Laboratory Exercise 4. Multiplex PCR of Short Tandem Repeats and Vertical Polyacrylamide Gel Electrophoresis.
|
|
- Noel Bond
- 6 years ago
- Views:
Transcription
1 Laboratory Exercise 4 4 Multiplex PCR of Short Tandem Repeats and Vertical Polyacrylamide Gel Electrophoresis B A C K G R O U N D The human genome contains over 3000 million base pairs, which are distributed among 23 pairs of chromosomes Only about 90 million base pairs of the human genome (about 3%) are actually genes The rest of the genome consists of non-coding sequences such as Long Interspersed repeats (LINEs), like the old retrovirus that codes for reverse transcriptase in Alu, SINEs (like Alu itself), STRs (Short Tandem Repeats) also called microsatellites, and VNTRs (Variable Number of Tandem Repeats) also known as minisatellites Indeed, in Chapter 1, we discussed the estimation that over 10% of our DNA is composed simply of Alu SINE inserts Figure 1 Amplification of VNTRs and STRs from mother and father using PCR Boxes indicate repeat number Comparing human genomes, the similarities are striking; less than 01 % (about 3 million bases) differs from one person to the other These variable differences tend to be concentrated in "variable regions" Forensic scientists use these variable regions as genetic markers to generate a DNA profile (a genetic bar code) of an individual, using samples from blood, bones, hair, or any other body tissues or products that contain inteact cells with DNA The two main types of human genomic DNA sequences that are used in the applications for DNA profiling are minisatellite DNA and microsatellite DNA Minisatellites have core repeats with 9-80 bp, while microsatellites contains 2-5 bp repeats These sequences are widespread throughout the human genome and show sufficient variability (polymorphism) among individuals in a population due to differences in the number of the core repeats Variable Number of Tandem Repeats (VNTR) DNA profiling uses the variability in the number of tandemly repeated copies in minisatellites, while Short Tandem Repeats (STR) DNA profiling uses microsatellites The DNA forensic community has moved toward the use of STRs for its greater fidelity Click Here Figure 2 Dolan DNA interactive website DNA fingerprinting flash animation
2 and reproducibility STRs are amplified using polymerase chain reaction using a set of primers that flank the STR loci The gels will reflect the number of repeats in the two chromosomes As both chromosomes originate from different parents, two different lengths of product may result from one set of primers (Figure 1) You can see an example of how this works at: At the bottom left, click on human identification, then on the top left, click on profiling You should get a screen like Figure 2 Click on the circle with the two peaks in it and it should take you to a modern DNA fingerprinting flash animation As a 2-5 bp difference in length should be distinguished, we utilize polyacrylamide (rather than agarose) gels for separation of the PCR products, just as we did in sequencing A genetic profile Figure 3 FBI CODIS "bar code" that reflects the genomic variability of an individual can be examined using multiple STRs The Federal Bureau of Investigations (FBI) adopted the use of 13 loci to constitute the core of the United States CODIS (Combined DNA Index System) database (Figure 3) In addition to the nuclear DNA (nudna), the cell contains mitochondria (mtdna) Forensic scientists typically turn to mtdna STR analysis to determine possible maternal relationships, or if there is only a limited amount of specimen available This is because in humans, all mitochondria are inherited from the mother and there are hundreds of them in each cell Refer to Appendix I for an example on DNA profile probability calculations In this experiment, you use your own DNA from the sample of cheek cells you collected by saline mouthwash in lab 1 A PCR reaction is then performed on the DNA using multiple primers (multiplex PCR) to amplify four separate STRs on different chromosomes simultaneously The lengths of the PCR products are then analyzed on a polyacrylamide gel A DNA size marker is included as a size reference Figure 4 Automated Genotype generated by using fluorescent primers on an ABI 377 automated DNA sequencer The Profiler plus ladder is very similar to the 100kb ladder we use in experiment 1 Norma is homozygous with 15 repeats for D and heterozygous for the vwa locus with 14 and 16 repeats and heterozygous for the FGA locus with 24 and 25 repeats The resolving power of polyacrylamide gels is larger than of agarose gels, and they can reliably separate DNA molecules whose
3 lengths differ by 1% The 10% polyacrylamide gel used in this experiment allows separation of fragments that differ by 3-4 bases Polyacrylamide gels are much thinner than agarose gels (to improve resolution) and are poured in between two glass plates to avoid differences in thickness The FBI uses sophisticated DNA automated profiler machines that can determine the genotype of an individual in a matter of a few hours (Figure 4) Refer to Table 1 and Table 2 for information on the loci that will be amplified in this experiment Table 1 Locus Chromosome Repeat Structure Repeat # Genbank accession number D7S820 7 GATA 5-15 G08616 CSF1PO 5 AGAT 6-16 X1420 Y-GATA- H4 Y (TAGAATGGATAGATT A (GATG)pAA(TAGA)q HUMTH01 11 TCAT 3-14 D00269 Human genome database * G42676 AC * Repeat numbers are not clearly defined Table 2 Locus Forward primer Reverse primer D7S820 5'GTCATAGTTTAGAACGAACTAACG3' 5'CTGAGGTATCAAAAACTCAGAGG3' CSF1PO 5'CTGAGTCTGCCAAGGACTAGC3' 5'CACACACCACTGGCCATCTTC3' Y-GATA-H4 5'CCTAAGCAGAGATGTTGGTTTTC3' 5'CTGATGGTGAAGTAATGGAATTAG3' HUMTH01 5'GTGGGCTGAAAAGCTCCCGAT3' 5'CAAAGGGTATCTGGGCTCTGG3' Materials 10% Chelex P20, P200, P1000 and tips 09% NaCl 15 ml culture tubes PCR mix Mineral oil Disposable gloves Paper cup ddh 2 O 100 C water bath Ice 15 ml tubes 05 ml PCR tubes Boiling water bath DNA thermal cycler Forceps Procedure Note: if you already have ample DNA from experiment number 1, you can skip the DNA isolation protocol and go straight to PCR
4 DNA Isolation from Cheek Cells PCR Collecting cheek cells 1 Label a 15 ml culture tube containing saline solution with your name Pour all the solution into your mouth and save the empty tube Vigorously swish the saline solution in your mouth for 10 seconds 2 Release the saline solution from your mouth into a paper cup, then carefully transfer into the labeled 15 ml culture tube 3 Place the cap on the culture tube, and pellet the cells by centrifuging in a balanced clinical centrifuge for 10 minutes at maximum speed 4 Carefully discard the supernatant (you may want to pipet 15 times with a P1000 if you feel the pellet is loose) making sure not to disturb the pellet, and then place the tube on ice Binding metal ions that inhibit PCR 1 Add 500 µl of 10% Chelex (a chelating resin) to the cell pellet, and resuspend the cell pellet by pipetting in and out several times Complete resuspension is essential for obtaining a good yield of DNA and for a successful PCR 2 Transfer the well-suspended cells into a 15 ml microcentrifuge tube Cell lysis 1 Incubate the cells in a boiling water bath for 10 minutes 2 Cool the tube containing the mixture by incubating it on ice for 1 minute 3 Centrifuge the sample in a microcentrifuge for 30 seconds to pellet the Chelex beads 4 Transfer 200 µl of the supernatant into a fresh microcentrifuge tube, being careful not to transfer any Chelex beads, and label it with your name 1 (Prepared by TAs) The PCR mixture contains the following: Forward and reverse primers for 4 different loci 20 pmoles/µl (see Table 2) 8 µl ddh 2 O 305 µl Taq polymerase 250 units/µl 05 µl dntp 10 mm (each nucleotide) 10 µl 10X PCR buffer (500 mm KCl; 100 mm Tris-HCl (ph 83); 15 mm MgCl 2 ) 50 µl 2 Label a microcentrifuge tube, which contains the PCR mix, with your name 3 Add 5 µl of the DNA that was extracted from the cheek cells to the PCR mixture 4 Mix the sample by pipetting the total volume in and out a couple of times 5 Place the sample in the PCR machine that was set to the following parameters: 1 94 C for 3 minutes 2 94 C for 1 minute 3 58 C for 1 minute 4 72 C for 1 minute 5 Repeat steps times 6 4 C hold
5 Prelab Questions 1 What is the purpose of Chelex resin? 2 What are the possibilities regarding the number of bands that can be obtained from each locus? Explain 3 What are the criteria for selecting a collection of STRs for forensic DNA profiling? 4 Which method of DNA profiling (VNTR or STR) is of most use by forensic scientists? Why? 5 Compare nudna and mtdna, then compare their use in STR analysis Which type of DNA is most suited in STR analysis for identification of severely damaged victims (badly burned, for example)? Denaturing Vertical Polyacrylamide Gel Electrophoresis (PAGE) Materials 10% denaturing polyacrylamide gel (with 7 M urea) 10 µg/ml ethidium bromide staining solution Loading dye PCR product ddh 2 O 5x TBE buffer Disposable gloves 100 bp DNA marker 05 ml microcentrifuge tubes P20, P200 and tips 10% ammonium persulfate TEMED 5% formamide Method Loading polyacrylamide gel 1 A 10% polyacrylamide gel was prepared and poured by the TAs 2 Transfer the PCR product into a new labeled 05 ml microcentrifuge tube being careful not to transfer any mineral oil 3 Boil sample and immediately place on ice 4 Add 4 µl of 95% formamide to the PCR sample 5 Add 5 µl of loading dye to the PCR sample, and mix by pipetting the total volume in and out 6 Load sample on the polyacrylamide gel Record the well number of your sample since the gel will be shared with your classmates 7 Load 100 bp DNA marker 8 Electrophorese at 350 watts for about 3 hours 9 Turn off the power supply and remove the gel from the electrophoresis glass plates 10 Stain the gel in ethidium bromide solution for minutes 11 Rinse the gel in water and view under UV light 12 Photograph your gel Prelab Questions 1 What are the advantages of using a polyacrylamide gel over an agarose gel? Lab Report
6 1 Discuss the number and size of alleles for each of the STR loci examined Include your gel photograph 2 Compare your STR DNA profile to that of your classmate Appendix 1 Reagents for PAGE Gels Acrylamide 30% polyacrylamide-100 ml Bisacrylamide 29 g 1 g Bring volume up to 100 ml with ddh 2 O Heat in 37 C water bath to dissolve 10% ammonium persulfate- 10 ml Ammonium persulfate 1 g Bring volume up to 10 ml with ddh 2 O 5X TBE 1000 ml Tris base (MW 1214) 54 9 g Boric acid EDTA (05 M, ph 75) 272 g 20 ml 22% acrylamide- 50 ml 30% acrylamide 367 ml ddh 2 O 3 ml 3% ammonium persulfate 03 ml 5x TBE 10 ml TEMED 15 µl DNA Profile Frequency Calculations Genotype Probability at any STR Locus Part of the work of forensic DNA analysis is the creation of population databases for the STR loci studied Probability calculations are based on knowing allele frequencies for each STR locus for a representative human population (and showing Hardy-Weinberg equilibrium for the population by statistical tests) Allele frequency is defined as the number of copies of the allele in a population divided by the sum of all alleles in a population
7 For a heterozygous individual, if the two alleles have frequencies of p and q in a population, the probability (P) of an individual of having both alleles at a single locus is P = 2pq If an individual is homozygous for an allele with a frequency of p, the probability (P) of the genotype is P = p 2 We saw earlier (Figure 4) that Norma Liu is heterozygous for the FGA locus with 24 and 25 repeats Thus she has the genotype 24, 25 at the locus FGA In a reference database of 2000 US Asians (below), the frequency of the alleles 24 and 25 was 0162 and 0069, respectively The frequency of the 24, 25 genotype is therefore P = 2 (0162) (0069) = 0112, or 111% CFS Asian ProfilerPlus Allele Frequency Table Locus Allele Frequency Locus Allele Frequency Locus Allele Frequency FGA FGA FGA FGA FGA FGA FGA FGA FGA FGA FGA FGA FGA FGA FGA FGA FGA FGA FGA FGA FGA Probability for a DNA profile of Multiple Loci If databases of allele frequency for different loci can be shown to be independently inherited by appropriate statistical tests, the probability for the combined genotype can be determined by the multiplication (product rule) The probability (P) for a DNA profile is the product of the probability (P 1, P 2, P n ) for each individual locus, ie Profile Probability = (P 1 ) (P 2 ) (P n ) So for example, earlier we calculated the probability that Norma Liu would bet heterozygous for 24,25 at the FGAlocus at 0112 We can multiply that by her probability that she would be heterozygous 14, 16 for the vwa locus as well Locus Allele Frequency VWA
8 VWA VWA VWA Use the table above to calculate the probability for the vwa locus and then use the multiplication rule to determine the probability she would have the genotype at both loci As you can see, the probability can be an extremely low numbers when all 13 CODIS STR markers are included in the DNA profile Norma Liu calculated her own profile probability for all 13 CODIS at 13 times 10-16, or no more frequent than 1 in 77 quadrillion individuals (77 million billion), which is more than a million times the population of the planet
Biology 423L Nov. 6/7. Genetics in Forensic Science: Human DNA Fingerprinting Report due Nov. 21
1 Biology 423L Nov. 6/7 Genetics in Forensic Science: Human DNA Fingerprinting Report due Nov. 21 Readings: Hartwell et al. pp. 297-302, 374-387. Nakamura Y., Carlson, K. Krapco, and R. White 1988. Isolation
More informationPCR Laboratory Exercise
PCR Laboratory Exercise Advance Protocol (updated 1/2018) Introduction Detection of TPA-25 Alu by PCR A Human DNA Fingerprinting Lab Protocol 1994 Cold Spring Harbor Laboratory DNA Learning Center In this
More informationOverview. Background ~30 min. Lab activity ~50 min. DNA profiling Polymerase Chain Reaction (PCR) Gel Electrophoresis PCR
Overview Day 1: Tuesday Introduction to DNA profiling How do we use DNA to solve crimes? Background Polymerase Chain Reaction (PCR) Gel Electrophoresis Set up PCR Day 2: Wednesday Make and Run Agarose
More informationDNA FINGERPRINTING VIA THE PCR HUMAN Alu INSERTION POLYMORPHISM
1 DNA FINGERPRINTING VIA THE PCR HUMAN Alu INSERTION POLYMORPHISM Revised s10 Objectives Understand the technique of the PCR Extract, amplify, and analyze human DNA Observe genetic variation among individuals
More informationHuman DNA Alu Amplification by Polymerase Chain Reaction (PCR)* Laboratory Procedure
Human DNA Alu Amplification by Polymerase Chain Reaction (PCR)* Laboratory Procedure *Polymerase Chain Reaction is covered by patents owned by Hoffmann-La Roche, Inc. This experiment was adapted from Laboratory
More informationPCR Amplification of The Human Dimorphic Alu PV92 Site 3/17 Honors Biomedical Science 2 Redwood High School Name: [ETRLMBR]
PCR Amplification of The Human Dimorphic Alu PV92 Site 3/17 Honors Biomedical Science 2 Redwood High School Name: [ETRLMBR] Background T he human genome (the total sum of our genetic makeup) is made up
More informationAmplifying the ALU intron for Hardy- Weinberg Analysis Part 1
Bio 212 Lab Name: Amplifying the ALU intron for Hardy- Weinberg Analysis Part 1 OBJECTIVES: Review the following terms and concepts presented in Biology 211: enzymes, DNA structure and replication, role
More informationGenetic Identity. Steve Harris SPASH - Biotechnology
Genetic Identity Steve Harris SPASH - Biotechnology Comparison of Organisms ORGANISM GENES BASE PAIRS Lambda Phage 40 50,000 E.coli 400 5,000,000 Yeast 13,000 15,000,000 Human 20,000 3,000,000,000 (3 billion)
More informationAh, Lou! There really are differences between us!
Name Per Ah, Lou! There really are differences between us! Introduction The human genome (the total sum of our genetic makeup) is made up of approximately 6 billion base pairs distributed on 46 chromosomes.
More informationBio 121 LAB 11 INSTRUCTIONS - DNA II
Bio 121 LAB 11 INSTRUCTIONS - DNA II In the first part of today's lab we will demonstrate that the DNA which we extracted last week can create heritable changes in the phenotype of bacterial cells. We
More informationMutations during meiosis and germ line division lead to genetic variation between individuals
Mutations during meiosis and germ line division lead to genetic variation between individuals Types of mutations: point mutations indels (insertion/deletion) copy number variation structural rearrangements
More informationProduct Name : Simple mirna Detection Kit
Product Name : Simple mirna Detection Kit Code No. : DS700 This product is for research use only Kit Contents This kit provides sufficient reagents to perform 20 reactions for detecting microrna. Components
More informationReport of Analyzing Short Tandem Repeats for Parentage Testing
1 Alex Michael Tseng Department of Forensic Medicine, College of Medicine, National Taiwan University Report of Analyzing Short Tandem Repeats for Parentage Testing Introduction In the three billion letter
More informationCONCEPTS AND METHODS INSTRUCTOR PLANNING AND PREPARATION
CONCEPTS AND METHODS This laboratory can help students understand several important concepts of modern biology: The relationship between genotype and phenotype. The use of transposable elements to mutagenize
More informationBiology 445K Winter 2007 DNA Fingerprinting
Biology 445K Winter 2007 DNA Fingerprinting For Friday 3/9 lab: in your lab notebook write out (in bullet style NOT paragraph style) the steps for BOTH the check cell DNA prep and the hair follicle DNA
More informationShort Tandem Repeat (STR) Analysis
Maj Gen (R) Suhaib Ahmed, HI (M) Short tandem repeats (STR) are randomly distributed DNA sequences in which 2-6bp are tandemly repeated. These are scattered on all chromosomes including the autosomes as
More informationPCR Detection of Genetically Modified (GM) Foods Protocol
PCR Detection of Genetically Modified (GM) Foods Protocol Purpose Isolate DNA from corn-based food so that the Polymerase Chain Reaction can be used to determine whether the selected foods have been genetically
More informationShort Tandam Repeat (D1S58) Detection Kit (for Academic Instructions) Product # 54600
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Short Tandam Repeat (D1S58) Detection Kit (for Academic Instructions)
More informationCSS451 Spring 2010 Polymerase Chain Reaction Laboratory
CSS451 Spring 2010 Polymerase Chain Reaction Laboratory The purpose of the polymerase chain reaction (PCR) is to amplify specific segments of DNA. If one knows the DNA sequence of regions of DNA that flank
More informationAh, Lou! There really are differences between us!
Name Per Ah, Lou! There really are differences between us! Maria C. Abilock BABEC Frank H. Stephenson, Ph.D. Applied Biosystems We gratefully acknowledge David Micklos of the DNA Learning Center at Cold
More informationQuick Guide. Lesson 1 Cheek Cell DNA Template Preparation
Quick Guide Lesson 1 Cheek Cell DNA Template Preparation 1. Label one 1.5 ml micro test tube with your initials. Label one screwcap tube containing 200 µl of InstaGene matrix with your initials. 2. Obtain
More informationMicrosatellite markers
Microsatellite markers Review of repetitive sequences 25% 45% 8% 21% 13% 3% Mobile genetic elements: = dispersed repeat included: transposition: moving in the form of DNA by element coding for transposases.
More informationWhat is DNA? Deoxyribonucleic Acid The inherited genetic material that makes us what we are
DNA Basic Genetics What is DNA? DNA is Deoxyribonucleic Acid The inherited genetic material that makes us what we are DNA in the Cell Human Genome ~3 billion base pairs of DNA 30,000-35,000 genes Population-each
More informationSTUDY OF VNTR HUMAN POLYMORPHISMS BY PCR
STUDY OF VNTR HUMAN POLYMORPHISMS BY PCR Ref. PCR1 1. OBJECTIVE OF THE EXPERIMENT The objective of this experiment is to introduce students to the principles and practice of Polymerase Chain Reaction (PCR)
More information..C C C T C A T T C A T T C A T T C A T T C A..
Polymerase Chain Reaction Lab: a Forensic Application INTRODUCTION PCR (polymerase chain reaction) is a technique that scientists use to amplify particular segments of DNA. This process can produce large
More informationUnit 4-DNA Analysis Review Guide
Name: KEY Match the term on the right with the definition on the left. Unit 4-DNA Analysis Review Guide 1. A procedure used to determine the order of the base pairs that make up a DNA molecule E 2. These
More informationDNA Analysis Students will learn:
DNA Analysis Students will learn: That DNA is a long-chain polymer found in nucleated cells, which contain genetic information. That DNA can be used to identify or clear potential suspects in crimes. How
More informationminipcr Forensics Lab: Analysis of the D1S80 VNTR
minipcr Forensics Lab: Analysis of the D1S80 VNTR Student s Guide Contents 1. Scenario overview p 2 2. Laboratory guide p 15 3. Study questions p 22 1 m i n i P C R L e a r n i n g L a b s - H u m a n
More informationGenomic Sequencing. Genomic Sequencing. Maj Gen (R) Suhaib Ahmed, HI (M)
Maj Gen (R) Suhaib Ahmed, HI (M) The process of determining the sequence of an unknown DNA is called sequencing. There are many approaches for DNA sequencing. In the last couple of decades automated Sanger
More informationThe Polymerase Chain Reaction. Chapter 6: Background
The Polymerase Chain Reaction Chapter 6: Background Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off the road and outlined a way to conduct DNA replication in a tube Worked for
More informationHuman DNA authentication using Combined DNA Index System (CODIS) profiling Created on: May 28, 2009; Last modified by: May, 2009, Version: 2.
Human DNA authentication using Combined DNA Index System (CODIS) profiling Created on: May 28, 2009; Last modified by: May, 2009, Version: 2.0 This protocol describes the procedure for the authentication
More informationASIC200 PERSONAL GENOMICS LECTURE (PART 2/PCR LAB).
ASIC200 PERSONAL GENOMICS LECTURE (PART 2/PCR LAB). Essentially covering the Polymerase Chain Reaction and Gel Electrophoresis. As mentioned earlier, Sanger sequencing, and Next Gen sequencing will not
More informationAh, Lou! There really are differences between us!
Name Ah, Lou! There really are differences between us! Maria C. Abilock BABEC Frank H. Stephenson, Ph.D. Applied Biosystems We gratefully acknowledge David Micklos of the DNA Learning Center at Cold Spring
More informationApplication of Biotechnology in DNA Fingerprinting and Forensic Analysis. Copyright 2009 Pearson Education, Inc.
Application of Biotechnology in DNA Fingerprinting and Forensic Analysis Introduction to DNA Fingerprinting and Forensics Forensic science intersection of law and science Historic examples Early 1900s
More informationHiPer Random Amplification of Polymorphic DNA (RAPD) Teaching Kit
HiPer Random Amplification of Polymorphic DNA (RAPD) Teaching Kit Product Code: HTBM031 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 3.5 hours Agarose Gel Electrophoresis:
More informationBiotechnology. Explorer Program. Serious About Science Education 5/17/09 1
Biotechnology Explorer Program Serious About Science Education 5/17/09 1 Chromosome 8: PCR TM PCR Workshop Kirk Brown,, Tracy High School; Tracy, Ca Stan Hitomi,, Monte Vista High School; Danville, CA
More informationDNA: THE INDISPENSIBLE FORENSIC SCIENCE TOOL
Chapter 9 DNA: THE INDISPENSIBLE TOOL By Richard Saferstein Upper Saddle River, NJ 07458 1 Chapter 9 DNA Fingerprinting By the end of this chapter you will be able to: explain how crime scene evidence
More informationDNA FINGERPRINTING MADE EASY FOR FORENSICS
DNA FINGERPRINTING MADE EASY FOR FORENSICS Presented by Eilene Lyons The St. Louis Community College Florissant Valley Biotechnology Program Some slides are from a downloaded PPT presentation from The
More informationBasic Steps of the DNA process
As time pasted technology has improve the methods of analyzing DNA. One of the first methods for the analysis of DNA is known as Restriction Fragment Length Polymorphism (RFLP). This technique analyzed
More informationGenetics module. DNA Structure, Replication. The Genetic Code; Transcription and Translation. Principles of Heredity; Gene Mapping
Genetics module Lectures DNA Structure, Replication The Genetic Code; Transcription and Translation Principles of Heredity; Gene Mapping Controlling Gene Expression Mutation and Cancer Textbook: Introduction
More informationPractical 4: PCR in Molecular Diagnosis
PRINCIPLES What is PCR Practical 4: PCR in Molecular Diagnosis Instructors: Dr. Valerie C.L. Lin and Dr. Sze Chun Chau PCR stands for polymerase chain reaction. The PCR method was devised and named by
More informationMOLEBIO LAB #10: PV92 PCR BIOINFORMATICS
Name: MOLE BIO/BIOCHEMISTRY MOLEBIO LAB #10: PV92 PCR BIOINFORMATICS Lesson 1 Cheek Cell DNA Template Preparation To obtain DNA for use in the polymerase chain reaction (PCR) you will extract the DNA from
More informationPrepare CTAB solutions to extracting DNA from Plant
Prepare CTAB solutions to extracting DNA from Plant By Dr. Mona S. Alwahibi Botany and Microbiology Dep. Introduction The search for a more efficient means of extracting DNA of both higher quality and
More informationHiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
More informationDNA Fingerprinting Using PCR
Revised and Updated Edvo-Kit #371 DNA Fingerprinting Using PCR 371 Experiment Objective: In this experiment, students will conduct a DNA fingerprinting exercise on simulated samples from a crime scene
More informationSOP for Quantitation of the Hepatitis C Virus (HCV) Genome by RT-PCR
Virus Bank SOP-HCV-001 1. Scope SOP for Quantitation of the Hepatitis C Virus (HCV) Genome by RT-PCR 1.1 This procedure describes a method for quantitation of the HCV genome in HCV-infected cells by RT-PCR.
More informationThe Techniques of Molecular Biology: Forensic DNA Fingerprinting
Revised Fall 2016 The Techniques of Molecular Biology: Forensic DNA Fingerprinting **Lab coat, eye goggles and gloves (nitrile or latex) are required for this lab. You will not be allowed to participate
More informationVNTR Analysis: The Science Behind DNA Fingerprinting Teacher Materials
VNTR Analysis: The Science Behind DNA Fingerprinting Teacher Materials In this lab, students will analyze a single VNTR locus (Variable Number of Tandem Repeats) in several different subjects. The VNTR
More informationThe Techniques of Molecular Biology: Forensic DNA Fingerprinting
The Techniques of Molecular Biology: Forensic DNA Fingerprinting Revised Fall 2017 Laboratory Safety: Lab coat, long pants, closed-toe shoes, safety goggles, and nitrile or latex gloves are required. Learning
More informationMarathon TM cdna Amplification Kit Protocol-at-a-Glance
(PT1115-2) Marathon cdna amplification is a fairly complex, multiday procedure. Please read the User Manual before using this abbreviated protocol, and refer to it often for interpretation of results during
More informationHCV Genotype Primer Kit
Instruction Manual for HCV Genotype Primer Kit HCV Genotype Determination Kit for Research Purpose Thoroughly read this instruction manual before use of this kit Background Study of nucleotide sequence
More informationStudent Manual. Introduction to PCR The Polymerase Chain Reaction
Student Manual Introduction to PCR The Polymerase Chain Reaction You are about to perform a procedure known as PCR 1 to amplify a specific sequence of your own DNA in a test tube. You will be looking for
More informationFORENSIC GENETICS. DNA in the cell FORENSIC GENETICS PERSONAL IDENTIFICATION KINSHIP ANALYSIS FORENSIC GENETICS. Sources of biological evidence
FORENSIC GENETICS FORENSIC GENETICS PERSONAL IDENTIFICATION KINSHIP ANALYSIS FORENSIC GENETICS Establishing human corpse identity Crime cases matching suspect with evidence Paternity testing, even after
More informationStudent Name: Prepared by Dr. Elizabeth Tattersall, Instructor of Biophysical Sciences. WNC-Douglas Campus. Edited by
1 Using A SNP to Predict the Ability to Taste PTC Student Name: Course: Date: Section: Sign-Off: Prepared by Dr. Elizabeth Tattersall, Instructor of Biophysical Sciences WNC-Douglas Campus Edited by Dr.
More informationUSDA RiceCAP DNA extraction using DNeasy Plant Mini Kit.
DNA extraction using DNeasy Plant Mini Kit. Preparatory work: 1. If using the kit for the first time, add ethanol to buffer AW and buffer AP3/E to obtain the working solutions. 2. Preheat a water bath
More informationThe Polymerase Chain Reaction. Chapter 6: Background
The Polymerase Chain Reaction Chapter 6: Background PCR Amplify= Polymerase Chain Reaction (PCR) Invented in 1984 Applications Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off
More informationOverview. Introduction
Genetics 101: Introduction Overview Important terminology DNA extraction, gel electrophoresis, PCR Allozymes (Protein electrophoresis) RFLP AFLP Sequencing Microsatellites SNPs Costs, Sample Collection
More informationPositive control kit for enzymatic mismatch cleavage and agarose gel visualization (version 2.4)
28 January, 2010 Positive control kit for enzymatic mismatch cleavage and agarose gel visualization (version 2.4) Plant Breeding Unit Brad Till and Owen Huynh January, 2010 Kit Contents: Genomic DNA from
More information2ml of 1M stock 10x TBE (1 Litre) Tris Base 107.8g 55g (harmful, wear mask) EDTA 7.4g
Phytoplasma Detection Protocol Buffers: Hybridisation buffer 100ml hybridisation buffer 2.92g Sodium chloride 4g Blocking reagent (add slowly while stirring) Mix at room temperature for 2 hours Can be
More informationTexas A&M University-Corpus Christi CHEM4402 Biochemistry II Laboratory Laboratory 8: DNA Restriction Digest (II) and DNA Sequencing (I)
Texas A&M University-Corpus Christi CHEM4402 Biochemistry II Laboratory Laboratory 8: DNA Restriction Digest (II) and DNA Sequencing (I) We have made considerable progress in our analysis of the gene for
More informationVNTR Human DNA Typing Using PCR
SA w Ple M eb a P lin se LE k re LI fo fe T r c r ER t or o AT re inc U ct lu R ve de E rs d io n. ISED & ED P D AT 334 REV U Edvo-Kit #334 VNTR Human DNA Typing Using PCR Experiment Objective: In this
More informationPlantDirect TM Multiplex PCR System
PlantDirect TM Multiplex PCR System Technical Manual No. 0178 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 3 IV Shipping and Storage. 3 V Simplified Procedures. 3 VI Detailed
More informationLarge DNA Fragments Extraction Kit
Instruction Manual Ver. 04.25.17 For Research Use Only Large DNA Fragments Extraction Kit DFL004 (4 Preparation Sample Kit) DFL100 (100 Preparation Kit) DFL300 (300 Preparation Kit) Advantages Efficient:
More informationBIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.
!! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which
More informationVNTR Human DNA Typing Using PCR
The Biotechnology Education Company Revised and Updated VNTR Human DNA Typing Using PCR Storage: See Page 3 for specific storage instructions EXPERIMENT OBJECTIVE: In this experiment, students will use
More informationUsing Single Nucleotide Polymorphism (SNP) to Predict Bitter Tasting Ability
Using Single Nucleotide Polymorphism (SNP) to Predict Bitter Tasting Ability Part II:! Digestion and Analysis of an Amplified Region of the Bitter Taste Receptor TAS2R38 Gene In The Last Lab:! You sampled
More informationPolymerase Chain Reaction (PCR)
Laboratory for Environmental Pathogens Research Department of Environmental Sciences University of Toledo Polymerase Chain Reaction (PCR) Background information The polymerase chain reaction (PCR) is an
More informationBIOO RESEARCH PRODUCTS. ALL-TAIL Kit Manual For Extreme 3 RACE Catalog #: 5205
BIOO RESEARCH PRODUCTS ALL-TAIL Kit Manual For Extreme 3 RACE Catalog #: 5205 BIOO Scientific Corp. 2010 TABLE OF CONTENTS GENERAL INFORMATION... 1 Product Description... 1 Procedure Overview... 2 Kit
More informationDNA Profiling with PCR
Name: DNA Profiling with PCR OBJECTIVES To review the structure and function of DNA. Understand and perform the polymerase chain reaction (PCR) To gain experience using the micropipettes, thermocycler,
More informationMultiplex analysis of 10 STR loci plus Amelogenin
Multiplex analysis of 10 STR loci plus Amelogenin Page 1 of 15 Table of Content 1 Product Information.3 1.1 Product Description 3 1.2 Ordering Information and Kit Components 5 1.3 Storage Conditions..5
More informationITS Sequencing in Millepora. 10/09 Subcloning DNA Fragments into pbluescript Preparation of pbluescript Vector
Page 1 of 5 10/09 Subcloning DNA Fragments into pbluescript Preparation of pbluescript Vector 1. Digest 1 µg of pbluescript with Eco RI 2. Following digestion, add 0.1 volumes of 3M sodium acetate (ph
More informationLesson 3 Gel Electrophoresis of Amplified PCR Samples and Staining of Agarose Gels
Lesson 3 Gel Electrophoresis of Amplified PCR Samples and Staining of Agarose Gels What Are You Looking At? Before you analyze your PCR products, let s take a look at the target sequence being explored.
More informationPTC PCR II: Restriction Enzymes & Gel Electrophoresis
PTC PCR II: Restriction Enzymes & Gel Electrophoresis Objective To apply what we ve learned about genetics, molecular biology, and recombinant DNA to a specific human genetic trait. Background Mammals
More informationTable of Contents. Description Kit Components Reagents not supplied in the kit Equipment required Storage...
Table of Contents Description... 2 Kit Components... 2 Reagents not supplied in the kit... 2 Equipment required... 2 Storage... 2 References... 2 Principle... 3 Protocol... 4 Identification of HPV types...
More informationVNTR Analysis The Science Behind DNA Fingerprinting Teacher Materials
VNTR Analysis The Science Behind DNA Fingerprinting Teacher Materials In this lab, students will analyze a single VNTR locus (Variable Number of Tandem Repeats) in several different subjects. The VNTR
More informationHLA-DR TYPING OF GENOMIC DNA
HLA-DR TYPING OF GENOMIC DNA Zofia SZCZERKOWSKA, Joanna WYSOCKA Institute of Forensic Medicine, Medical University, Gdañsk, Poland ABSTRACT: Advances in molecular biology techniques allowed for introduction
More informationPolymerase Chain Reaction PCR
Polymerase Chain Reaction PCR What is PCR? An in vitro process that detects, identifies, and copies (amplifies) a specific piece of DNA in a biological sample. Discovered by Dr. Kary Mullis in 1983. A
More informationDNA Fingerprinting Using PCR
SA w Ple M eb a P lin se LE k re LI fo fe T r c r ER t or o AT re inc U ct lu R ve de E rs d io n. ISED & D AT E D REV UP Edvo-Kit #371 371 DNA Fingerprinting Using PCR Experiment Objective: In this experiment,
More informationAnalysis in Forensic Science
Chapter 16 Gene Cloning & DNA Analysis in Forensic Science 1. DNA analysis in identification of crime suspects 2. Studying kinship by DNA profiling 3. Sex identification by DNA analysis Forensic science
More informationDNA Labeling Kits Texas Red -dctp and -dutp Instruction Manual
DNA Labeling Kits Texas Red -dctp and -dutp Instruction Manual Catalog Number 170-8221 170-8222 For Technical Service Call Your Local Bio-Rad Office or in the U.S. Call 1-800-4BIORAD (1-800-424-6723) Bio-Rad
More informationEduPrimer DNA Profiling Kit Catalog # s
GenoSensor Corporation EduPrimer DNA Profiling Kit Catalog # s 3001-3002 Version A January 2011 User Manual EduPrimer DNA Profiling Kit Table of Contents Product Overview... 2 Kit Components and Storage
More informationqpcr Kit, DNA-free Product components 100 rxn 250 rxn Product description
qpcr Kit, DNA-free For the PCR detection and identification of bacterial and fungal DNA using custom primers Product code A8514 Product components 100 rxn 250 rxn A 2.5x mastermix (3 mm MgCl 2 final concentration)
More informationBiol/Chem 475 Spring 2007
Biol/Chem 475 Spring 2007 Goal of lab: For most of the quarter, we will be exploring a gene family that was first discovered in fruitlfies and then found to be present in humans and worms and fish and
More informationGENERAL INFORMATION...
BIOO LIFE SCIENCE PRODUCTS NEXTflex-96 TM DNA Barcodes (Illumina Compatible) Catalog #: 514106 BIOO Scientific Corp. 2012 V12.11 TABLE OF CONTENTS GENERAL INFORMATION... 1 Product Overview... 1 Contents,
More informationMastermix 16S Complete, DNA-free
Mastermix 16S Complete, DNA-free For the PCR detection and identification of bacteria using universal 16S rdna primers For research use only Cat. No. S-020-0100 Cat. No. S-020-0250 Cat. No. S-020-1000
More informationThermo Scientific Equine Genotypes Panel 1.1
Thermo Scientific Equine Genotypes Panel 1.1 F- 850S 100 reactions F- 850L 500 reactions Technical Manual Product Description Parentage testing and individual identification using short tandem repeat (STR)
More informationFMF NIRCA PROTOCOL STEP 1.
FMF NIRCA PROTOCOL STEP 1. After you have isolated patient s DNA and DNA from a healthy donor (wild type), you perform a nested PCR. The primers used to amplify exon 2 and exon 10 of the mefv gene are
More informationCSI TEST. Ref. PCR detectives (4 practices) 1. EXPERIMENT OBJETIVE 2. BACKGROUND INFORMATION
CSI TEST Ref. PCR detectives (4 practices) 1. EXPERIMENT OBJETIVE This practice introduces students to using DNA and PCR to simulate how DNA obtained from a hair or saliva sample from a crime scene can
More informationHy-Fy High Fidelity Mix (x2)
Hy-Fy High Fidelity Mix (x2) #EZ-2021 1ml, 100rxn of 20μl Contents: 2X High Fidelity Mix 1ml Nuclease-free water 1ml Store at -20 C Shelf life: 2 years Description Hy-Fy High Fidelity Mix (x2) is a premixed,
More informationQuant One Step RT-PCR Kit
1. Quant One Step RT-PCR Kit For fast and sensitive one-step RT-PCR www.tiangen.com/en RT121221 Quant One Step RT-PCR Kit Kit Contents Cat. no. KR113 Contents Hotmaster Taq Polymerase (2.5 U/μl) Quant
More informationPuro. Knockout Detection (KOD) Kit
Puro Knockout Detection (KOD) Kit Cat. No. CC-03 18 Oct. 2016 Contents I. Kit Contents and Storage II. Product Overview III. Methods Experimental Outline Genomic DNA Preparation Obtain Hybrid DNA Digest
More informationPreparing normalized cdna libraries for transcriptome sequencing (Illumina HiSeq)
Preparing normalized cdna libraries for transcriptome sequencing (Illumina HiSeq) Last updated: Oct 28, 2016 Overview First-strand cdna is synthesized using oligo-dt containing primers and an RNA oligo
More informationFor in vitro Veterinary Diagnostics only. DNA Extraction and PCR Detection Kit for Pasteurella multocida.
For in vitro Veterinary Diagnostics only. DNA Extraction and PCR Detection Kit for Pasteurella multocida www.kylt.eu DIRECTION FOR USE Art. No. 31058 / 31059 Kylt Pasteurella multocida DNA Extraction and
More informationBIOO LIFE SCIENCE PRODUCTS
BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit
More informationChapter 7 DNA Fingerprinting By the end of this chapter you will be able to:
Chapter 7 DNA Fingerprinting By the end of this chapter you will be able to: explain how crime scene evidence is collected and processed to obtain DNA describe how radioactive probes are used in DNA fingerprinting
More informationReadyAmp Genomic DNA Purification System INSTRUCTIONS FOR USE OF PRODUCTS A7710.
Technical Bulletin ReadyAmp Genomic DNA Purification System INSTRUCTIONS FOR USE OF PRODUCTS A7710. PRINTED IN USA. Revised 4/11 ReadyAmp Genomic DNA Purification System All technical literature is available
More informationBIO 121 LAB 10 - DNA I
BIO 121 LAB 10 - DNA I All cellular organisms store their hereditary information as the precise sequence of nucleotides in DNA, just as written information is stored as the precise sequence of letters
More informationCONCEPTS AND METHODS INSTRUCTOR PLANNING. The following table will help you to plan and integrate the four parts of the experiment.
CONCEPTS AND METHODS This laboratory can help students understand several important concepts of modern biology: The relationship between genotype and phenotype. Forensic identification of genes. Methods
More informationIntroduction to some aspects of molecular genetics
Introduction to some aspects of molecular genetics Julius van der Werf (partly based on notes from Margaret Katz) University of New England, Armidale, Australia Genetic and Physical maps of the genome...
More informationDNA Fingerprint Analysis of Three Short Tandem Repeat STR Loci for Biochemistry and Forensics Laboratory Courses
Supplemental Material for DNA Fingerprint Analysis of Three Short Tandem Repeat STR Loci for Biochemistry and Forensics Laboratory Courses Kathleen McNamara-Schroeder, Cheryl Olonan, Simon Chu, Maria Montoya,
More information