Genetic testing of Tay-Sachs disease by PCR and Restriction Digest
|
|
- Theresa Gibbs
- 6 years ago
- Views:
Transcription
1 Genetic testing of Tay-Sachs disease by PCR and Restriction Digest ESC102-PRA0103 Submitted to: Elizabeth Berndl 18 February, 2009 Submitted by: Laila Hulbert ( ) Maria Yancheva ( )
2 Scientific and Medical Justification Tay-Sachs disease is a progressive neurodegenerative disorder, which causes large quantities of the GM2 ganglioside fatty acid to accumulate in the nerve cells of the brain [1]. The presence of gangliosides in the retinal cells results in the appearance of a red spot in the retinae of patients with Tay-Sachs disease. Other consequences caused by the excess presence of gangliosides in the nerve cells are a loss of mental and physical abilities in infants, leading to blindness and deafness [2]. The atrophy of muscles causes paralysis and eventual death at an early age. In its classic form, the disease is found in infants and is typically fatal by the age of 2 or 3. Tay-Sachs is a genetic disorder caused by a mutation in the hexosaminidase A (HEXA) gene [1], and is inherited in an autosomal recessive pattern [2]. There are a number of genetic mutations which can cause the disease. The Arg170Gln mutation was found to be one of the wide-spread mutations causing Tay-Sachs among the Moroccan Jewish population [1]. There is currently no cure for the disease, and infantile Tay-Sachs disease results in death by the age of 5 at best. The methods of treatment currently being researched include enzyme replacement therapy which aims to replace a missing enzyme in patients; gene therapy which aims to replace defective genes through the brain; and substrate reduction therapy which aims to control the metabolism of GM2 gangliosides in the brain [2]. This proposal describes a diagnostic which tests for the Arg170Gln mutation caused by the substitution of glutamine in place of arginine-170, resulting in a G-to-A change at nucleotide 509 [1]. See Appendix A for transcript and genomic region. The primers used to amplify the region are as follows: (see Appendix B for primer design details) Tay-Sachs F: CTTGAGGCCACACTGCTTTGAA Tay-Sachs R: TGTATCCCTGGAAACAGCCTGA The restriction enzyme HpaII will be used to cleave these sites (see Appendix C for cleave sites). The following bands will be produced. Homozygous Wild Type: 346, 614 Heterozygous: 346, 614, 960 Homozygous Mutant: 960 Protocol (Modified from Labs 2 & 3) Step One: Obtaining DNA See Lab 2, step1. Step Two: PCR Amplification of DNA See Lab 2, step 2, except: After 3, each group member transfers the remaining Instagene liquid (without beads) to a 1.5 ml tube, labeled with her name on a removable label. The TA removes the label with the name and replaces it with a number, and selects three random samples to test. Transfer 20 μl of master mix into each PCR tube, mix by pipetting up and down two to three times. Avoid bubbles. Cap the tubes and keep them on ice. Continue from step 6 in protocol. Step Three: Restriction Digest and Electrophoresis See Lab 3, except: Add 10 μl PCR product and 10 μl HpaII master mix to microtubes, and incubate at 37C for 1 hour (do this before preparing gel). Continue from 1.
3 Concentration of agarose gel should be 2% (from RFP) After incubation, add 5 μl loading dye to one undigested sample and to all digested samples. Continue from step 6. Step Four: Staining with Sybr Green See Lab 3.
4 References [1] OMIM. (2009). Tay-Sachs Disease. Retrieved February 17, 2009, from [2] Wikipedia. (n.d.). Tay-Sachs Disease. Retrieved February 17, 2009, from
5 Appendix A Wild Type and Tay-Sachs cell variants of the HEXA gene from Ensembl Wild Type Transcript: 961 ACATTCTTTATCAACAAGACTGAGATTGAGGACTTTCCCCGCTTTCCTCACCGGGGCTTG 153 -T--F--F--I--N--K--T--E--I--E--D--F--P--R--F--P--H--R--G--L- Mutant Transcript: 961 ACATTCTTTATCAACAAGACTGAGATTGAGGACTTTCCCCGCTTTCCTCACCaGGGCTTG 153 -T--F--F--I--N--K--T--E--I--E--D--F--P--R--F--P--H--R--G--L- Wild Type Genomic Region: ACCCAGGCTCCTTGGAAACCCAAGCTTATGATCACTTTCTCACAATTTATTCTGGGACCC CTTTTCTCAGCTCTCTTAGCTCCTGATAGGGGTTATCCATGAAAAGTCCAACTCTTGCAG GCTGAGTTGTCTCTGTGTCTGTCCTCATGAGTATATGTCTTGGCCTCTCTTCTCAATATT CTTGTGAAGGCACAGGAAATATAGATAAGAGGTATGTGGGTTTTGAAGGTTAGTATGTTG TAAGGAAGGGCACTAAAACCCTTACTCTGACATCTCCCAAAATGAAATACAGAAGTAAAG ATGGATAGTGGCTTCCTAATATCCCCTTTTCATCAGTGTTAAAAATCGTCAAGCCTACAC TACATCCATTTTCCCTGTGTACCCAAATGTTATGCTCTGCTACATTGAGAACCTTCCAAA TAGAGACATCTCTTTTTCCACTCCCTGAGTCTTTACTCTGCCTCTCTACATCTTCCTAGG TCTGGAGACTTTTAGCCAGCTTGTTTGGAAATCTGCTGAGGGCACAGTAAGTGTGGACCC TCAAAAAGGGCTCCTTTTTCATCTCTGGGGTTGGATCCCAATATTGAGAATCCTAGAAAA ATCTTGTTTTGCCTTAGGATCCTGGTGGCTTGAGATAGCCCCAGTAGAAATGGAAGAGGA GATGTGAGTGGAAAACTGGTTTGGTAGATTTGGTCTGTTTGGAATCACTGTAATTTGGTC CCCCTGAGTCATCATTTAGTAATGACCTTGAGGCCACACTGCTTTGAAGAAAATAAACTA TGTTAACAGGAAAATCCAGAATTTGTAGGCTGAGTGGTGTTTGGGACAGTTGTATTAGGC TGGCGTTGGACAATTGCTCTCTGGGAAGGTGGCTGCTTATGGTCATTTATAGAGGTGGGG AGCATTTAGGGAGAGAGCGACCCTGAGAACAGTCACAGATTGGCTTTTTAAGAATCCTGG GAGAGTTGTCTTCATCTCCCTGTGCCCCCATAGTAAGCTTCCTTTGAAACTGACATGTTC AATGTTTGTTCTGCACAGTTCTTTATCAACAAGACTGAGATTGAGGACTTTCCCCGCTTT CCTCACCGGGGCTTGCTGTTGGATACATCTCGCCATTACCTGCCACTCTCTAGCATCCTG GACACTCTGGTAACCAGGCCTTAAGGCCTTCTTCACACTTAAGAGTTCTAGGGTGATGGA GCAACGGACAGACCAAGTTCCAAATTCTTAAAGAGTTAGAGAGGGAATGTATGGACTGGG TGTGGTGGCTCATGCCTGTAATCCCAACACTTTGGGAGGCCGAGGTGGGCGGATCACCTG AAGTCAGAAGTTCAAGGCCAGCCTGGCCAACATGGTGAAACTCTGTCTCTACTAAAAATA CAAAAATTAGCTGGGCATGGTGGTGCATGCTTGTAATCCCAGCTACCTGGGAGGCTGAGG CAGGAGAATCGCATGAACCCAGGAGGCAGAGGTTGCAGTGGGTGGAGATCACGCCACTGC ACTCCAGCCTGGGTGAAAGAGTGAGACGCTGTCTCAAAAAAAAAAAAAAAAATTGTATGT AATTCTATGAGCTCCTGGGAAAAATGTAGAAGATGAGCTGCTCCAAGACTCAAAAAATAA CAGAGTGACTTAAATCTACCTTACAGGCTACTGTAGATCAATGTTCAGGCTGTTTCCAGG GATACAAATGTTTAGGGGAATTGGCTTCATTGGCAGAGCTAACTATATTTGTTTTTGAGA CAGCGTCTCAATTTTTTTTTTTTTTTTTTGTATTTTTTGTAGAGCTGGGGTTTCGTCATG TTACCCAGGCTGGTCTTGAACTCCTGGGCTCAAGCAATCTGCCCACCTTGGCCTGCCAGA GTGGTAGAATTACAGGCATGAGTCACTACACCTGGCCGGCAGAGCTAACTTTAGTTAGAA CAAGGTCATAGGAGAGAGACGTTCAAAGCCTTAACTTGGGGCCAGGTGCAGTGGCTCACA CCTGTAATCCTAGCACTCTGGGAGGCCAAGGCGGGTGGATTGCCCGAGCTCAGGAGTTTG AGACTAACCTGGCCAAGACGGTGAAACCCCATCTCTACTGAAAATACAAAAAATTAGCCA GGCGCGATGGCGCAAACCTGTAGTCCCAGCTACTCAGGAGTCTGTGATGGGAGAATCACC TGAGCCTGGGGAGATCAAGGATGCATGAACTGTGATTGCACCACTGCACTCCAGCCTGGA Mutant Genomic Region: ACCCAGGCTCCTTGGAAACCCAAGCTTATGATCACTTTCTCACAATTTATTCTGGGACCC CTTTTCTCAGCTCTCTTAGCTCCTGATAGGGGTTATCCATGAAAAGTCCAACTCTTGCAG GCTGAGTTGTCTCTGTGTCTGTCCTCATGAGTATATGTCTTGGCCTCTCTTCTCAATATT CTTGTGAAGGCACAGGAAATATAGATAAGAGGTATGTGGGTTTTGAAGGTTAGTATGTTG 23100
6 23101 TAAGGAAGGGCACTAAAACCCTTACTCTGACATCTCCCAAAATGAAATACAGAAGTAAAG ATGGATAGTGGCTTCCTAATATCCCCTTTTCATCAGTGTTAAAAATCGTCAAGCCTACAC TACATCCATTTTCCCTGTGTACCCAAATGTTATGCTCTGCTACATTGAGAACCTTCCAAA TAGAGACATCTCTTTTTCCACTCCCTGAGTCTTTACTCTGCCTCTCTACATCTTCCTAGG TCTGGAGACTTTTAGCCAGCTTGTTTGGAAATCTGCTGAGGGCACAGTAAGTGTGGACCC TCAAAAAGGGCTCCTTTTTCATCTCTGGGGTTGGATCCCAATATTGAGAATCCTAGAAAA ATCTTGTTTTGCCTTAGGATCCTGGTGGCTTGAGATAGCCCCAGTAGAAATGGAAGAGGA GATGTGAGTGGAAAACTGGTTTGGTAGATTTGGTCTGTTTGGAATCACTGTAATTTGGTC CCCCTGAGTCATCATTTAGTAATGACCTTGAGGCCACACTGCTTTGAAGAAAATAAACTA TGTTAACAGGAAAATCCAGAATTTGTAGGCTGAGTGGTGTTTGGGACAGTTGTATTAGGC TGGCGTTGGACAATTGCTCTCTGGGAAGGTGGCTGCTTATGGTCATTTATAGAGGTGGGG AGCATTTAGGGAGAGAGCGACCCTGAGAACAGTCACAGATTGGCTTTTTAAGAATCCTGG GAGAGTTGTCTTCATCTCCCTGTGCCCCCATAGTAAGCTTCCTTTGAAACTGACATGTTC AATGTTTGTTCTGCACAGTTCTTTATCAACAAGACTGAGATTGAGGACTTTCCCCGCTTT CCTCACCaGGGCTTGCTGTTGGATACATCTCGCCATTACCTGCCACTCTCTAGCATCCTG GACACTCTGGTAACCAGGCCTTAAGGCCTTCTTCACACTTAAGAGTTCTAGGGTGATGGA GCAACGGACAGACCAAGTTCCAAATTCTTAAAGAGTTAGAGAGGGAATGTATGGACTGGG TGTGGTGGCTCATGCCTGTAATCCCAACACTTTGGGAGGCCGAGGTGGGCGGATCACCTG AAGTCAGAAGTTCAAGGCCAGCCTGGCCAACATGGTGAAACTCTGTCTCTACTAAAAATA CAAAAATTAGCTGGGCATGGTGGTGCATGCTTGTAATCCCAGCTACCTGGGAGGCTGAGG CAGGAGAATCGCATGAACCCAGGAGGCAGAGGTTGCAGTGGGTGGAGATCACGCCACTGC ACTCCAGCCTGGGTGAAAGAGTGAGACGCTGTCTCAAAAAAAAAAAAAAAAATTGTATGT AATTCTATGAGCTCCTGGGAAAAATGTAGAAGATGAGCTGCTCCAAGACTCAAAAAATAA CAGAGTGACTTAAATCTACCTTACAGGCTACTGTAGATCAATGTTCAGGCTGTTTCCAGG GATACAAATGTTTAGGGGAATTGGCTTCATTGGCAGAGCTAACTATATTTGTTTTTGAGA CAGCGTCTCAATTTTTTTTTTTTTTTTTTGTATTTTTTGTAGAGCTGGGGTTTCGTCATG TTACCCAGGCTGGTCTTGAACTCCTGGGCTCAAGCAATCTGCCCACCTTGGCCTGCCAGA GTGGTAGAATTACAGGCATGAGTCACTACACCTGGCCGGCAGAGCTAACTTTAGTTAGAA CAAGGTCATAGGAGAGAGACGTTCAAAGCCTTAACTTGGGGCCAGGTGCAGTGGCTCACA CCTGTAATCCTAGCACTCTGGGAGGCCAAGGCGGGTGGATTGCCCGAGCTCAGGAGTTTG AGACTAACCTGGCCAAGACGGTGAAACCCCATCTCTACTGAAAATACAAAAAATTAGCCA GGCGCGATGGCGCAAACCTGTAGTCCCAGCTACTCAGGAGTCTGTGATGGGAGAATCACC TGAGCCTGGGGAGATCAAGGATGCATGAACTGTGATTGCACCACTGCACTCCAGCCTGGA 25080
7 Appendix B Primer design details from PrimerQuest
8 Appendix C Cutting patterns of HpaII for wild type and mutant HEXA WILD TYPE: MUTANT:
Using Single Nucleotide Polymorphism (SNP) to Predict Bitter Tasting Ability
Using Single Nucleotide Polymorphism (SNP) to Predict Bitter Tasting Ability Part II:! Digestion and Analysis of an Amplified Region of the Bitter Taste Receptor TAS2R38 Gene In The Last Lab:! You sampled
More informationPositive control kit for enzymatic mismatch cleavage and agarose gel visualization (version 2.4)
28 January, 2010 Positive control kit for enzymatic mismatch cleavage and agarose gel visualization (version 2.4) Plant Breeding Unit Brad Till and Owen Huynh January, 2010 Kit Contents: Genomic DNA from
More informationChapter 11 Complex Inheritance and Human Heredity
Chapter 11 Complex Inheritance and Human Heredity 11.1 Basic Patterns of Human Inheritance o The inheritance of a trait over can be shown in a o Pedigrees can help us to track and understand Genetic Disorders
More informationActivity 4.3.2: Hypercholesterolemia
Activity 4.3.2: Hypercholesterolemia Introduction In the previous activity, you learned that Anna Garcia has abnormally high cholesterol levels. Because of this result, Anna was sent back to the lab for
More informationMRC-Holland MLPA. Description version 10; 16 March 2017
SALSA MLPA probemix P199-B2 HEXA Lot B2-0115. As compared to version B1 (lot B1-0410), two reference probes have been replaced and the control fragments have been adjusted (QDX2). Tay-Sachs disease is
More informationAmplifying the ALU intron for Hardy- Weinberg Analysis Part 1
Bio 212 Lab Name: Amplifying the ALU intron for Hardy- Weinberg Analysis Part 1 OBJECTIVES: Review the following terms and concepts presented in Biology 211: enzymes, DNA structure and replication, role
More informationQuick Guide. Lesson 1 Cheek Cell DNA Template Preparation
Quick Guide Lesson 1 Cheek Cell DNA Template Preparation 1. Label one 1.5 ml micro test tube with your initials. Label one screwcap tube containing 200 µl of InstaGene matrix with your initials. 2. Obtain
More informationExplain why the scientists used the same restriction endonuclease enzymes on each DNA sample
Q1.Some populations of flies are becoming resistant to insecticides intended to kill them. Scientists developed a method for finding out whether a fly was carrying a recessive allele, r, that gives resistance
More informationLab #4 Polymerase Chain Reaction
BE60, 011 Lab #4 Polymerase Chain Reaction In this laboratory work you will perform an allelespecific PCR. Allelic variants mean that the two genes (two alleles) are present in one DNA sample. These alleles
More informationLab 5: Shark Attacks, Again! DNA Fingerprinting to the Rescue
Lab 5: Shark Attacks, Again! DNA Fingerprinting to the Rescue Notebook Lab Objectives Develop an understanding of the basic techniques used to study genetic polymorphisms encoded in DNA Gain familiarity
More informationCYP 2C19 Genotyping Reagents
CONTENTS Introduction 4 Overview of Mutector TM Assay 5 Materials Provided 6 Materials Required 7 CYP 2C19 Genotyping Reagents Equipment Required 7 DNA Sample Preparation 8 Sequencer Setup 8 Thermal Cycling
More informationPuro. Knockout Detection (KOD) Kit
Puro Knockout Detection (KOD) Kit Cat. No. CC-03 18 Oct. 2016 Contents I. Kit Contents and Storage II. Product Overview III. Methods Experimental Outline Genomic DNA Preparation Obtain Hybrid DNA Digest
More informationBiotechnology. Explorer Program. Serious About Science Education 5/17/09 1
Biotechnology Explorer Program Serious About Science Education 5/17/09 1 Chromosome 8: PCR TM PCR Workshop Kirk Brown,, Tracy High School; Tracy, Ca Stan Hitomi,, Monte Vista High School; Danville, CA
More informationFMF NIRCA PROTOCOL STEP 1.
FMF NIRCA PROTOCOL STEP 1. After you have isolated patient s DNA and DNA from a healthy donor (wild type), you perform a nested PCR. The primers used to amplify exon 2 and exon 10 of the mefv gene are
More informationNRAS Codon 61 Mutation Analysis Reagents
NRAS Codon 61 Mutation Analysis Reagents User Manual V1.0 Cat No. GP19 32 reactions 1 CONTENTS Introduction 4 Overview of Mutector TM Assay 5 Materials Provided 6 Materials Required 7 Equipment Required
More informationGen e e n t e i t c c V a V ri r abi b li l ty Biolo l gy g Lec e tur u e e 9 : 9 Gen e et e ic I n I her e itan a ce
Genetic Variability Biology 102 Lecture 9: Genetic Inheritance Asexual reproduction = daughter cells genetically identical to parent (clones) Sexual reproduction = offspring are genetic hybrids Tendency
More information3. How can you test a food to find out if it contains materials derived from a GMO?
GMO Investigator LAB Name Introduction With the world population exploding and farmable land disappearing, agricultural specialists are concerned about the world's ability to produce enough food to feed
More informationDIRECTION FOR USE. Art. No / /25 reactions in vitro Diagnosticum for birds
DIRECTION FOR USE Art. No. 31066 / 31067 100 /25 reactions in vitro Diagnosticum for birds Kylt Turkey Hemorrhagic Enteritis Virus PCR Detection Kit is for detection of the etiological agent of Infectious
More informationAh, Lou! There really are differences between us!
Name Per Ah, Lou! There really are differences between us! Introduction The human genome (the total sum of our genetic makeup) is made up of approximately 6 billion base pairs distributed on 46 chromosomes.
More informationProposal form for the evaluation of a genetic test for NHS Service Gene Dossier
Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier Test Disease Population Triad Disease name OMIM number for disease 268800 Disease alternative names Please provide any alternative
More informationPractical 4: PCR in Molecular Diagnosis
PRINCIPLES What is PCR Practical 4: PCR in Molecular Diagnosis Instructors: Dr. Valerie C.L. Lin and Dr. Sze Chun Chau PCR stands for polymerase chain reaction. The PCR method was devised and named by
More informationNRAS Mutation Analysis Reagents (Codons 12 and 13)
NRAS Mutation Analysis Reagents (Codons 12 and 13) User Manual V1.1 Cat No. GP18 32 reactions 1 CONTENTS Introduction 4 Overview of Mutector TM Assay 5 Materials Provided 6 Materials Required 7 Equipment
More informationHuman Genetic Diseases non mutation
Page 1 of 10 Human Genetic Diseases non mutation These are diseases that normally occur because of gene inheritance rather than mutations. 1. Autosomal Recessive Inheritance This is the inheritance of
More informationData Sheet Quick PCR Cloning Kit
Data Sheet Quick PCR Cloning Kit 6044 Cornerstone Ct. West, Ste. E DESCRIPTION: The Quick PCR Cloning Kit is a simple and highly efficient method to insert any gene or DNA fragment into a vector, without
More informationPCR Amplification of The Human Dimorphic Alu PV92 Site 3/17 Honors Biomedical Science 2 Redwood High School Name: [ETRLMBR]
PCR Amplification of The Human Dimorphic Alu PV92 Site 3/17 Honors Biomedical Science 2 Redwood High School Name: [ETRLMBR] Background T he human genome (the total sum of our genetic makeup) is made up
More informationNxGen phi29 DNA Polymerase
NxGen phi29 DNA Polymerase Please read carefully and thoroughly before beginning FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE. Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll
More informationFACTOR V of LEIDEN REAL TIME
When you have completed this, the graph will show all of the wells identified as shown in the legend. Homozygous WT Negative Heterozygous Homozygous MUT FACTOR V of LEIDEN REAL TIME REF. 05960127 Opening
More informationCombining Techniques to Answer Molecular Questions
Combining Techniques to Answer Molecular Questions UNIT FM02 How to cite this article: Curr. Protoc. Essential Lab. Tech. 9:FM02.1-FM02.5. doi: 10.1002/9780470089941.etfm02s9 INTRODUCTION This manual is
More informationCSS451 Spring 2010 Polymerase Chain Reaction Laboratory
CSS451 Spring 2010 Polymerase Chain Reaction Laboratory The purpose of the polymerase chain reaction (PCR) is to amplify specific segments of DNA. If one knows the DNA sequence of regions of DNA that flank
More informationGenetics module. DNA Structure, Replication. The Genetic Code; Transcription and Translation. Principles of Heredity; Gene Mapping
Genetics module Lectures DNA Structure, Replication The Genetic Code; Transcription and Translation Principles of Heredity; Gene Mapping Controlling Gene Expression Mutation and Cancer Textbook: Introduction
More informationCALR Mutation Analysis Reagents
CALR Mutation Analysis Reagents User Manual V1.0 Cat No. GP20 32 reactions 1 CONTENTS Introduction 4 Materials Provided 4 Materials Required 5 Equipment Required 5 DNA Sample Preparation 6 Sequencer Setup
More informationIntroduction. Background Information. WORKSHOP: Transforming Your Classroom into a Neuroscience Laboratory. Visit our website at
Introduction The brain is an incredibly important and complex organ. It is responsible for everything your body does, from eating and breathing to playing soccer and learning the violin. When something
More informationSuperTCRExpress TM Human TCR Vβ Repertoire CDR3 Diversity Determination (Spectratyping) and Quantitative Analysis Kit
SuperTCRExpress TM Human TCR Vβ Repertoire CDR3 Diversity Determination (Spectratyping) and Quantitative Analysis Kit Cat. No. H0521 Size: 2 sets (22 Vβ families/each, with enzymes) H0522 Size: 4 sets
More informationMutations. What is a mutation? a mutation is a change in the sequence of bases in DNA mutations may result in the production of defective proteins
Mutations What is a mutation? a mutation is a change in the sequence of bases in DNA mutations may result in the production of defective proteins Mutations What environmental factors may cause mutations
More informationFamily Secrets Genetic Testing PowerPoint Script
Family Secrets Genetic Testing PowerPoint Script *Notes on use: Each bulleted portion goes with a mouse click advance on the PowerPoint. Sometimes, the mouse click advances a slide, and sometimes the mouse
More informationFor in vitro Veterinary Diagnostics only. PCR Detection Kit for Salmonella Gallinarum, Pullorum (separate detection) & DIVA 9R.
For in vitro Veterinary Diagnostics only. PCR Detection Kit for Salmonella Gallinarum, Pullorum (separate detection) & DIVA 9R www.kylt.eu DIRECTION FOR USE Art. No. 31420 / 31421 Kylt SGP & 9R DIVA PCR
More informationLaboratory Exercise 4. Multiplex PCR of Short Tandem Repeats and Vertical Polyacrylamide Gel Electrophoresis.
Laboratory Exercise 4 4 Multiplex PCR of Short Tandem Repeats and Vertical Polyacrylamide Gel Electrophoresis B A C K G R O U N D The human genome contains over 3000 million base pairs, which are distributed
More informationSupplementary Methods
Supplementary Methods SMAP Assay Detailed Protocol I. Technology Description SMAP is a novel gene amplification method with high sensitivity and single-nucleotide precision, enabling rapid detection of
More informationAbsolute Human Telomere Length and Mitochondrial DNA Copy Number Dual Quantification qpcr Assay Kit (AHDQ) Catalog # reactions
Absolute Human Telomere Length and Mitochondrial DNA Copy Number Dual Quantification qpcr Assay Kit (AHDQ) Catalog #8958 100 reactions Product Description Telomeres are repetitive nucleotide elements at
More informationGenetics Test. Multiple Choice Identify the choice that best completes the statement or answers the question.
Genetics Test Multiple Choice Identify the choice that best completes the statement or answers the question. 41. Situations in which one allele for a gene is not completely dominant over another allele
More informationGenetic Diagnosis. electrophoresis. During the lab, genetic testing was done for the cystic fibrosis gene in a young
Meyers 1 Keya Meyers Genetic Diagnosis Abstract: In this lab two processes were observed: restriction fragment polymorphism and gel electrophoresis. During the lab, genetic testing was done for the cystic
More informationSuperiorScript III cdna Synthesis Kit Instruction Manual
SuperiorScript III cdna Synthesis Kit Instruction Manual Cat.# EZ405S, EZ405M SuperiorScript III cdna Synthesis Kit Table of Contents I. Description... 3 II. Kit... 4 III. Procedure... 5 IV. Control Experiment
More informationCystic Fibrosis. Gary Hoffman Wisconsin Newborn Screening Laboratory WISCONSIN STATE LABORATORY OF HYGIENE
Cystic Fibrosis Gary Hoffman Wisconsin Newborn Screening Laboratory Cystic Fibrosis Review Most common lethal genetic autosomal recessive disorder Caucasians 1:3,000 African Americans 1:20,000 Hispanics
More informationFLT3 Conventional PCR Detection Kit ONKOTEST K
FLT3 Conventional PCR Detection Kit ONKOTEST K3030-20 Product Information FLT3 (fms-related tyrosine kinase 3) gene frequently mutated in acute myeloid leukemia (AML) is associated with disease pathogenesis.
More informationHuman DNA Alu Amplification by Polymerase Chain Reaction (PCR)* Laboratory Procedure
Human DNA Alu Amplification by Polymerase Chain Reaction (PCR)* Laboratory Procedure *Polymerase Chain Reaction is covered by patents owned by Hoffmann-La Roche, Inc. This experiment was adapted from Laboratory
More informationFor in vitro Veterinary Diagnostics only. PCR Detection Kit for Fowl Adenovirus.
For in vitro Veterinary Diagnostics only. PCR Detection Kit for Fowl Adenovirus www.kylt.eu DIRECTION FOR USE Art. No. 31144 / 31145 Kylt Fowl Adenovirus PCR Detection Kit for Fowl Adenovirus 100 /25 reactions
More informationAP Biology Chapter 14 Notes Mendel and the Gene Idea
AP Biology Chapter 14 Notes Mendel and the Gene Idea I. Chapter 14.1: Mendel used the scientific approach to identify two laws of inheritance. II. Chapter 14.2: The Laws of Probability Govern Mendelian
More informationAbsolute Mouse Telomere Length Quantification qpcr Assay Kit (AMTLQ) Catalog #M reactions
Absolute Mouse Telomere Length Quantification qpcr Assay Kit (AMTLQ) Catalog #M8918 100 reactions Product Description Telomeres are repetitive nucleotide elements at the ends of chromosomes that protect
More informationDNA amplification and analysis: minipcr TM Food Safety Lab
Science for everyone, everywhere DNA amplification and analysis: minipcr TM Food Safety Lab Release date: 09 September 2014 Welcome Our goals for today: Review DNA amplification theory Solve a public health
More informationMultiplex PCR Assay Kit Ver.2
Cat. # RR062A For Research Use Multiplex PCR Assay Kit Ver.2 Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. Precautions... 3 V. Designing Primers for Multiplex
More information6th Form Open Day 15th July 2015
6th Form Open Day 15 th July 2015 DNA is like a computer program but far, far more advanced than any software ever created. Bill Gates Welcome to the Open Day event at the Institute of Genetic Medicine
More informationGenomic Sequencing. Genomic Sequencing. Maj Gen (R) Suhaib Ahmed, HI (M)
Maj Gen (R) Suhaib Ahmed, HI (M) The process of determining the sequence of an unknown DNA is called sequencing. There are many approaches for DNA sequencing. In the last couple of decades automated Sanger
More informationAntibiotic-Resistant Bacteria
Antibiotic-Resistant Bacteria You may be familiar with the antibiotics that are prescribed to you by your doctor to help you overcome a bacterial infection. While some antibiotics are synthesized in the
More informationHop Latent Viroid (HLVd) End-Point RT-PCR Kit Product# EP38700
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Hop Latent Viroid (HLVd) End-Point RT-PCR Kit Product# EP38700
More informationminipcr TM Genes in Space Food Safety Lab: Mars Colony at Risk!
minipcr TM Genes in Space Food Safety Lab: Mars Colony at Risk! An E. coli outbreak affects astronaut food aboard the International Space Station. DNA samples from two food racks are analyzed to determine
More informationRelative Mouse Telomere Length Quantification qpcr Assay Kit (RMTLQ) Catalog #M reactions
Relative Mouse Telomere Length Quantification qpcr Assay Kit (RMTLQ) Catalog #M8908 100 reactions Product Description Telomeres are repetitive nucleotide elements at the ends of chromosomes that protect
More informationPositive control kit for enzymatic mismatch cleavage using LI- COR and agarose gel visualization (version 2.5)
29 January, 2010 Positive control kit for enzymatic mismatch cleavage using LI- COR and agarose gel visualization (version 2.5) Plant Breeding Unit Brad Till and Owen Huynh January, 2010 Kit Contents:
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More informationFor in vitro Veterinary Diagnostics only. DNA Extraction and PCR Detection Kit for Pasteurella multocida.
For in vitro Veterinary Diagnostics only. DNA Extraction and PCR Detection Kit for Pasteurella multocida www.kylt.eu DIRECTION FOR USE Art. No. 31058 / 31059 Kylt Pasteurella multocida DNA Extraction and
More informationSi mon P t e ersen J ones
Simon Petersen Jones What is a DNA based Test Uses sample of DNA Blood Cheek Swab Identifies the genotype (not phenotype) of the animal There are Two Categories of Test: Mutation Detection Direct detection
More informationPCR Detection of Genetically Modified (GM) Foods Protocol
PCR Detection of Genetically Modified (GM) Foods Protocol Purpose Isolate DNA from corn-based food so that the Polymerase Chain Reaction can be used to determine whether the selected foods have been genetically
More informationAbsolute Human Telomere Length Quantification qpcr Assay Kit (AHTLQ) Catalog # reactions
Absolute Human Telomere Length Quantification qpcr Assay Kit (AHTLQ) Catalog #8918 100 reactions Product Description Telomeres are repetitive nucleotide elements at the ends of chromosomes that protect
More information1a. What is the ratio of feathered to unfeathered shanks in the offspring of the above cross?
1. Whether or not the shanks of chickens contains feathers is due to two independently assorting genes. Individuals have unfeathered shanks when they are homozygous for recessive genes at two loci; the
More informationQUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 2007)
QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 007) Please contact Center for Plant Genomics (CPG) facility manager Hailing Jin (hljin@iastate.edu) regarding questions or corrections.
More informationOverview. Background ~30 min. Lab activity ~50 min. DNA profiling Polymerase Chain Reaction (PCR) Gel Electrophoresis PCR
Overview Day 1: Tuesday Introduction to DNA profiling How do we use DNA to solve crimes? Background Polymerase Chain Reaction (PCR) Gel Electrophoresis Set up PCR Day 2: Wednesday Make and Run Agarose
More informationTelomerase Activity Quantification qpcr Assay Kit (TAQ) Catalog # reactions
Telomerase Activity Quantification qpcr Assay Kit (TAQ) Catalog #8928 100 reactions Product Description Telomeres are repetitive nucleotide elements at the ends of chromosomes that protect chromosomes
More informationProtocol for amplification of measles sequencing window (N-450)
Annex 7.1 Protocol for amplification of measles sequencing window (N-450) NOTE: This document is intended to provide basic test method details and is not an SOP. Laboratories need to develop their own
More informationGeneral Product Insert. End-Point PCR/RT-PCR Kit Product# EPxxxxx
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com End-Point PCR/RT-PCR Kit Product# EPxxxxx General Product Insert
More informationPage 1 of 10 MIDTERM EXAM OF BIO
Page 1 of 10 MIDTRM XAM OF IO3151 2017 Name: Student number: Part I: Calculations 1 2 3 4 NaCl: Water: 5 6 7 Volume of NaCl: 8 Plasmid A: Amount of 1 Kb insert: Part II: ioinformatics 1 2 3 Forward: Reverse:
More informationHBV Quantitative & YMDD Mutation Real Time PCR Kit
Revision No.: ZJ0002 Issue Date: Aug 7 th, 2008 HBV Quantitative & YMDD Mutation Real Time PCR Kit Cat. No.: HD-0003-01 For Use with LightCycler 1.0/LightCycler2.0/LightCycler480 (Roche) Real Time PCR
More informationFunctional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update
Functional Genomics Research Stream Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Updates Alternate Lab Meeting Fridays 11:30-1:00 WEL 4.224 Welcome to attend either one Lab Log thanks
More informationHy-Fy High Fidelity Mix (x2)
Hy-Fy High Fidelity Mix (x2) #EZ-2021 1ml, 100rxn of 20μl Contents: 2X High Fidelity Mix 1ml Nuclease-free water 1ml Store at -20 C Shelf life: 2 years Description Hy-Fy High Fidelity Mix (x2) is a premixed,
More informationHCV Genotype Primer Kit
Instruction Manual for HCV Genotype Primer Kit HCV Genotype Determination Kit for Research Purpose Thoroughly read this instruction manual before use of this kit Background Study of nucleotide sequence
More informationSOP: SYBR Green-based real-time RT-PCR
SOP: SYBR Green-based real-time RT-PCR By Richard Yu Research fellow Centre for Marine Environmental Research and Innovative Technology (MERIT) Department of Biology and Chemistry City University of Hong
More informationRelative Rat Telomere Length Quantification qpcr Assay Kit (RRTLQ) Catalog #R reactions
Relative Rat Telomere Length Quantification qpcr Assay Kit (RRTLQ) Catalog #R8908 100 reactions Product Description Telomeres are repetitive nucleotide elements at the ends of chromosomes that protect
More informationHiPer Random Amplification of Polymorphic DNA (RAPD) Teaching Kit
HiPer Random Amplification of Polymorphic DNA (RAPD) Teaching Kit Product Code: HTBM031 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 3.5 hours Agarose Gel Electrophoresis:
More informationUses: The Methylamp MS-qPCR Fast Kit is very suitable for quantitative methylation-specific PCR in a fast format using very minute amounts of DNA.
Methylamp MS-qPCR Fast Kit Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE Uses: The Methylamp MS-qPCR Fast Kit is very suitable for quantitative methylation-specific PCR in a fast format
More informationHuman Genomics. 1 P a g e
Human Genomics What were the aims of the human genome project? To identify all the approximately 20,000-25,000 genes in Human DNA. To find where each gene is located To determine the sequences of the 3
More informationTexas A&M University-Corpus Christi CHEM4402 Biochemistry II Laboratory Laboratory 4 - Polymerase Chain Reaction (PCR)
Texas A&M University-Corpus Christi CHEM4402 Biochemistry II Laboratory Laboratory 4 - Polymerase Chain Reaction (PCR) Progressing with the sequence of experiments, we are now ready to amplify the green
More informationHBV Quantitative & YMDD Mutation Real Time PCR Kit
Revision No.: ZJ0002 Issue Date: Aug 7 th, 2008 HBV Quantitative & YMDD Mutation Real Time PCR Kit Cat. No.: HD-0003-02 For Use with LightCycler2.0/LightCycler480 (Roche) Real Time PCR Systems For In Vitro
More informationLesson 3 Gel Electrophoresis of Amplified PCR Samples and Staining of Agarose Gels
Lesson 3 Gel Electrophoresis of Amplified PCR Samples and Staining of Agarose Gels What Are You Looking At? Before you analyze your PCR products, let s take a look at the target sequence being explored.
More information3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: (905) Fax: (905)
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com E.coli O157:H7 End-Point PCR Kit Product# EP41300 Product Insert
More informationMycobacterium tuberculosis End-Point PCR Kit Product# EP42100
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Mycobacterium tuberculosis End-Point PCR Kit Product# EP42100
More informationHiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
More informationMRC-Holland MLPA. Description version 07; 11 AUG 2015
mix P347-A2 Hemochromatosis Lot A2-0213. As compared to version A1 (lot A1-1109), four reference s have been replaced and the control fragments have been adjusted (QDX2). Hereditary hemochromatosis (HH)
More informationMCB 102 University of California, Berkeley August 11 13, Problem Set 8
MCB 102 University of California, Berkeley August 11 13, 2009 Isabelle Philipp Handout Problem Set 8 The answer key will be posted by Tuesday August 11. Try to solve the problem sets always first without
More informationFunctional Genomics Research Stream. Research Meeting: November 8, 2011 cdna Library Construction for RNA-Seq
Functional Genomics Research Stream Research Meeting: November 8, 2011 cdna Library Construction for RNA-Seq Lab Issues Don t leave out boxes of water + ethidium bromide Minimize tip boxes in phenol waste
More informationHELINI Hepatitis B virus [HBV] Real-time PCR Kit (Genotype A to H)
HELINI Hepatitis B virus [HBV] Real-time PCR Kit (Genotype A to H) Quantitative In vitro diagnostics Instruction manual Cat. No: 8001-25/50/100 tests Compatible with: Agilent, Bio-Rad, Applied Bio systems
More informationNEXTFLEX 16S V4 Amplicon-Seq Kit (For Illumina Platforms) Catalog #NOVA (Kit contains 8 reactions) Bioo Scientific Corp V18.
NEXTFLEX 16S V4 Amplicon-Seq Kit 2.0-4 (For Illumina Platforms) Catalog #NOVA-4203-01 (Kit contains 8 reactions) Bioo Scientific Corp. 2018 V18.07 This product is for research use only. Not for use in
More informationi. This type of DNA damage will result in (circle all correct answers) b. a transversion mutation
Biol 321 Winter 2010 Quiz 5 40 points NAME ANSWERS IN RED COMMENTS IN BLUE 1. (2 pts.) Recall the article entitled: Human Genetic Variation By each statement circle True/False/Not addressed in the paper.
More informationminipcr Forensics Lab: Analysis of the D1S80 VNTR
minipcr Forensics Lab: Analysis of the D1S80 VNTR Student s Guide Contents 1. Scenario overview p 2 2. Laboratory guide p 15 3. Study questions p 22 1 m i n i P C R L e a r n i n g L a b s - H u m a n
More informationDNA & DNA Replication
DNA & DNA Replication DNA Structure How did Watson and Crick contribute to our understanding of genetics? Watson and Crick developed the double helix model for DNA DNA Structure What is a double helix?
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationPTC PCR II: Restriction Enzymes & Gel Electrophoresis
PTC PCR II: Restriction Enzymes & Gel Electrophoresis Objective To apply what we ve learned about genetics, molecular biology, and recombinant DNA to a specific human genetic trait. Background Mammals
More informationHigh-Resolution Melting analysis as a tool for rapid and sensitive detection of genotypes in cattle population
Research and Development Station for Bovine, Arad, Romania High-Resolution Melting analysis as a tool for rapid and sensitive detection of genotypes in cattle population Daniela Elena Ilie, Ada Cean, Ioan
More informationMitochondrion DNA site Mutation Real Time PCR Kit
Revision No.: ZJ0003 Issue Date: Aug 7 th, 2008 Mitochondrion DNA site 11778 Mutation Real Time PCR Kit Cat. No.: GD-0027-01 For use with LightCycler2.0/ LightCycler480 (Roche) real time PCR systems. For
More informationBio 121 LAB 11 INSTRUCTIONS - DNA II
Bio 121 LAB 11 INSTRUCTIONS - DNA II In the first part of today's lab we will demonstrate that the DNA which we extracted last week can create heritable changes in the phenotype of bacterial cells. We
More informationA PCR Assay for the Anthocyaninless Mutation in Fast Plants and a Bridge Between Classical Genetics and Genomics
Tested Studies for Laboratory Teaching Proceedings of the Association for Biology Laboratory Education Volume 39, Article 61, 2018 A PCR Assay for the Anthocyaninless Mutation in Fast Plants and a Bridge
More informationGenetics BOE approved April 15, 2010
Genetics BOE approved April 15, 2010 Learner Objective: Cells go through a natural progression of events to produce new cells. A. Cellular organelles work together to perform a specific function. B. The
More informationHiPer Real-Time PCR Teaching Kit
HiPer Real-Time PCR Teaching Kit Product Code: HTBM032 Number of experiments that can be performed: 10 Duration of Experiment Protocol: 1.5 hours Storage Instructions: The kit is stable for 12 months from
More information