). Continued on next page 34

53 Ligating the 34-bp Ditag to Yield Concatemers, Continued Expected Results 100-bp Ladder Concatemer An example of concatemer gel electrophoresis using a 2% agarose gel and the conditions described on the previous page. 600 bp DNA Elution 1. Make a hole in the bottom of six 0.5-ml sterile microcentrifuge tubes using an 18-gauge needle. Be careful when piercing the tubes with a needle. 2. Using a new razor blade, excise the following approximate regions from the gel: bp bp 800 bp 1 kb 3. Cut each gel region into 2 pieces and place each piece into a 0.5-ml microcentrifuge tube prepared as above two tubes for each gel region. 4. Place each 0.5-ml microcentrifuge tube into a sterile 1.5-ml microcentrifuge tube, and label each 1.5-ml tube to indicate its gel region. 5. Centrifuge the tubes at maximum speed in a microcentrifuge for 2 3 minutes (be careful not to rip off the lids of the tubes). The excised bands will be broken into small pieces and collected in the 1.5-ml tubes. Discard the 0.5-ml tubes. 6. Prepare 200 µl of LoTE/7.5 M ammonium acetate (5:1) mix. Add this mix to each 1.5-ml microcentrifuge tube containing the gel pieces. Make sure that all gel pieces are covered with the buffer. Mix well by vortexing. 7. Incubate at 65 C for 2 hours to elute the DNA from the gel. If there is not enough time to complete the elution, you may incubate at +4 C overnight followed by 65 C for 15 minutes. 8. Combine the contents of each pair of tubes containing the same gel region into a S.N.A.P. column fitted to a collection tube (three S.N.A.P. columns one for each gel region). Centrifuge at maximum speed in a microcentrifuge for 2 minutes. 9. Aliquot the eluate from each column into two clean microcentrifuge tubes (~200 µl of eluate each) and proceed to Ethanol Precipitation, next page. Continued on next page 35

54 Ligating the 34-bp Ditag to Yield Concatemers, Continued Ethanol Precipitation 1. Add an equal volume of phenol/chloroform to each tube containing the eluate. Vortex vigorously. 2. Centrifuge at maximum speed in a microcentrifuge for 5 minutes at room temperature. 3. Transfer the aqueous (top) phase (~200 µl) from each tube to a new 1.5-ml sterile microcentrifuge tube and precipitate each sample as follows: 7.5 M Ammonium Acetate 133 µl Mussel Glycogen 3 µl 100% Ethanol 1000 µl 4. Mix well and place the tubes on dry ice for minutes and centrifuge at maximum speed in a microcentrifuge for 30 minutes at +4 C. 5. Wash the pellet twice with 1 ml of cold 70% ethanol and air-dry the pellet for minutes. 6. Resuspend the pellet in each tube in 6 µl of LoTE and proceed to Cloning Concatemers into pzero -1 (see next page). 36

55 Cloning Concatemers into pzero -1 Introduction In this section you will clone the gel-purified concatemers into pzero -1. Prior to cloning, you need to linearize pzero -1 with Sph I. This step can be performed while you are gel-purifying the concatemers. For a description of pzero -1, see page 57. A detailed map and features of pzero -1 are provided on pages The sequences surrounding the multiple cloning site are shown on page 45. The complete sequence of pzero -1 is available for downloading from our Web site at Before Starting You will need the following items on hand before starting: Dry ice Shaker set at 37 C 100% ethanol Phenol/chloroform (see page 65 for ordering information) 1.5-ml sterile microcentrifuge tubes Reagents from the Zero Background Cloning kit and the Concatemer Module Linearizing pzero -1 with Sph I Before cloning your concatemers into pzero -1, you need to linearize the vector. We recommend using Sph I (provided in the Concatemer Module) to linearize the vector. 1. Digest 2 µg of pzero -1 with Sph I as follows: pzero -1 (1 µg/µl) 2.0 µl 10X Buffer µl Sph I 1.4 µl Sterile Water 19.1 µl Total Volume 25 µl 2. Incubate at 37 C for minutes. DO NOT digest for longer than 30 minutes. 3. Add 175 µl of LoTE to the digestion mix. 4. Add an equal volume of phenol/chloroform to the tube and mix vigorously. 5. Centrifuge at maximum speed in a microcentrifuge at room temperature. 6. Transfer the aqueous (top) phase (200 µl) to a clean microcentrifuge tube. 7. Add 65 µl of 7.5 M ammonium acetate and 600 µl 100% ethanol. Mix well. 8. Place the tube on dry ice for 10 minutes and centrifuge at maximum speed in a microcentrifuge at +4 C. 9. Carefully remove and discard the supernatant. Wash the pellet twice with 1 ml of cold 70% ethanol and air-dry the pellet for 5 10 minutes. 10. Resuspend the pellet in 60 µl LoTE. Mix well and aliquot into six 10-µl tubes. Store the tubes at -20 C. You may check the efficiency of Sph I digestion (see below). Proceed to Ligating into pzero -1 (see next page). RECOMMENDATION We recommend that you check the efficiency of Sph I digestion by agarose gel electrophoresis. Analyze 2 µl of the digestion mixture and undigested pzero -1 on a 1% agarose gel. Use the linearized pzero -1 vector immediately, if possible. The DNA can be stored at -20 C. Continued on next page 37

56 Cloning Concatemers into pzero -1, Continued Ligating into pzero -1 Be sure to include a no DNA and no ligase controls. Test inserts are provided to check ligation conditions and confirm the lack of ccdb function when its expression is disrupted (see page 60 for details on using the test inserts). 1. Set up the following 10-µl ligation reaction on ice. You will need 3 tubes for ligation (one for each pool of DNA). Reagent Sample No DNA No Ligase Concatemers 6 µl pzero -1/Sph I 1 µl 1 µl 1 µl 10X Ligase Buffer 1 µl 1 µl 1 µl T4 DNA Ligase 2 µl 2 µl -- Sterile Water -- 6 µl 8 µl 2. Incubate for 1 3 hours at 16 C. Do not ligate at room temperature. 3. Adjust the volume to 200 µl with LoTE. 4. Add equal volume of phenol/chloroform to each tube and mix vigorously. 5. Centrifuge at maximum speed in a microcentrifuge at room temperature. 6. Transfer the aqueous (top) phase (200 µl) to a clean microcentrifuge tube. 7. Add 133 µl of 7.5 M ammonium acetate, 3 µl of mussel glycogen and 1 ml of 100% ethanol. Mix well. 8. Place the tubes on dry ice for 5 10 minutes and centrifuge at maximum speed in a microcentrifuge at 4 C. 9. Carefully remove and discard the supernatant. Wash the pellet four times with 1 ml of cold 70% ethanol. 10. Air-dry the pellet for minutes. 11. Resuspend the pellet from each tube in 12 µl LoTE and proceed to Transforming One Shot TOP10 Electrocomp E. coli (see next page). Continued on next page 38

57 Transforming One Shot TOP10 Electrocomp E. coli Introduction A transformation protocol using One Shot TOP10 Electrocomp E. coli is provided below for your convenience. If you are using any other competent cells or chemically competent cells, please follow the manufacturer s recommendations. Before Starting You will need the following items on hand before starting: Shaker set at 37 C Appropriate number of low salt LB plates containing 50 µg/ml Zeocin (see page 63 for a recipe) Reagents from the One Shot TOP10 Electrocomp E. coli kit Preparing for Transformation The following transformation protocol is for use with One Shot TOP10 Electrocomp E. coli available with the kit. For each transformation, you will need one vial of One Shot TOP10 Electrocomp E. coli and 2 3 selective plates. Perform the following steps before beginning. 1. Bring the vial of SOC medium from the kit to room temperature. 2. Warm low salt LB plates containing 50 µg/ml Zeocin at 37 C for 30 minutes. 3. Thaw on ice the desired number of vials of One Shot E. coli for each transformation. 4. Chill electroporation cuvettes on ice. Transformation Reaction 1. Be sure to include appropriate controls. Supercoiled puc19 plasmid is provided as a positive control for transformation. 2. Add 1 2 µl of the ligation reaction (from Step 11, previous page) into 50 µl of One Shot TOP10 Electrocomp E. coli and mix gently. Do not mix by pipetting up and down. Avoid formation of bubbles. 3. Carefully transfer the cells and DNA to a chilled 0.1 cm cuvette. 4. Electroporate the samples using your protocol. 5. Add 250 µl of room temperature SOC medium to the cuvette and shake the tube (200 rpm) at 37 C for 1 hour. 6. Add 750 µl of SOC medium to the tube and mix well. 7. Plate 100 µl from each transformation on low salt LB plates containing 50 µg/ml Zeocin and incubate overnight at 37 C. We recommend plating 100 µl onto 2 3 low salt LB plates containing 50 µg/ml Zeocin plates. 8. Store the remaining transformation reaction at +4 C. The next day, depending on the number of colonies observed from previous plating, plate out all the transformation reaction or dilute the transformation reaction appropriately and then plate. 9. Proceed to Screening Transformants (see page 41). 39

58 Days 8 9: Screening and Sequencing of Clones Experimental Outline The experimental steps and the time necessary to complete each step on Days 8 and 9 are outlined below. Day Step Action Time 8 1 Analyze Transformants by Restriction overnight Digestion (Optional) Analyze Transformants by Colony PCR ~3 4 hours 9 2 Sequencing varies 40

59 Screening Transformants Introduction In this step, you analyze the transformants either by restriction enzyme digestion (below) or colony PCR (optional; next page). Before Starting Restriction Enzyme Digestion You will need the following items on hand before starting: 1% agarose gel Sterile toothpicks Bam HI, Xba I, or Hind III SOC medium containing 50 µg/ml Zeocin Analyze Transformants by Restriction Digestion Remove plates from the incubator (Step 7, page 39) and check the colonies. An efficient ligation reaction should produce colonies per plate while the controls should produce < 10 colonies per plate. 1. Pick Zeocin -resistant transformants using sterile toothpicks or pipette tips. We recommend using a high throughput plasmid generating system. 2. Inoculate into 1 2 ml SOC containing 50 µg/ml Zeocin. Grow overnight at 37 C. 3. Isolate plasmid DNA using any method of choice. 4. Digest the DNA using either Bam HI and Xba I or Xba I and Hind III. Follow the manufacturer s recommendations for buffers and reaction conditions. 5. Analyze digests on a 1% agarose gel. 6. Determine the size and the percent of inserts present in the I-SAGE Long library. More than 75% of clones should contain an insert of >400 bp (negative control is 200 bp). The quality of the I-SAGE Long library is determined by the percent of products containing large inserts (see page 43 for calculations). If the quality of the library is acceptable, proceed to Sequencing (page 44). 100 bp Ladder 600 bp Figure: Inserts were cloned into pzero -1 and digested as specified above using Xba I and Hind III. Size of the inserts range from 600 bp to 1.2 kb. Continued on next page 41

60 Screening Transformants, Continued Optional: Before Starting Colony PCR You will need the following items on hand before starting: 1% agarose gel Sterile pipettes 96-well PCR plates 10X BV Buffer M13 forward and reverse primer dntp Mix, 10 mm each Optional: Analyze Transformants by Colony PCR Remove plates from the incubator (Step 7, page 39) and check the colonies. An efficient ligation reaction should produce colonies per plate while the controls should produce < 10 colonies per plate. 1. Prepare the following PCR cocktail. The amounts provided are for one PCR reaction. Calculate the volume of reagents you will need for 48 or 96 PCR reactions. 10X BV Buffer 2.5 µl DMSO 1.25 µl 10 mm dntp's 1.25 µl 5 µm M13 Forward Primer 1 µl 5 µm M13 Reverse Primer 1 µl Sterile Water 18 µl Platinum Taq DNA Polymerase 0.2 µl 2. Add 25 µl to each well of a 96-well PCR plate. 3. Using a sterile pipette tip, gently touch a Zeocin resistant colony and then dip the tip into a well containing the PCR cocktail. Save the plates for each concatemer as these plates can be used later for sequencing (see page 44). 4. Mix well and amplify using the following parameters: Temperature Time Cycles 94 C 2 minutes 1 94 C 30 seconds 55 C 1 minute C 1 minute 70 C 5 minutes 1 5. Analyze 4 µl from each well on a 1% agarose gel. 6. Determine the size and the percent of inserts present in the I-SAGE Long library. Most of the clones will contain an insert of >400 bp (negative control is 200 bp). The quality of the I-SAGE Long library is determined by the percent of products containing large inserts (see page 43 for calculations). 7. Proceed to Sequencing of the selected clones (see page 44). Continued on next page 42

61 Screening Transformants, Continued Calculating the Number of Tags Use the formulas below to calculate the number of tags per library. 1. Total number of tags per clone = the size of the insert divided by 17 (size of the tag) 2. Total number of tags per clone Number of clones = Total number of tags µl* µl* 3. Total number of tags Total number of µl = Total number of tags per library µl* µl* = amount in µl of the ligation mix used A good quality I-SAGE library should produce >100,000 tags. If you obtain fewer tags, see the Troubleshooting section on page

62 Sequencing Introduction Once you have analyzed the Zeocin -resistant transformants for the presence of insert, you are ready to sequence the selected clones. You may use any method of choice for sequencing. Before Starting You will need the following items on hand before starting: M13 forward primer Plasmid DNA of selected clones Sequencing Guidelines Using optimal amount of template is critical to achieve the best sequencing results High throughput automated sequencing is highly recommended Sequencing can be performed using inserts that have been amplified by PCR or by using intact plasmid containing the insert as the sequencing template Use M13 forward sequencing primer to sequence the clones We recommend the Concert 96 Plasmid Purification System for preparing highquality plasmids for automated sequencing (see page 65 for ordering information) Sequencing Time Using an ABI PRISM 377 DNA Sequencer, you can sequence 96 clones per day. Each clone contains ~25 Long SAGE tags. Continued on next page 44

63 Sequencing, Continued Sequencing your Construct The sequence surrounding your insert is shown below. Unique restriction sites are labeled to indicate the cleavage site. You may download the complete sequence of the pzero -1 vector from our web site at or call Technical Service (see page 68). 95 P lac-laco region GCGCAACGCA ATTAATGTGA GTTAGCTCAC TCATTAGGCA CCCCAGGCTT TACACTTTAT M13 Reverse primer lacza ORF GCTTCCGGCT CGTATGTTGT GTGGAATTGT GAGCGAATAA CAATTTCACA CAGGAAACAG CT ATG Met Mlu I Nsi I * ACC ATG ATT ACG CCA AGC TAT TTA GGT GAC GCG TTA GAA TAC TCA AGC TAT GCA Thr Met Ile Thr Pro Ser Tyr Leu Gly Asp Ser Leu Glu Tyr Ser Ser Tyr Ala Hind III Asp718 I Kpn I Ecl136 II Sac I BamH I Spe I Eco RI TCA AGC TTG GTA CCG AGC TCG GAT CCA CTA GTA ACG GCC GCC AGT GTG CTG GAA Ser Ser Leu Val Pro Ser Ser Asp Pro Leu Val Thr Ala Ala Ser Val Leu Glu Pst I Eco RV Not I Xho I Sph I Nsi I * Xba I Dra II Apa I TTC TGC AGA TAT CCA TCA CAC TGG CGG CCG CTC GAG CAT GCA TCT AGA GGG CCC Phe Cys Arg Tyr Pro Ser His Trp Arg Pro Leu Glu His Ala Ser Arg Gly Pro T7 Promoter/Priming site M13 (-20) Foward priming site AAT TCG CCC TAT AGT GAG TCG TAT TAC AAT TCA CTG GCC GTC GTT TTA CAA CGT Asn Ser Pro Tyr Ser Glu Ser Tyr Tyr Asn Ser Leu Ala Val Val Leu Gln Arg M13 (-40) Foward priming site CGT GAC TGG GAA AAC CCT GGC GTT ACC CAA CTT AAT CGC CTT GCA GCA CAT CCC Arg Asp Trp Glu Asn Pro Gly Val Thr Gln Leu Asn Arg Leu Ala Ala His Pro CCT TTC GCC AGC TGG CGT AAT AGC GAA GAG GCC CGC ACC GAT CGC CCT TCC CAA Pro Phe Ala Ser Trp Arg Asn Ser Glu Glu Ala Arg Thr Asp Arg Pro Ser Gln LacZa/ccdB Fusion joint CAG TTG CGC AGC CTA TAC GTA CGG CAG TTT AAG GTT TAC ACC TAT AAA AGA GAG Gln Leu Arg Ser Leu Tyr Val Arg Gln Phe Lys Val Tyr Thr Tyr Lys Arg Glu AGC CGT TAT CGT CTG TTT GTG GAT GTA CAG AGT GAT ATT ATT GAC ACG CCG GGG Ser Arg Tyr Arg Leu Phe Val Asp Val Gln Ser Asp Ile Ile Asp Thr Pro Gly ccdb ORF CGA CGG ATG GTG ATC CCC CTG GCC AGT GCA CGT CTG CTG TCA GAT AAA GTC TCC Arg Arg Met Val Ile Pro Leu Ala Ser Ala Arg Leu Leu Ser Asp Lys Val Ser CGT GAA CTT TAC CCG GTG GTG CAT ATC GGG GAT GAA AGC TGG CGC ATG ATG ACC Arg Glu Leu Tyr Pro Val Val His Ile Gly Asp Glu Ser Trp Arg Met Met Thr ACC GAT ATG GCC AGT GTG CCG GTC TCC GTT ATC GGG GAA GAA GTG GCT GAT CTC Thr Asp Met Ala Ser Val Pro Val Ser Val Ile Gly Glu Glu Val Ala Asp Leu AGC CAC CGC GAA AAT GAC ATC AAA AAC GCC ATT AAC CTG ATG TTC TGG GGA ATA Ser His Arg Glu Asn Asp Ile Lys Asn Ala Ile Asn Leu Met Phe Trp Gly Ile TAA ATG TCA GGC *** Continued on next page 45

64 Sequencing, Continued Expected Results The figure below shows an example of sequencing results obtained using an ABI PRISM for an I-SAGE Long library. The transcript sequences are separated by the Nla III recognition site, CATG (see boxed sequences in the figure below). 46

65 Analyzing Data Introduction After you have sequenced the clones, you are ready to analyze the sequence data. SAGE2000 Version 4.5 analysis software for I-SAGE Long library analysis is available from our Web site at The software converts the sequence data into Long SAGE tags, tabulates tag abundances, and creates a report containing each tag and its expression level. Then the SAGE tags can be analyzed using downloadable reference sequence databases such as SAGEmap (Lash A.E et al., 2000) available at the NCBI Web site. You will need Microsoft Windows, Microsoft Excel, and Microsoft Access to use the software. See the SAGE2000 software manual for details. Using the Software A SAGE2000 software manual is provided with the kit to help you access and use the software, and analyze your sequencing data. You can also download the manual from our Web site at 47

66 Appendix Recipes Low Salt LB Agar Plates with Zeocin Composition: (per liter) 1% Tryptone 0.5% Yeast Extract 0.5% NaCl ph For 1 liter, dissolve 10 g tryptone, 5 g yeast extract, and 5 g NaCl in 950 ml deionized water. 2. Adjust the ph of the solution to 7.5 with 5 M NaOH, add 15 g agar, and bring the volume to 1 liter. 3. Autoclave for 20 minutes on liquid cycle. 4. Let agar cool to ~55 C. Thaw the 100 mg/ml Zeocin stock solution and add to a final concentration of 50 µg/ml (500 µl/liter of medium). Sufficient Zeocin is provided to make 2 liters of 50 µg/ml Zeocin medium. If using a cell line carrying a laci q gene, add IPTG to a final concentration of 1 mm (1 ml/liter). 5. Pour into 10 cm petri plates. Let the plates harden, then invert and store at +4 C. Plates containing Zeocin are stable for 1 week. 48

67 Troubleshooting Introduction mrna quality is the key factor that will affect the outcome of your results using the I-SAGE Long kit. Please review the information provided in the table below to troubleshoot your experiments. Problem Cause Solution 28S and 18S bands are not observed after isolation of total RNA No bands seen after cdna synthesis when analyzed by PCR Clumping of beads Inefficient enzymatic reactions RNA is degraded due to RNase activity Less RNA loaded on the gel for analysis Poor quality of RNA or RNA is degraded cdna synthesis reagents not working Robust cdna synthesis results in entangling of the double stranded DNA in the beads Precipitation of SDS in Wash Buffer C Improper mixing and washing of beads Loss of beads Follow the guidelines on page 7 to avoid RNase contamination. Use fresh sample (tissue or cells) for RNA isolation. Be sure to load at least 250 ng of RNA for analysis. Check the quality for RNA as described on page 8. Use extreme care while handling RNA samples to prevent RNase contamination (see page 7). Perform cdna synthesis with Control HeLa Total RNA included in the kit to ensure that the cdna synthesis reagents are working properly. Perform 2 4 additional wash steps using medium vortexing to disperse the beads. Increase the concentration of BSA in Wash Buffer D to 3X to facilitate resuspension of beads. Keep the solutions warm to prevent SDS precipitation, which results in bead clumping. Be sure to thoroughly mix the beads after every reaction and during all the wash steps. Intermittent mixing of the beads during incubation of enzymatic reactions will increase the efficiency and robustness of each reaction. Use siliconized microcentrifuge tubes to prevent the beads from sticking to the sides of the tube. Be sure to scrape the sides of the microcentrifuge tube to remove any beads that are sticking to the tubes. Minimize pipetting steps. Continued on next page 49

68 Troubleshooting, Continued Problem Cause Solution Inefficient adapter ligation Incomplete Mme I digestion Low yield of 130-bp ditags CATG overhangs on the LS adapters and Nla III digested cdna may be cleaved by the exonuclease activity of E. coli DNA polymerase Adapter amount is not optimal Thoroughly wash and heat the beads with Wash Buffer C containing SDS to remove any traces of exonuclease activity. Optimize the adapter concentration if the amount of your sample is not within the range described on page 15. Increase the amount of LS adapters in the reaction if the 130-bp and 100-bp bands are faint. Decrease the amount of LS adapters in the reaction if there is a strong 100-bp band and a faint 130-bp band. Improper reaction conditions Be sure to perform the Mme I incubation at 37 C for 2.5 hours for optimal digestion, mixing the reaction occasionally. Cleavage of CATG overhangs by the exonuclease activity of E. coli DNA polymerase (see above) Prolonged storage of beads at 4 C after each enzymatic reaction Traces of exonuclease activity present due to clumping and improper washing of beads Poor RNA quality produces less double-stranded cdna, resulting in low yield of 130-bp ditag Be careful to thoroughly wash and heat the beads with Wash Buffer C containing SDS to remove any traces of exonuclease activity. Try to quickly proceed through the first three days of the protocol for ditag generation to prevent any degradation of intermediates from traces of exonuclease activity. Thoroughly vortex the beads during all the wash steps and add wash steps if necessary. Be sure to use high-quality RNA. Check the quality of your RNA sample as described on page 8. Continued on next page 50

69 Troubleshooting, Continued Problem Cause Solution Presence of nonspecific bands in PCR reactions Presence of higher molecular weight bands High intensity of a 100-bp band Low yield of 34-bp ditags Contamination of PCR tubes or reagents Formation of primer-dimers or non-specific binding of primers resulting in amplification of unrelated products Poor RNA quality produces less double-stranded cdna template for the PCR reaction. This results in increased amplification of the 100-bp band Improper washing of beads due to bead clumping Results from ligation of two LS adapters Reduced activity of Nla III Inefficient Nla III digestion of 130-bp ditag due to the presence of contaminants after gel purification Presence of an 100-bp band which inhibits Nla III digestion Degradation of 34-bp ditags Be sure set up the PCR reactions in two separate locations as described on page 5 to prevent contamination from template or cross contamination of reagents. Include negative controls to help you evaluate your results. Use hot-start PCR. Set up the PCR reaction on ice to prevent primer-dimer formation. Reduce the amount of template or reduce the number of PCR cycles. Be sure to use high-quality RNA. Check the quality of your RNA sample as described on page 8. Be sure to thoroughly wash the beads and follow the guidelines on page 49 to prevent clumping of beads. Decrease the amount of LS adapter in the ligation reaction. Be sure to keep the enzyme at -80 C at all times. Use the enzyme immediately upon removal from -80 C and immediately return to -80 C. Be sure to excise only the 130-bp ditag from the gel. Do not include any high or low molecular weight contaminating band. Use large-format gels to obtain complete separation of the 130-bp band from the contaminating 100-bp band. Be sure to keep the 34-bp ditag at +4 C and in high-salt buffer at all times to prevent denaturation. Continued on next page 51

70 Troubleshooting, Continued Problem Cause Solution High background of transformants that do not contain the insert Very few or no transformants arise Thin lawn of cells on plate Reagents contaminated with nucleases. A nuclease digestion may create a frame shift deletion mutation that will disrupt expression of the ccdb gene Overdigestion of the vector with restriction enzymes may result in disruption of the laczα-ccdb gene Loss of DNA during precipitation Low transformation efficiency of E. coli strain Insufficient amount of Zeocin in the medium Zeocin is inactivated Too many cells plated Use the reagents supplied with the kit or autoclave all reagents used for cloning. Use high-quality restriction enzymes to prevent nuclease contamination. Limit restriction enzyme digestion to minutes. Be careful not to lose the DNA pellet when precipitating and washing. Check transformation efficiency with the puc19 control vector included in the kit. Be sure to add 50 µg/ml Zeocin to the medium. Be sure to use low salt LB plates and maintain the ph of the medium at 7.5 to prevent inactivation of Zeocin. Plate a smaller volume of the transformation mixture or dilute with SOC before plating. 52

71 Verifying cdna Synthesis and Nla III Digestion If you are familiar with cdna synthesis and Nla III digestion and have used an I-SAGE kit before, you can skip the following procedure. However, if you are having problems with cdna synthesis and/or Nla III digestion, we recommend that you perform this step. Verifying cdna Synthesis and Nla III Digestion by PCR The following procedure can be used to check the cdna synthesis reaction (page 12) and Nla III digestion (page 13). This procedure uses reagents from the Performance Check Module, takes approximately 2 hours, and may be performed at the end of Day 1 or at any time thereafter. The PCR primers (GAPDH and EF) used in the following procedure are designed for human RNA sample, but have also been found to work with mouse and rat. Note that this reaction may not detect subtle problems with the cdna reaction and/or Nla III digestion (e.g., loss of enzyme activity during storage). 1. Set up four 50-µl PCR reactions as shown below on ice in sterile PCR tubes. We strongly recommend that you set up a similar reaction with the cdna synthesized using Control HeLa Total RNA. Reagents GAPDH/ cdna Template GAPDH/ Nla III Template EF/ cdna Template EF/ Nla III Template 10X BV Buffer 5 µl 5 µl 5 µl 5 µl DMSO 3 µl 3 µl 3 µl 3 µl dntp Mix (10 mm each) 5 µl 5 µl 5 µl 5 µl GAPDH Primer Set 4 µl 4 µl EF Sense Primer µl 2 µl EF Anti-sense Primer µl 2 µl Platinum Taq DNA Polymerase 0.5 µl 0.5 µl 0.5 µl 0.5 µl cdna Synthesis Template 0.5 µl µl -- from Step 8, page 12 Nla III Digestion Template µl µl from Step 5, page 13 DEPC Water to 50 µl to 50 µl to 50 µl to 50 µl 2. Cap the tubes and centrifuge briefly to collect the contents. 3. Amplify using the following cycling parameters: Temperature Time Cycles 95 C 2 minutes 1 95 C 1 minute 55 C 1 minute C 2 minutes 72 C 5 minutes 1 4. Maintain the reaction at 4 C after cycling. 5. Analyze 10 µl of the reaction using agarose gel electrophoresis (see following page for expected results). Continued on next page 53

72 Verifying cdna Synthesis and Nla III Digestion, Continued Expected Results After electrophoresis, you should see a 540-bp band with the cdna Synthesis template and GAPDH primers, no band with the Nla III template and GAPDH primers, and a 350-bp band with either template and the EF primers, as shown below. (Note that efficient Nla III digestion will result in loss of the GAPDH primer binding site.) If you do not observe any bands after cdna synthesis with your RNA sample, please see the Troubleshooting section on page 49. Legend for the gel: An aliquot was removed after double-stranded cdna synthesis using total RNA from peripheral blood mononuclear cells and was PCR amplified using gene-specific primers for GAPDH (lane 2) and EF (lane 4) as described on the previous page. After Nla III digestion, the GAPDH primer binding sites are lost (lane 3), while the EF-1 primer binding sites are intact (lane 5). Lanes 1 and 6: 100-bp ladder Nla III Digestion Check cdna Synthesis Check GAPDH Forward GAPDH Reverse EF Forward EF Reverse 54