GeneAmp Gold PCR Reagent Kit Hot Start, Strong Finish
|
|
- Barnaby Bryan
- 6 years ago
- Views:
Transcription
1 GeneAmp Gold PCR Reagent Kit Hot Start, Strong Finish Protocol
2 Copyright 2002, 2010 Applied Biosystems. All rights reserved. For Research Use Only. Not for use in diagnostic procedures. AB (Design), Applera, Applied Biosystems, Hot Start Strong Finish, and MicroAmp are trademarks of Applied Biosystems or its subsidiaries in the U.S. and certain other countries. GeneAmp and AmpliTaq Gold are registered trademarks of Roche Molecular Systems, Inc. All other trademarks are the sole property of their respective owners. Printed in the USA, 07/2010 Part Number Rev. D
3 Contents KitOverview...1 PCRKitFeatures...1 HotStart,StrongFinish...1 AmpliTaqGoldDNAPolymerase...2 Multiplexing GeneAmp10XPCRGoldBuffer...3 MaterialsandEquipment...4 GeneAmpGoldPCRReagentKit...4 KitComponents...4 MaterialsRequiredbutNotSupplied...5 StorageandStability...5 PerformanceCharacteristics...5 Safety...6 DocumentationUserAttentionWords...6 OrderingKitsandReagents...6 User Safety Precautions ProtocolandKitWarnings...7 PreventingContamination...8 Overview...8 GeneralPCRPractices...8 ProtocolforAmplificationofControlSamples...9 PreparingtheReactionMix...9 RecommendationsforPrimerConcentration...10 PreparingtheControlTemplateLambdaDNA...10 Reaction Mix Components Thermal Cycling Parameters for Control DNA Amplification i
4 StoringSampleReactions...11 AnalysisoftheControlReaction...11 ReagentOptimizationGuidelinesforCustomApplications...12 AboutReagentOptimization...12 OptimizingtheTemplateConcentration...12 DesigningthePrimers...13 OptimizingthePrimerConcentration...13 Optimizing the MgCl 2 Concentration...14 OptimizingthedNTPConcentration...14 OptimizingtheEnzymeConcentration...14 Thermal Cycling Optimization Guidelines for Custom Applications AboutThermalCyclingOptimization...15 Two-TemperatureversusThree-TemperaturePCR...15 Two-TemperatureThermalCycling...16 Three-TemperatureThermalCycling...17 Adjusting the Hold Period for AmpliTaq Gold Activation AdjustingtheDenaturationConditions...18 AdjustingtheAnnealingConditions...19 AdjustingtheExtensionConditions...19 Appendix A. AmpliTaq Gold DNA Polymerase Characteristics AmpliTaqGoldDNAPolymerase...20 ThermalActivationProfile...21 AppendixB. DesigningMultiplexPCRAmplification...22 About Multiplex PCR Designing Multiplex PCR AppendixC. NucleotideRegionsforControlPrimers...23 RegionforControlPrimers#1and# RegionforControlPrimers#3and# AppendixD. Troubleshooting...25 AppendixE. References...26 AppendixF. TechnicalSupport...28 AppliedBiosystemsWebSite...28 ii
5 Kit Overview PCR Kit Features The GeneAmp Gold PCR Reagent Kit (P/N ) is used to perform polymerase chain reaction (PCR) amplification of single or multiple DNA targets. This kit has the following features: Incorporates the Hot Start technique by using AmpliTaq Gold DNA Polymerase. The Hot Start technique increases sensitivity, specificity, and yield of PCR products. Contains a multiplex control that demonstrates the high performance and simplicity of use of AmpliTaq Gold DNA Polymerase. Contains all the reagents needed to perform one hundred 50 µl reactions, and 50 multiplex control reactions. Hot Start, Strong Finish The AmpliTaq Gold DNA Polymerase in the reagent kit provides an automated chemical enzyme for performing the Hot Start technique and allowing for a strong finish in your PCR experiment. The Hot Start technique for performing PCR (Faloona et al.,1990; Chou et al.,1992) is a simple modification of the original PCR method whereby the amplification reaction is initiated above the optimal primerannealing temperature. In conventional PCR amplification, active reaction components are exposed to suboptimal annealing temperatures resulting in unintended priming and subsequent formation of nonspecific products. Because nonspecific product formation occurs at the beginning of the PCR, they are efficiently amplified throughout the remaining PCR cycles. This unintended amplification results in poor yield of the desired product. The sensitivity of the experiment is reduced, both by decreasing the desired amplification signal and obscuring it with a high background. Conversely, when the Hot Start PCR method is used, primers bind only to their specific target and the polymerase activity is directed only to that target. This results in increased sensitivity and yield, and decreased nonspecific product amplification. 1
6 AmpliTaq Gold is a chemically modified form of AmpliTaq DNA Polymerase. When the chemical moiety is attached to the enzyme, the enzyme is inactive. This allows for flexibility in reaction setup, including pre-mixing of PCR reagents at room temperature. Because the enzyme is inactive during set-up and during the first ramp of PCR, when the reaction goes through sub-optimal primer annealing temperatures, mis-primed primers will not be extended. AmpliTaq Gold DNA Polymerase requires a heat activation step, well above optimal annealing, to activate the enzyme, which provides an automated chemical hot start. AmpliTaq Gold DNA Polymerase can be completely or partially activated in a pre-pcr heat step, or it can be allowed to activate slowly during thermal cycling. Slow activation can provide a hot start and a time release of active enzyme, where polymerase activity builds as PCR product accumulates. AmpliTaq Gold DNA Polymerase The key component of this kit is AmpliTaq Gold DNA Polymerase. AmpliTaq Gold DNA Polymerase is a chemically modified form of Thermus aquaticus DNA polymerase that facilitates automated Hot Start PCR. The modified enzyme is provided in an inactive state. Activation of AmpliTaq Gold depends on three factors (Birch et al., 1996; Bost et al., 1997): Incubation temperature Incubation time Reaction ph The activation is performed by heating the enzyme reaction mix for 1 to 10 minutes at 95 C. Upon activation, the modifier is permanently released, regenerating the active enzyme and initiating PCR amplification. The automated Hot Start capabilities of AmpliTaq Gold DNA Polymerase improves the PCR procedure by increasing sensitivity, specificity, and yield over conventional PCR techniques. Note For more information about AmpliTaq Gold DNA Polymerase, see Appendix A. 2
7 Multiplexing Multiplexing is an amplification technique in which multiple primer sets are used to amplify multiple specific targets simultaneously. The use of AmpliTaq Gold DNA Polymerase significantly reduces non-specific product amplification, allowing specific multiplex amplification to occur. For guidelines on performing multiplex PCR see Appendix B. GeneAmp 10X PCR Gold Buffer GeneAmp 10X PCR Gold Buffer is formulated to provide flexible, efficient activation of AmpliTaq Gold DNA Polymerase, resulting in highly specific and robust PCR amplification. The ionic strength and ph of GeneAmp 10X PCR Gold Buffer has been optimized carefully for use with AmpliTaq Gold DNA Polymerase. 3
8 Materials and Equipment GeneAmp Gold PCR Reagent Kit The GeneAmp Gold PCR Reagent Kit (P/N ) contains all the reagents needed to perform one hundred 50 µl reactions and enough control DNA and primers for 50 multiplex control reactions. Kit Components Reagent AmpliTaq Gold DNA Polymerase GeneAmp 10X PCR Gold Buffer The following reagents are supplied with the GeneAmp Gold PCR Reagent Kit: Quantity (µl) Description 25 One tube containing 5 U/µL ofamplitaqgolddnapolymerase in 100 mm KCl, 20 mm Tris-HCl, ph 9.0, 0.1 mm EDTA, 1 mm DTT, 0.5% Tween 20, and 50% (v/v) glycerol. For more information, see Appendix A 1500 One tube containing 150 mm Tris-HCI and 500 mm KCl, ph 8.0 (at room temperature) MgCl One tube containing 25 mm MgCl 2 dntp Blend 1000 One tube containing 10 mm deoxyribonucleotide triphosphates (2.5 mm each datp, dctp, dgtp, and dttp) dissolved in deionized water, titrated to ph 7.0 with NaOH Control Template Lambda DNA 50 One tube containing 1 µg/ml bacteriophage Lambda genomic DNA (~ 48.5 kb) in Tris-EDTA (TE) buffer and 50 µg/ml glycogen Control Primer #1: PC01 a 50 One tube containing 20 µm complement of strand of Lambda genomic DNA: nucleotides of sequence: 5 GATGAGTTCGTGTCCGTACAACTGG 3 in TE buffer Control Primer #2: PC02 a 50 One tube containing 20 µm complement of + strand of Lambda genomic DNA: nucleotides of sequence: 5 GGTTATCGAAATCAGCCACAGCGCC 3 in TE buffer Control Primer #3: PC03 a 50 One tube containing 20 µm complement of strand of Lambda genomic DNA: nucleotides of sequence: 5 TTCAGGCGGCGCATTTTTATT 3 in TE buffer Control Primer #4: PC04 a 50 One tube containing 20 µm complement of + strand of Lambda genomic DNA: nucleotides of sequence: 5 ACGTCGATGACATTTGCCGTA 3 in TE buffer a. See Appendix C for specific sequence of the target segment. 4
9 Materials Required but Not Supplied In addition to the reagents supplied in this kit, the items listed in the following table are required: Item GeneAmp PCR System 2400, 9600, or 9700 Thermal Cycler MicroAmp disposables Agarose Disposable gloves Electrophoresis apparatus Microcentrifuge Pipets, positive-displacement or airdisplacement Pipet tips with filter plugs Polypropylene tubes TE buffer Vortex Source Applied Biosystems Applied Biosystems Major laboratory supplier (MLS) MLS MLS MLS MLS MLS MLS MLS MLS Storage and Stability Store the GeneAmp Gold PCR Reagent Kit at 20 C in a constanttemperature freezer. If stored under the recommended conditions, the enzyme will remain active through the control date printed on the label. Performance Characteristics Under the reagent conditions described in Protocol for Amplification of Control Samples on page 9 and the amplification conditions listed in Thermal Cycling Parameters for Control DNA Amplification on page 11, each lot of this kit has been shown to enable multiplex amplification of two regions of the Lambda genome, generating 300 bp and 500 bp amplicons simultaneously using two sets of primers. 5
10 Safety Documentation User Attention Words Five user attention words appear in the text of all Applied Biosystems user documentation. Each word implies a particular level of observation or action as follows. Note This word is used to call attention to information. IMPORTANT This word calls attention to information that is necessary for correct use of the kit or instrument.! CAUTION This word informs the user that damage to the instrument could occur if the user does not comply with the information. It also indicates a potentially hazardous situation that could result in minor or moderate injury to the user.! WARNING This word informs the user that serious physical injury or illness to the user or other persons could occur if these required precautions are not taken.! DANGER Indicates an imminently hazardous situation that, if not avoided, will result in death or serious injury. Ordering Kits and Reagents To order additional kits and reagents, please contact Applied Biosystems at one of the regional sales offices listed on the back of this protocol. Have the part number of the kit or reagent you are ordering available when ordering. User Safety Precautions Always wear the appropriate protective gloves, clothing, and eyewear when handling kit chemicals. 6
11 Protocol and Kit Warnings! WARNING CHEMICAL HAZARD. Some of the chemicals used in this protocol are hazardous. Follow the safety precautions stated in the specific chemical warnings that appear throughout this protocol.! WARNING CHEMICAL HAZARD. Some of the chemicals referred to in this protocol may not have been provided with your kit. If the chemicals are not provided, please obtain the Material Safety Data Sheets (MSDSs) from their manufacturers. If the chemicals are not provided with this kit but are purchased from Applied Biosystems, the MSDSs will accompany the first shipment. You can obtain additional copies of the MSDSs by calling Applied Biosystems at (800) To order an MSDS online, go to click Services and Support, click Documents on Demand, then click MSDS. Click the MSDS Index to search for the specific chemical, and click on the MSDS part number to obtain the pdf.! WARNING CHEMICAL WASTE HAZARD. Wastes produced by Applied Biosystems instruments are potentially hazardous and can cause injury, illness, or death. Read and understand the material safety data sheets (MSDSs) provided by the manufacturers of the chemicals in the waste container before you store, handle, or dispose of chemical waste. Minimize contact with chemicals. Wear appropriate personal protective equipment when handling chemicals (e.g., safety glasses, gloves, or protective clothing). For additional safety guidelines, consult the MSDS. Minimize the inhalation of chemicals. Do not leave chemical containers open. Use only with adequate ventilation (e.g., fume hood). For additional safety guidelines, consult the MSDS. Handle chemical wastes in a fume hood. After emptying the waste container, seal it with the cap provided. Dispose of the contents of the waste tray and waste bottle in accordance with good laboratory practices and local, state/provincial, or national environmental and health regulations. 7
12 Preventing Contamination Overview Due to the enormous amplification that occurs during PCR, small levels of DNA contamination can result in product formation even in the absence of purposefully added template DNA (Kwok et al., 1989). DNA contamination can come from: Previous PCR amplifications Samples with high DNA levels Cross contamination Positive control templates General PCR Practices Follow these recommendations: Wear a clean lab coat (not previously worn while handling amplified PCR products or used during sample preparation) and clean gloves when preparing samples for PCR amplification. Change gloves whenever you suspect that they are contaminated. Maintain separate areas and dedicated equipment and supplies for: Sample preparation PCR setup PCR amplification Analysis of PCR products. Never bring amplified PCR products into the PCR setup area. Open and close all sample tubes carefully. Try not to splash or spray PCR samples. Keep reactions and components capped as much as possible. Clean lab benches and equipment periodically with a 10% bleach solution. Use dedicated or disposable sterile vessels, solutions, and pipets (preferably positive-displacement pipets or tips with hydrophobic filters) to minimize cross-contamination during DNA preparation, reaction mixing, and sample analysis (Kwok, 1990). 8
13 Protocol for Amplification of Control Samples Preparing the Reaction Mix Prepare a Reaction Mix for all samples as described below. Note The Reaction Mix should be freshly prepared each time. To prepare the Reaction Mix: Step Action 1 Mix the AmpliTaq Gold DNA Polymerase and other thawed reagents gently to avoid generating bubbles.! CAUTION CHEMICAL HAZARD. AmpliTaq Gold DNA Polymerase may cause eye and skin irritation. Exposure may cause discomfort if swallowed or inhaled. Read the MSDS, and follow the handling instructions. Wear appropriate protective eyewear, clothing, and gloves. 2 Spin down the reagents in a microcentrifuge before pipetting. 3 Combine all of the following components in an appropriate size polypropylene tube: Note Pipet the enzyme carefully and slowly: the viscosity of the 50% glycerol in the buffer can lead to pipetting errors. Deionized water Buffer dntp MgCl 2 Enzyme 4 Mix the components by pipetting up and down. 5 Cap the tube and vortex gently. 6 Aliquot into the individual tubes or plates. 7 Add the primers and template DNA. 8 Cap the tubes or plates. 9 Mix the components by inverting the microcentrifuge tube or by vortexing gently. 10 Continue with PCR (see Thermal Cycling Parameters for Control DNA Amplification on page 11). 9
14 Recommendations for Primer Concentration The kit contains enough primers to support 50 multiplex control reactions using 0.4 µm of each primer in a 50 µl reaction. However, using 0.2 µm of each primer will still give good amplification and provide a total of one hundred 50 µl control reactions per kit. Preparing the Control Template Lambda DNA Reaction Mix Components Using 1X TE, ph 8.0 (room temperature), prepare a 10,000-fold dilution of the Control Template Lambda DNA to achieve a final concentration of 0.1 ng/ml. DNA amplification Reaction Mix components Component Vol (µl) Final Concentration Deionized water X PCR Gold Buffer 5 1X 25 mm MgCl mm 10 mm dntp Blend µm each dntp 20 µm Control Primer #1: PC µm 20 µm Control Primer #2: PC µm 20 µm Control Primer #3: PC µm 20 µm Control Primer #4: PC µm Control Template Lambda DNA diluted 5 10 fg/ µl (1:10,000) to 0.1 ng/ml 5U/µL AmpliTaq Gold DNA U/50 µl Polymerase Total Volume 50 10
15 Thermal Cycling Parameters for Control DNA Amplification The thermal cycling parameters for the GeneAmp Gold PCR Reagent Kit Control Primers and Control Template are described below. Cycling conditions for other cyclers may vary. Please consult the users manual for your thermal cycler for more information. Thermal Cycling on the GeneAmp PCR System 9700, 9600, 2700 or Cycle parameters for PCR with Control Template Lambda DNA Step AmpliTaq Gold Activation PCR PCR (Final Step) CYCLE (30 cycles) HOLD HOLD Denature Anneal/ Extend Anneal/ Extend Temp 95 C 95 C 68 C 72 C Time 5min 15sec 60sec 7min Storing Sample Reactions Analysis of the Control Reaction Following thermal cycling, samples can be stored at 4 C until subsequent analysis. The Amplification of the Lambda control template using the two sets of primers provided will simultaneously produce a 500 bp and 300 bp product. The 500 bp product will be produced using primers PC01 and PC02. The 300 bp product will be produced using primers PC03 and PC04. To visualize the products, electrophorese 5 µl of the control reaction through a 2% NuSieve, 0.5% SeaKem, or similar composition agarose gel. Electrophorese the samples at 70 to 80V/10 cm for 1.25 to 1.5 hours and stain the gel with 0.5 µg/ml of ethidium bromide solution.! WARNING CHEMICAL HAZARD. Ethidium bromide causes eye, skin, and respiratory tract irritation and is a known mutagen (i.e., it can change genetic material in a living cell and has the potential to cause cancer). Read the MSDS, and follow the handling instructions. Wear appropriate protective eyewear, clothing, and gloves. 11
16 Reagent Optimization Guidelines for Custom Applications About Reagent Optimization Optimization of reactions for each primer-template pair may be necessary and can be achieved by following the suggested guidelines for designing the primers and by varying the concentration of the following reagents: Template Primer MgCl 2 dntps Enzyme The effect of these variations can be monitored by examining the intensity and distribution of amplification products after electrophoresis. Optimizing the Template Concentration Use the following guidelines to optimize the template concentration: The DNA segment to be amplified from the template can be 5to10kblong(Jeffreyset al., 1988), although 100 to 1000 bases aremoretypicalandeasiertoamplify. Start with enough copies of the template to obtain a signal after 25 to 30 cycles; preferably more than 10 4 copies, but less than 1 µg of human genomic DNA per 50 µl reaction. If the target DNA concentration is low, more than 35 cycles may be required to produce sufficient product for analysis. As few as 1 to 10 target copies can be amplified (Saiki et al., 1988; Chou et al., 1992). Validation for low copy number amplifications is best done for an average of 5 to 10 target molecules per sample to avoid statistically arising dropouts (false negatives). 12
17 Designing the Primers Use the following guidelines when designing your primers: The single-stranded DNA primers should be 15 to 30 bases in length. To avoid potential problems, primers should be purified by gel electrophoresis or HPLC ion-exchange chromatography. Primer sequences should not complement within themselves or to each other, particularly at the 3 ends. This avoids templateindependent amplification of primer sequences (or primer dimer ) which can lead to other, larger primer artifacts. Primer-dimer may occur to some extent even without an apparent overlap. Optimizing the Primer Concentration Use the following guidelines to optimize the primer concentration: Optimal primer concentrations can be determined empirically by testing concentrations in the range of 0.1 to 1.0 µm. Primer concentrations that are too low will result in little or no PCR product. Primer concentrations that are too high may result in amplification of nontarget sequences. Primer concentrations in the range of 0.2 to 0.5 µm will work for most PCR amplifications. Reducing each primer concentration (e.g., to 0.2 µm) will help reduce amplification of nonspecific products. 13
18 Optimizing the MgCl 2 Concentration The magnesium ion concentration required for optimal PCR amplification is dependent on the specific set of primers and template. ToomuchortoolittleMgCl 2 reduces amplification efficiency or results in amplification of non-target sequences. The optimal MgCl 2 concentration must be determined empirically. The guidelines for determining the optimum MgCl 2 concentration for each primer set are listed below. Use the 25 mm MgCl 2 supplied to adjust the magnesium ion concentration. Vary the concentration of MgCl 2 around a midpoint of 2.5 mm. A typical range is 1.0 to 4.0 mm. Raise the MgCl 2 concentration in the reaction mix proportionately if the samples contain EDTA, citrate, or other chelators. Adjust the MgCl 2 concentration in parallel with significant changes in the concentration (higher or lower) of sample DNA or dntps. This will keep the free magnesium ion constant. For example reducing the concentration of dntp from 200 µm each to 40 µm each should be accompanied by a reduction in MgCl 2 concentration of 640 µm. Optimizing the dntp Concentration The dntp concentration provided for the Reaction Mix is balanced. If the blend is altered and the concentration of any one dntp is significantly different from the rest, then AmpliTaq Gold DNA Polymerase will tend to misincorporate, slow down and/or terminate prematurely (Innis et al., 1988). Lower concentrations of dntps (40 µm) favor increased polymerase fidelity (Eckert et al., 1992). Optimizing the Enzyme Concentration Increasing the AmpliTaq Gold DNA Polymerase concentration up to 2X the recommended amount may improve the yield of amplification product. 14
19 Thermal Cycling Optimization Guidelines for Custom Applications About Thermal Cycling Optimization Thermal cycling conditions can be optimized for each DNA template by using the following PCR temperature conditions: Two-temperature PCR Three-temperature PCR Two-Temperature versus Three- Temperature PCR Which One to Choose? Use the two-temperature PCR when primer annealing temperatures are more than 60 C. Use the three-temperature PCR when the templates have high G+C content and/or secondary structure, or desired primer annealing temperatures are below 60 C. 15
20 Two-Temperature Thermal Cycling Description of the Two-Temperature PCR Two-temperature PCR consolidates the annealing and extension steps into one. The extension is completed at the annealing temperature. Two-temperature PCR consists of: Denaturation of DNA template Annealing and extension of primers Note Fifteen seconds for denaturation and annealing is adequate when using GeneAmp PCR System thermal cyclers which display a calculated sample temperature. Some models of thermal cyclers may require longer times. Two-temperature thermal cycling on the GeneAmp PCR System 9700, 9600, 2700 or 2400 Step AmpliTaq Gold Enzyme Activation PCR PCR (Final Step) HOLD CYCLE (30 cycles) HOLD Denature Anneal/ Extend Temp 95 C 95 C 60 to 70 C a 72 C Time 5 min b 15 sec 60 sec/kb 7 min a. Adjust the temperature according to the primer melting temperature. b. Adjust the time according to the desired initial enzyme activation (refer to Thermal Activation Profile on page 21). Start with an initial activation of 95 C for 5 minutes and adjust as required (refer to Adjusting the Hold Period for AmpliTaq Gold Activation on page 18 for more details). 16
21 Three- Temperature Thermal Cycling Description of Three-Temperature PCR Three-temperature PCR consists of: Denaturation of DNA template Annealing of the primers to the template Extension of the primers Note Fifteen seconds for denaturation and annealing is adequate when using GeneAmp PCR System thermal cyclers which display a calculated sample temperature. Some models of thermal cyclers may require longer times. Three-temperature thermal cycling on the GeneAmp PCR System 9700, 9600, 2700, or 2400 Step AmpliTaq Gold Enzyme Activation PCR PCR (Final Step) HOLD CYCLE (30 cycles) HOLD Denature Anneal Extend Temp 95 C 95 C 37 to 65 C a 72 C 72 C Time 5 min b 15 sec 15 sec 60 sec/kb 7 min a. Adjust the temperature according to the primer melting temperature. b. Adjust the time according to the desired initial enzyme activation (refer to Thermal Activation Profile on page 21). Start with an initial activation of 95 C for 5 minutes and adjust as required (refer to Adjusting the Hold Period for AmpliTaq Gold Activation on page 18 for more details). 17
22 Adjusting the Hold Period for AmpliTaq Gold Activation For general PCR runs, we recommend a pre-pcr activation setup of 95 C for 5 minutes. A titration of pre-pcr activation times (2 to 10 minutes in 1 minute intervals) should be done to find the best upfront enzyme activity for your reaction. Activation of AmpliTaq Gold DNA Polymerase can also be modulated to release active enzyme slowly over time (time release), allowing enzyme activity to increase with cycle number as the amount of template increases. This type of PCR can be accomplished as follows: With no activation during the pre-pcr hold period With limited activation during the pre-pcr hold period In a Time Release protocol, the enzyme is released slowly to match the template concentration which further increases the specificity. When a no or limited (1 to 2 minute) pre-pcr activation is used, the enzyme is released gradually during the denaturation step (95 C for 15 seconds) of each cycle. Because the enzyme is released slowly, up to 5 additional cycles may be required. Limiting the amount of active enzyme at the beginning of the amplification reaction when low amounts of substrate molecules are present enhances high specificity in the early PCR cycles. Seepage21forthethermalactivationprofileforAmpliTaqGoldDNA Polymerase. Adjusting the Denaturation Conditions The following are guidelines for adjusting the denaturation conditions: It is very important in the early cycles to make sure that your DNA template is completely melted. The maximum denaturation temperature should not exceed 95 to 96 C (Gelfand et al., 1990). 15 seconds is adequate when using GeneAmp PCR System thermal cyclers with a calculated in-tube temperature. Some models of thermal cyclers may require longer denaturation times. 18
23 Adjusting the Annealing Conditions The following are guidelines for adjusting annealing conditions: For increased product specificity, use annealing temperatures greater than 45 C (Saiki et al., 1988; Rychlik et al., 1990). Use two-temperature PCR for annealing temperatures greater than 60 C. The optimum annealing temperature can be determined empirically by testing at 5 C or smaller increments, until the maximum specificity is reached. Computer programs designed to calculate primer melting temperatures (T m ), can assist you in narrowing the range of annealing temperatures for empirical determination. A T m calculator can be found on the Applied Biosystems Web site at select Services & Support, click Technical Tools, and then click Tm Calculator. In addition, the GeneAmp PCR System 9700 Thermal Cycler also contains a T m calculator. 15 seconds is adequate when using GeneAmp PCR System thermal cyclers with a calculated in tube temperature. Some models of thermal cyclers may require longer annealing times. Adjusting the Extension Conditions The following are guidelines for adjusting the extension conditions: The length of the target sequence will affect the required extension time. Longer targets require increased extension times. As a general rule, allow an extension time of approximately 60 seconds per 1000 bases at 72 C. As the amount of DNA increases, the number of DNA polymerase molecules may become limiting. This can be compensated for, by increasing the extension time in later cycles. For two-temperature PCR, extension temperatures are typically lower than 72 C and thus extension times may need to be lengthened accordingly. 19
24 Appendix A. AmpliTaq Gold DNA Polymerase Characteristics AmpliTaq Gold DNA Polymerase AmpliTaq Gold DNA Polymerase is a chemically modified form of AmpliTaq DNA Polymerase. This thermostable 94-kDa protein is encoded by a modified form of a Thermus aquaticus DNA polymerase gene and expressed in an Escherichia coli host (Lawyer et al., 1989). Characteristics of AmpliTaq Gold DNA Polymerase Item Unit definition Analysis conditions Storage buffer Associated activities Description The enzyme is provided at 5 U/µL. One unit of enzyme is defined as the amount that will incorporate 10 nmol of dntps into acid-insoluble material per 30 minutes in a 10-minute incubation at 74 C under the conditions listed below in Analysis conditions. Note The enzyme is shipped in an inactive form. Before analyzing, the enzyme is activated by heating for 3 hours at 80 C. The analysis conditions are in the presence of 25 mm TAPS (tris- (hydroxymethyl)-methyl-amino-propanesulfonic acid, sodium salt), ph 9.3 (at room temperature); 50 mm KCl; 2 mm MgCl 2 ;1mMβ-mercaptoethanol; 200 µm each of datp, dgtp, dttp; 100 µm[α- 32 P] dctp ( Ci/mmol); salmon sperm DNA, activated by a modification of methods in Richardson et al., 1966; mixed in a final volume of 50 µl and incubated at 74 C for 10 minutes. Amplitaq Gold DNA Polymerase is stored in the following buffer: 20 mm Tris- HCl, ph 9.0 (at room temperature); 100 mm KCl, 0.1 mm EDTA (ethylenediaminetetraacetic acid), 1.0 mm DTT (dithiothreitol), 50% v/v glycerol, 0.5% w/v Tween 20. (See page 9 for protocol instructions.) Endonuclease and exonuclease activities were not detectable after 1 hour incubation of 600 ng of supercoiled pbr322 (dam,dcm )or600ngofmsp1- digested pbr322 DNA, respectively, at 74 C, in the presence of 8 units of AmpliTaq Gold DNA Polymerase. The enzyme has a fork-like, structuredependent, polymerization-enhanced, 5 -to-3 nuclease activity. It lacks a 3 to-5 exonuclease activity (Innis et al., 1988; Holland et al., 1991). 20
25 Thermal Activation Profile The activation profile of AmpliTaq Gold DNA Polymerase in Gold buffer at different temperatures is shown in the graph below C 95 C 90 C Percent Activity C 97 C Time (minutes) 21
26 Appendix B. Designing Multiplex PCR Amplification About Multiplex PCR Multiplex PCR is an amplification technique in which multiple primer sets amplify specific targets in a single reaction. Using AmpliTaq Gold DNA Polymerase simplifies the multiplexing process by reducing nonspecific product amplification and primer dimer formation. Designing Multiplex PCR When designing multiplex PCR, optimize the following factors: Primer selections Reagent concentrations PCR conditions To optimize the multiplex PCR factors: Step Action 1 Select primers that have similar melting temperatures and amplified products of distinguishable lengths. Note Primers can be optimized with a specialized primer program. 2 Optimize the following conditions separately for each product: Annealing temperature Primer concentration MgCl 2 concentration 3 Combine reactions and reoptimize combined components as in step 2 if necessary. 22
27 Appendix C. Nucleotide Regions for Control Primers Region for Control Primers #1 and #2 The sequence below (Sanger et al., 1982) (+ strand) is the 500 base pair target segment of bacteriophage Lambda genomic DNA amplified using Control Primer #1 (PC01) and Control Primer #2 (PC02). This corresponds to nucleotides of the Lambda genome. Sequence for PC01 Sequence for PC02 23
28 Region for Control Primers #3 and #4 The sequence below (Sanger et al., 1982) (+ strand) is the 300 base pair target segment of bacteriophage Lambda genomic DNA amplified using Control Primer #3 (PC03) and Control Primer #4 (PC04). This corresponds to nucleotides 30,537 30,836 of the Lambda genome. Sequence for PC03 Sequence for PC04 24
29 Appendix D. Troubleshooting Observation Possible Cause Recommended Action Reduced or no product band visible Product band is smeared Nonspecific amplification with or without a product band Template concentration too low Experimental sample DNA damaged or degraded Denaturation time too short or too long Denaturation temperature too low or too high Annealing/extension temperature too high Annealing/extension time too short Cycle number too low Primer design not optimal Preincubation/activation time not sufficient Carryover contamination Denaturation time too short or too long Denaturation temperature too low Annealing/extension time too long Cycle number too high Experimental sample DNA degraded Carryover contamination Nonspecific priming Too much initial enzyme activity Primer design not optimal Increase sample concentration. Use sample that has been processed to minimize shearing and nicking. Adjust time in increments of 5 seconds. Adjust temperature in increments of 1 C. Lower temperature in increments of 2 C. Lengthen time in increments of 15 seconds. Increase cycle number in increments of three cycles. Review primer design and composition. Increase pre-pcr heat step in increments of 1 minute, or use Time Release protocol. See Preventing Contamination on page 8. Adjust time in increments of 5 seconds. Increase temperature in increments of 1 C. Shorten time in increments of 15 seconds. Shorten cycle number in increments of three cycles. Test a new aliquot of sample. See Preventing Contamination on page 8. Increase the anneal temperature in 1to2 C increments. Reduce pre-pcr activation time or use a Time Release protocol. Review primer design and composition. 25
30 Appendix E. References Birch, D. E., Kolomodin, L., Laird, W. J., McKinney, N., Wong, J., Young, K. K. Y., Zangenberg, G. A., and Zoccoli, M. A Simplified Hot Start PCR. Product review in Nature 381: Bost, D. A., Zalloua, P., and Abramson, R. D AmpliTaq Gold: Biochemical Characterization and PCR Optimization. The FASEB Journal. 11: A1370. Chou, Q., Russell, M., Birch, D.E., Raymond, J., and Bloch, W Prevention of pre-pcr mis-priming and primer dimerization improves low- copy-number amplifications. Nucleic Acids Res. 20: Eckert, K.A. and Kunkel, T.A The fidelity of DNA polymerases used in the polymerase chain reactions. In: PCR: A Practical Approach. McPherson, M.J., Quirke, P., and Taylor, G.R., eds. New York: Oxford University Press Faloona, F., Weiss, S., Ferre, F., and Mullis, K Direct detection of HIV sequences in blood high-gain polymerase chain reaction [abstract]. In: 6th International Conference on AIDS, University of California, San Francisco: San Francisco (CA). Abstract Gelfand, D.H. and White, T.J Thermostable DNA polymerases. In: PCR Protocols: A Guide to Methods and Applications. Innis, M.A., Gelfand, D.H., Sninsky, J.J., and White, T.J., eds. San Diego: Academic Press Holland, P.M., Abramson, R.D., Watson, R., and Gelfand, D.H Detection of specific polymerase chain reaction product by utilizing the 5 3 exonuclease activity of Thermus aquaticus DNA polymerase. Proc.Natl.Acad.Sci.USA88: Innis, M.A., Myambo, K.B., Gelfand, D.H., and Brow, M.A DNA sequencing with Thermus aquaticus DNA polymerase and direct sequencing of polymerase chain reaction-amplified DNA. Proc. Natl. Acad.Sci.USA85: Jeffreys, A.J., Wilson, V., Neumann, R., and Keyte, J., Amplification of human minisatellites by the polymerase chain reaction: towards DNA fingerprinting of single cells. Nucleic Acids Res. 16:
31 Kwok, S. and Higuchi, R Avoiding false positives with PCR. Nature 339: Kwok, S Procedures to minimize PCR-product carry-over. In: PCR Protocols: A Guide to Methods and Applications. Innis, M.A., Gefland, D.H., Sninsky, J.J., and White, T.J., eds. San Diego: Academic Press Lawyer, F.C., Stoffel, S., Saiki, R.K., etþal Isolation, characterization, and expression in Escherichia coli of the DNA polymerase gene from Thermus aquaticus. J. Biol. Chem. 264: Richardson, C.C DNA polymerase from Escherichia coli. In: Procedures in Nucleic Acid Research. Cantoni, G.L. and Davies, D.R., eds. New York: Harper & Row Rychlik, W., Spencer, W.J., and Rhoads, R.E Optimization of the annealing temperature for DNA amplification in vitro [published erratum appears in Nucleic Acids Res 1991 Feb 11;19(3):698]. Nucleic Acids Res. 18: Saiki, R.K., Gelfand, D.H., Stoffel, S., etþal Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239: Sanger, F., Coulson, A.R., Hong, G.F., et al Nucleotide sequence of bacteriophage lambda DNA. J. Biol. Chem. 162:
32 Appendix F. Technical Support Applied Biosystems Web Site To access the Applied Biosystems Web site, go to: At the Applied Biosystems Web site, you can: Search through frequently asked questions (FAQs) Submit a question directly to Technical Support Order Applied Biosystems user documents, MSDSs, certificates of analysis, and other related documents Download PDF documents Obtain information about customer training Download software updates and patches In addition, the Applied Biosystems Web site provides a list of telephone and fax numbers that can be used to contact Technical Support. 28
33
34
35
36 Headquarters 850 Lincoln Centre Drive Foster City, CA USA Phone: Toll Free: Fax: Worldwide Sales Offices Applied Biosystems vast distribution and service network, composed of highly trained support and applications personnel, reaches into 150 countries on six continents. For international office locations, please call our local office or refer to our web site at Applied Biosystems is committed to providing the world s leading technology and information for life scientists. Printed in the USA, 07/2010 Part Number Rev. D
AmpliTaq Gold DNA Polymerase, LD Hot Start, Strong Finish
AmpliTaq Gold DNA Polymerase, LD Hot Start, Strong Finish Protocol Copyright 2007, Applied Biosystems. All rights reserved. For Research Use Only. Not for use in diagnostic procedures. Information in this
More informationTaKaRa PCR Amplification Kit
Cat. # R011 For Research Use TaKaRa PCR Amplification Kit Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 4 IV. Materials Required but not Provided... 4 V. Principle...
More informationGeneAmp Fast PCR Master Mix (2 )
GeneAmp Fast PCR Master Mix (2 ) Protocol August 25, 2004 12:53 pm, 7x9_Title.fm Copyright 2004, 2010 Applied Biosystems. All rights reserved. For Research Use Only. Not for use in diagnostic procedures.
More informationAmpliTaq Gold 360 Master Mix. Protocol
AmpliTaq Gold 360 Master Mix Protocol AmpliTaq Gold 360 Master Mix Protocol Copyright 2009, 2010 Applied Biosystems. All rights reserved. For Research Use Only. Not for use in diagnostic procedures. Information
More informationProtocol. Path-ID Multiplex One-Step RT-PCR Kit Protocol TaqMan probe-based multiplex one-step real-time RT-PCR detection of RNA targets
Protocol TaqMan probe-based multiplex one-step real-time RT-PCR detection of RNA targets For Research Use Only. Not for use in diagnostic procedures. Information in this document is subject to change without
More informationPRODUCT INFORMATION Long PCR Enzyme Mix #K0182 500 u Lot Exp. 00.0000 Store at -20 C. CERTIFICATE OF ANALYSIS Long PCR Enzyme Mix is functionally tested in PCR amplification of 47.4 kb fragment from lambda
More informationSureStart Taq DNA Polymerase
SureStart Taq DNA Polymerase INSTRUCTION MANUAL Catalog #600280 (100 U), #600282 (500 U), #600284 (1000 U) Revision A.01 For in Vitro Use Only 600280-12 LIMITED PRODUCT WARRANTY This warranty limits our
More informationAmpliTaq Gold Fast PCR Master Mix, UP (2 ) Protocol
AmpliTaq Gold Fast PCR Master Mix, UP (2 ) Protocol Copyright 2008, 2010 Applied Biosystems. All rights reserved. Information in this document is subject to change without notice. Applied Biosystems assumes
More informationJumpStart REDAccuTaq LA DNA Polymerase. Catalog Number D1313 Storage Temperature 20 C. Product Description
JumpStart REDAccuTaq LA DNA Polymerase Catalog Number D1313 Storage Temperature 20 C Product Description JumpStart REDAccuTaq LA DNA Polymerase contains AccuTaq LA DNA polymerase, 1,2 an inert red dye,
More informationPolymerase Chain Reaction (PCR)
Laboratory for Environmental Pathogens Research Department of Environmental Sciences University of Toledo Polymerase Chain Reaction (PCR) Background information The polymerase chain reaction (PCR) is an
More informationCERTIFICATE OF ANALYSIS. For. Red i-taq DNA Polymerase
CERTIFICATE OF ANALYSIS For Red i-taq DNA Polymerase Version 1 (110804) Catalog i-taq6 Size 500 units For Research Use Only and Not For Human and Animal Therapeutic and Diagnostic Use. Disclaimer: THE
More informationAmpliTaq Gold PCR Master Mix Protocol
AmpliTaq Gold PCR Master Mix Protocol For Research Use Only. Not for use in diagnostic procedures. Copyright 2001, Applied Biosystems For Research Use Only. Not for use in diagnostic procedures. NOTICE
More informationLabQ Taq DNA Polymerase
LabQ Taq DNA Polymerase SHIPPING: on dry ice / blue ice LOT: see vial PACK SIZES LQ-92TDP500U: 500 Units LabQ DNA Polymerase KIT COMPONENTS 500 U LabQ DNA Polymerase (5 U / µl) 2x 1.5 ml 10X LabQ Buffer
More informationMgCl 2 (25 mm) 1.6 ml 1.6 ml 1.6 ml 1.6 ml
Technical Data Sheet KAPA2G Fast PCR Kit Kit components KK 5008 Product codes KK 5010 KK 5009 KK 5011 KAPA2G Fast DNA polymerase (5 U/μl) 100 U 100 U 250 U 250 U 1. Production Description The KAPA2G Fast
More informationMultiplex PCR Assay Kit Ver.2
Cat. # RR062A For Research Use Multiplex PCR Assay Kit Ver.2 Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. Precautions... 3 V. Designing Primers for Multiplex
More informationApplied Biosystems 7900HT Fast Real-Time PCR System. Performing Fast Gene Quantitation with 384-Well Plates DRAFT
User Bulletin Applied Biosystems 7900HT Fast Real-Time PCR System October 3, 2005 SUBJECT: Performing Fast Gene Quantitation with 384-Well Plates In This User Bulletin System Overview System Requirements
More informationTaKaRa LA PCR Kit Ver.2.1
Cat. # RR013A For Research Use TaKaRa LA PCR Kit Ver.2.1 Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Materials Required but not Provided... 4 IV. Storage... 5 V. Protocol
More informationTaq + dntps #EZ U
#EZ1012 500U Taq + dntps Concentration: 5U/μl Contents: Hy-Taq DNA polymerase 100μl 10xPCR Buffer (Mg2+ Plus) 1.25ml dntps(2.5mm each) 1ml 6xLoading Buffer 1ml Store at -20 C Description Hy-Taq 500U +
More informationTaqMan PreAmp Master Mix Kit. Protocol
TaqMan PreAmp Master Mix Kit Protocol Copyright 2007, 2010 Applied Biosystems. All rights reserved. For Research Use Only. Not for use in diagnostic procedures. Information in this document is subject
More informationTaKaRa LA PCR Kit Ver. 2.1
Cat. # RR013A For Research Use TaKaRa LA PCR Kit Ver. 2.1 Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Materials Required but not Provided... 4 IV. Storage... 5 V. Protocol
More informationAccura High-Fidelity Polymerase
Accura High-Fidelity Polymerase FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608) 831-9011 FAX: (608)
More informationTaq Polymerase. Data sheet. Order No.: BS (For research and in vitro applications only) Batch No.: Best before: Bio&SELL
Data sheet Order No.: BS 91.711.0100 Order No.: BS 91.711.0500 100 units 500 units (For research and in vitro applications only) Batch No.: Best before: Appearance: clear liquid Colour: transparent 1 Description
More informationAmplification Products for PCR and RT-PCR
Selection guide Polymerase Hot start Comment UptiTherm DNA pol. no Most economic. Lower error rate than Taq polymerase Available in several formats, master mix including or not dntp, Mg 2+..., in gel format
More informationSYBR Green PCR and RT-PCR Reagents Protocol
SYBR Green PCR and RT-PCR Reagents Protocol For Research Use Only. Not for use in diagnostic procedures. Copyright 2001, Applied Biosystems For Research Use Only. Not for use in diagnostic procedures.
More informationKAPA HiFi HotStart ReadyMix PCR Kit
KAPA HiFi HotStart ReadyMix PCR Kit KR0370 v10.19 This provides product information and a detailed protocol for the KAPA HiFi HotStart ReadyMix PCR Kit. This document applies to the following kits: 07958919001,
More information500U. Unit Definition. Storage Buffer. 10X PCR Buffer with Mg 2+
Hy-Taq 500U + dntps #EZ1012 500U Concentration: 5U/μl Contents: Hy-Taq DNA Polymerase 100μl 10xPCR Buffer(Mg 2+ Plus) 1.25ml dntps(2.5mm each) 1ml 6xLoading Buffer 1ml Store at -20 C For research only
More informationSunScript TM One Step RT-qPCR Kit
INDEX Ordering Information...3 Kit Contents...3 Shipping and Storage...3 Handling...3 Quality Control...3 Reagents and Equipment to be Supplied by the User...3 Description...4 Protocol...4 Troubleshooting
More informationGuidelines for Preventing Contamination of PCR Reference Guidelines for Primer Design Estimation of Primer Melting Temperature
Guidelines for Preventing Contamination of PCR During PCR more than 10 million copies of a template DNA are generated. Therefore, care must be taken to avoid contamination with other templates and amplicons
More informationHigh Capacity RNA-to-cDNA TM Master Mix. Protocol
High Capacity RNA-to-cDNA TM Master Mix Protocol For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice.
More informationNxGen phi29 DNA Polymerase
NxGen phi29 DNA Polymerase Please read carefully and thoroughly before beginning FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE. Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll
More informationGeneAmp High Fidelity PCR System Protocol
GeneAmp High Fidelity PCR System Protocol For Research Use Only. Not for use in diagnostic procedures. Copyright 2001, 2010 Applied Biosystems. All rights reserved. For Research Use Only. Not for use in
More informationMultiplex RT for TaqMan Array Human MicroRNA Panel
f Multiplex RT for TaqMan Low Density Array Multiplex RT for TaqMan Array Human MicroRNA Panel Quick Reference Card For safety and biohazard guidelines, refer to the Safety section in the Multiplex RT
More informationInstructions for Use Life Science Kits & Assays
Instructions for Use Life Science Kits & Assays Content Content 1 Product and order number... I 2 Storage conditions... I 3 Description... II 3.1 Quality data... II 3.2 Unit definition... II 4 Delivered
More informationCat. # R006A. For Research Use. TaKaRa Z-Taq DNA Polymerase. Product Manual. v201411da
Cat. # R006A For Research Use TaKaRa Z-Taq DNA Polymerase Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Specifications... 3 IV. Optimization of Reaction Conditions... 4
More informationPRODUCT INFORMATION Thermo Scientific Luminaris Probe Low ROX qpcr Master Mix #K0944 For 5000 rxns Lot Expiry Date Store at -20 C in the dark CERTIFICATE OF ANALYSIS The absence of endo-, exodeoxyribonucleases
More informationAgPath-ID One-Step RT-PCR Kit
USER GUIDE AgPath-ID One-Step RT-PCR Kit Core Reagents for One-Step qrt-pcr Detection of Pathogen Catalog Numbers AM1005, 4387424, 4387391 Publication Number 1005M Revision Rev. G For Veterinary Use Only.
More informationSunScript One Step RT-PCR Kit
SunScript ONE STEP R T-PCR KIT HANDBOOK SunScript One Step RT-PCR Kit INDEX Legal... 4 Intended use... 4 Kit contents... 5 Shipping and storage... 5 Handling... 6 Quality control... 6 Reagents and equipment...
More informationNxGen M-MuLV Reverse Transcriptase
NxGen M-MuLV Reverse Transcriptase FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE. Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608) 831-9011 FAX: (608)
More information1. COMPONENTS. PyroStart Fast PCR Master Mix (2X) (#K0211 for 250 reactions of 20µl) 2. STORAGE 3. DESCRIPTION
1 2 1 PyroStart Fast PCR Master Mix (2X) (#K0211 for 250 reactions of 20µl) TABLE OF CONTENTS 1. COMPONENTS... 2 2. STORAGE... 2 3. DESCRIPTION... 2 4. PROTOCOL FOR FAST PCR... 3 4.1. General Considerations...
More informationInstructions for Use Life Science Kits & Assays
Instructions for Use Life Science Kits & Assays Product specifications 1 Product specifications The innutaq HOT-A DNA Polymerase provides improved specificity and sensitivity when amplifying low-copy-number
More informationPCR-ReIated Products User's Instruction
ISO 9001:2000 Certified PCR-ReIated Products User's Instruction SBS Genetech Co.,Ltd. Table of Contents Cat. No. Product Name Page EUT-500 ER-500 EP-500 EQ2.2-100/2.5-100/5.2-100/5.5-100 EN-1/2 U-Taq DNA
More informationMonsterScript Reverse Transcriptase
MonsterScript Reverse Transcriptase Cat. Nos. MSTA5110, and MSTA5124 Connect with Epicentre on our blog (epicentral.blogspot.com), Facebook (facebook.com/epicentrebio), and Twitter (@EpicentreBio). www.epicentre.com
More informationSpeedSTAR HS DNA Polymerase
Cat. # RR070A For Research Use SpeedSTAR HS DNA Polymerase Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. Supplied buffers... 3 V. General reaction mixture...
More informationTaq DNA Polymerase Pfu DNA Polymerase. For DNA Amplification
www. r oj et echnol ogi es. co T aqdnapol ymer as e PFUDNAPol ymer as e ForDNAampl i f i cat i on Taq DNA Polymerase Pfu DNA Polymerase For DNA Amplification By ROJE 2018 ROJETechnologies has been founded
More informationPrepare a Barcoded Fragment Library with the SOLiD Fragment Library Barcoding Kit 1 96
QUICK REFERENCE CARD Prepare a Barcoded Fragment Library with the SOLiD Fragment Library Barcoding Kit 1 96 Note: For safety and biohazard guidelines, refer to the Safety section in the Applied Biosystems
More informationPerform an HRM Methylation Study
Quick Reference Card Perform an HRM Methylation Study This quick reference card provides brief procedures for performing an HRM methylation study using MeltDoctor HRM Master Mix and High Resolution Melting
More informationPCR-EZ D-PCR Master Mix (2x Concentration, ready to use) MA1001. Table of Content. Introduction. List of Components. Additional Materials Required
Table of Content PCR-EZ D-PCR Master Mix (2x Concentration, ready to use) MA1001 Introduction List of Components Additional Materials Required General Considerations Experimental Procedures p3 p4 p4 p5
More informationPolymerase Chain Reaction (PCR)
Polymerase Chain Reaction (PCR) PCR protocols Polymerase Chain Reaction (PCR) A technique for the in vitro amplification of specific DNA sequences by the simultaneous primer extension of complementary
More informationPlantDirect TM Multiplex PCR System
PlantDirect TM Multiplex PCR System Technical Manual No. 0178 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 3 IV Shipping and Storage. 3 V Simplified Procedures. 3 VI Detailed
More informationProduct Name : Simple mirna Detection Kit
Product Name : Simple mirna Detection Kit Code No. : DS700 This product is for research use only Kit Contents This kit provides sufficient reagents to perform 20 reactions for detecting microrna. Components
More informationEncyclo Plus PCR kit. Cat #PK101. User Manual. This product is intended for research use only
Encyclo Plus PCR kit Cat #PK101 User Manual This product is intended for research use only Table of contents I. Kit components and storage conditions............. 1 II. Product description.........................
More informationGreenMasterMix (2X) b i o s c i e n c e. G E N A X X O N b i o s c i e n c e. High ROX (500nM)
G:\products\productflyer\pcr\polymerasen\hotstart\manu_m3052_green_en.docx GreenMasterMix (2) High RO (500nM) qpcr master mix with fluorescence dye and passive reference dye Contact & Technical support
More informationUses: The Methylamp MS-qPCR Fast Kit is very suitable for quantitative methylation-specific PCR in a fast format using very minute amounts of DNA.
Methylamp MS-qPCR Fast Kit Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE Uses: The Methylamp MS-qPCR Fast Kit is very suitable for quantitative methylation-specific PCR in a fast format
More informationAccuScript High Fidelity 1 st Strand cdna Synthesis Kit
AccuScript High Fidelity 1 st Strand cdna Synthesis Kit INSTRUCTION MANUAL Catalog #200820 Revision B.01 For In Vitro Use Only 200820-12 LIMITED PRODUCT WARRANTY This warranty limits our liability to replacement
More informationHerculase Hotstart DNA Polymerase
Herculase Hotstart DNA Polymerase Instruction Manual Catalog ##600310 (100 U), #600312 (500 U), and #600314 (1000 U) Revision C.0 For Research Use Only. Not for use in diagnostic procedures. 600310-12
More informationEpiQuik Quantitative PCR Fast Kit Base Catalog # P-1029
EpiQuik Quantitative PCR Fast Kit Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE Uses: The EpiQuik Quantitative PCR Fast Kit is designed for quantitative real time analysis of DNA samples
More informationTECHNICAL BULLETIN. SYBR Green JumpStart Taq ReadyMix without MgCl 2. Catalog Number S5193 Storage Temperature 20 C
SYBR Green JumpStart Taq ReadyMix without MgCl 2 Catalog Number S5193 Storage Temperature 20 C TECHNICAL BULLETIN Product Description SYBR Green JumpStart Taq ReadyMix without MgCl 2 combines JumpStart
More informationHiPer Random Amplification of Polymorphic DNA (RAPD) Teaching Kit
HiPer Random Amplification of Polymorphic DNA (RAPD) Teaching Kit Product Code: HTBM031 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 3.5 hours Agarose Gel Electrophoresis:
More informationAh, Lou! There really are differences between us!
Name Per Ah, Lou! There really are differences between us! Introduction The human genome (the total sum of our genetic makeup) is made up of approximately 6 billion base pairs distributed on 46 chromosomes.
More informationPolymer Block Cleaning Kit
Polymer Block Cleaning Kit For Applied Biosystems 3730/3730xl DNA Analyzers Protocol April 29, 2003 11:17 am, Title.fm Copyright 2003, Applied Biosystems. All rights reserved. For Research Use Only. Not
More informationPremix Ex Taq (Probe qpcr)
For Research Use Premix Ex Taq (Probe qpcr) Product Manual Table of Contents I. Description... 3 II. Principle... 4 III. Components... 5 IV. Materials Required but not Provided... 5 V. Storage... 5 VI.
More informationPCR Protocol Cooke Lab July 30, 2012
PCR Protocol Cooke Lab July 30, 2012 Contact Adriana Arango-Velez Contents 1. Before performing the PCR 2. Recommendations for the PCR 3. Performing the PCR 4. General Thermocycler program 5. Stock solutions
More informationThe Techniques of Molecular Biology: Forensic DNA Fingerprinting
The Techniques of Molecular Biology: Forensic DNA Fingerprinting Revised Fall 2017 Laboratory Safety: Lab coat, long pants, closed-toe shoes, safety goggles, and nitrile or latex gloves are required. Learning
More informationHigh-Specificity mirna QPCR Core Reagent Kit
High-Specificity mirna QPCR Core Reagent Kit Instruction Manual Catalog #600545 Revision F Research Use Only. Not for Use in Diagnostic Procedures. 600580-12 LIMITED PRODUCT WARRANTY This warranty limits
More information#K0262 For 1000 reactions of 25 µl Lot Exp.. Store at -20 C in the dark. V
PRODUCT INFORMATION Thermo Scientific Maxima Probe qpcr Master Mix (2X), ROX Solution provided #K0262 For 1000 reactions of 25 µl Lot Exp.. Store at -20 C in the dark. V CERTIFICATE OF ANALYSIS The absence
More informationHy-Fy High Fidelity Mix (x2)
Hy-Fy High Fidelity Mix (x2) #EZ-2021 1ml, 100rxn of 20μl Contents: 2X High Fidelity Mix 1ml Nuclease-free water 1ml Store at -20 C Shelf life: 2 years Description Hy-Fy High Fidelity Mix (x2) is a premixed,
More informationBlood direct 2x PCR Mastermix. Data sheet. Order No. BS reactions x 20 µl. (For research and in vitro applications only) Batch No.
Data sheet Order No. BS91.222.0250 250 reactions x 20 µl Order No. BS91.222.1250 1250 reactions x 20 µl (For research and in vitro applications only) Batch No.: Best before: Appearance: Colour: 1 Description
More informationHuman Placenta PCR-Ready cdna Kit Cat No. PC-40013: 30 reactions
780 Dubuque Avenue So. San Francisco, CA 94080, U.S.A. Tel: (800) 989-6296 / Fax:(650)871-2857 http://www.maximbio.com E-mail: mbi@maximbio.com Human Placenta PCR-Ready cdna Kit Cat No. PC-40013: 30 reactions
More informationHuman Leukemia Promyelocytic, HL-60 PCR-Ready cdna Kit Cat No. PC-40022: 30 reactions
780 Dubuque Avenue So. San Francisco, CA 94080, U.S.A. Tel: (800) 989-6296 / Fax:(650)871-2857 http://www.maximbio.com E-mail: mbi@maximbio.com Human Leukemia Promyelocytic, HL-60 PCR-Ready cdna Kit Cat
More informationProtocol for Creating Custom RT and Preamplification Pools using TaqMan MicroRNA Assays
USER BULLETIN Protocol for Creating Custom RT and Preamplification Pools using TaqMan MicroRNA Assays Publication Part Number 4465407 Revision Date January 2013 (Rev. C) SUBJECT: In this user bulletin
More informationPlatinum Multiplex PCR Master Mix
Platinum Multiplex PCR Master Mix USER GUIDE Catalog Numbers 4464268, 4464269, 4464270 Publication Number 4463722 Revision B For Research Use Only. Not for use in diagnostic procedures. Manufacturer: Life
More informationAbsolute Human Telomere Length Quantification qpcr Assay Kit (AHTLQ) Catalog # reactions
Absolute Human Telomere Length Quantification qpcr Assay Kit (AHTLQ) Catalog #8918 100 reactions Product Description Telomeres are repetitive nucleotide elements at the ends of chromosomes that protect
More informationApplied Biosystems Real-Time PCR Rapid Assay Development Guidelines
Applied Biosystems Real-Time PCR Rapid Assay Development Guidelines Description This tutorial will discuss recommended guidelines for designing and running real-time PCR quantification and SNP Genotyping
More informationRestorase DNA Polymerase with 10 Reaction Buffer. Catalog Number R1028 Storage Temperature 20 C TECHNICAL BULLETIN
Restorase DNA Polymerase with 10 Reaction Buffer Catalog Number R1028 Storage Temperature 20 C TECHNICAL BULLETIN Product Description Restorase DNA Polymerase with 10 Reaction Buffer combines Sigma s Long
More information3color RT HS-PCR Mix SYBR Ready-to-use mix for real-time Hot Start PCR with SYBR Green. Dedicated for white reaction tubes and plates.
3color RT HS-PCR Mix SYBR Ready-to-use mix for real-time Hot Start PCR with SYBR Green. Dedicated for white reaction tubes and plates. version 0217 250 reactions in 20 μl Cat. # 2000-250S 2500 reactions
More informationHELINI Hepatitis B virus [HBV] Real-time PCR Kit (Genotype A to H)
HELINI Hepatitis B virus [HBV] Real-time PCR Kit (Genotype A to H) Quantitative In vitro diagnostics Instruction manual Cat. No: 8001-25/50/100 tests Compatible with: Agilent, Bio-Rad, Applied Bio systems
More informationPCR OPTIMIZATION AND TROUBLESHOOTING
PCR OPTIMIZATION AND TROUBLESHOOTING Amplification of each DNA fragment can occur only under the defined conditions which are provided by a reaction mixture. If no positive PCR result can be obtained,
More informationVolume of Each Kit Reagent (ml) XTerminator Solution. 2-mL mL 1, mL 2,
BigDye XTerminator Purification Kit Quick Reference Card For safety and biohazard guidelines, refer to the Safety section in the Applied Biosystems BigDye XTerminator Purification Kit Protocol (PN 4374408).
More informationAccuScript PfuUltra II RT-PCR Kit
AccuScript PfuUltra II RT-PCR Kit INSTRUCTION MANUAL Catalog #600184 Revision A.01 For In Vitro Use Only 600184-12 LIMITED PRODUCT WARRANTY This warranty limits our liability to replacement of this product.
More informationKAPA HiFi HotStart Uracil+ ReadyMix PCR Kit
ReadyMix PCR Kit KR043 v4.7 Product Description KAPA HiFi HotStart is a novel B-family DNA polymerase, engineered to have increased affinity for DNA, without the need for accessory proteins or DNA-binding
More informationTe c htips. Simple Approaches for Optimization of RT-PCR TECH TIP 206
Te c htips TECH TIP 206 Fueling Innovation USB Corporation 26111 Miles Road Cleveland, Ohio 44128 800.321.9322 www.usbweb.com Simple Approaches for Optimization of RT-PCR Reverse transcription-polymerase
More informationThe Techniques of Molecular Biology: Forensic DNA Fingerprinting
Revised Fall 2016 The Techniques of Molecular Biology: Forensic DNA Fingerprinting **Lab coat, eye goggles and gloves (nitrile or latex) are required for this lab. You will not be allowed to participate
More informationAccuScript High Fidelity RT-PCR System
AccuScript High Fidelity RT-PCR System INSTRUCTION MANUAL Catalog #600180 Revision D.01 For In Vitro Use Only 600180-12 LIMITED PRODUCT WARRANTY This warranty limits our liability to replacement of this
More informationThermo Scientific Extensor Long Range PCR Enzyme Mix
Thermo Scientific Etensor Long Range PCR Enzyme Mi Description: Kit Contents: The Etensor Long Range PCR Enzyme Mi is a blend of ThermoPrime Taq DNA Polymerase and a proprietary proofreading enzyme. The
More informationBRCA MAQ USER GUIDE Version 1.0
BRCA MAQ USER GUIDE Version 1.0 For Copy Number Analysis Assays IFU604 v170797 www.multiplicom.com 2012 Multiplicom NV, all rights reserved Table of Contents Introduction to Multiplex Amplicon Quantification...2
More informationHigh-Specificity mirna QPCR Core Reagent Kit
High-Specificity mirna QPCR Core Reagent Kit Instruction Manual Catalog #600545 Revision H.0 For Research Use Only. Not for use in diagnostic procedures. 600580-12 LIMITED PRODUCT WARRANTY This warranty
More informationDNA fragments generated with the KAPA Plant PCR Kits are A-tailed and suitable for use with TA cloning vectors.
KAPA Plant PCR Kit Technical Data Sheet Product description Amplification of plant-derived DNA is a challenging application due to the diversity of plant tissue types and the potent PCR inhibitors contained
More informationTable of contents. I. Description...2. II. Principle...2. III. Kit Components...3. IV. Storage...3. V. Features...4. VI. Precautions for Operation...
Table of contents I. Description...2 II. Principle...2 III. Kit Components...3 IV. Storage...3 V. Features...4 VI. Precautions for Operation...4 VII. Protocol...4 VIII.Experiment Example...6 IX. Appendix...8
More informationCalifornia Institute of Technology. Directed evolution. Dr. F.H. Arnold s lab
Directed evolution. Dr. F.H. Arnold s lab May 4, 1999 Mutagenic PCR -[Mn] The amount of Mn used in the reaction should be titrated to produce the desired mutagenic rate. Libraries that have close to 30%
More information2x PCR LongNova-RED PCR Master Mix
2x PCR LongNova-RED Components RP85L 100 reactions (50 μl) RP85L-10 1000 reactions (50 μl) 2x PCR LongNova-RED 2 x 1.25 ml 20 x 1.25 ml PCR grade water 2 x 1.5 ml 20 x 1.5 ml Storage & Shiing Storage conditions
More informationGenomic Sequencing. Genomic Sequencing. Maj Gen (R) Suhaib Ahmed, HI (M)
Maj Gen (R) Suhaib Ahmed, HI (M) The process of determining the sequence of an unknown DNA is called sequencing. There are many approaches for DNA sequencing. In the last couple of decades automated Sanger
More informationSession 3 Cloning Overview & Polymerase Chain Reaction
Session 3 Cloning Overview & Polymerase Chain Reaction Learning Objective: In this lab exercise, you will become familiar with the steps of a polymerase chain reaction, the required reagents for a successful
More informationSuperiorScript III cdna Synthesis Kit Instruction Manual
SuperiorScript III cdna Synthesis Kit Instruction Manual Cat.# EZ405S, EZ405M SuperiorScript III cdna Synthesis Kit Table of Contents I. Description... 3 II. Kit... 4 III. Procedure... 5 IV. Control Experiment
More informationTOSCANA VIRUS oligomix Alert kit reagent for cdna "nested" amplification
TABLE OF CONTENTS INTENDED USE page 1 KIT DESCRIPTION page 1 KIT CHARACTERISTICS page 2 OTHER PRODUCTS REQUIRED page 2 MATERIALS PROVIDED IN THE KIT page 2 MATERIALS REQUIRED BUT NOT PROVIDED IN THE KIT
More informationDIRECTION FOR USE. Art. No / /25 reactions in vitro Diagnosticum for birds
DIRECTION FOR USE Art. No. 31066 / 31067 100 /25 reactions in vitro Diagnosticum for birds Kylt Turkey Hemorrhagic Enteritis Virus PCR Detection Kit is for detection of the etiological agent of Infectious
More informationTruePrime Single Cell WGA Kit
TruePrime SINGLE CELL WGA KIT HANDBOOK TruePrime Single Cell WGA Kit INDEX Legal...4 Intended use...4 Kit contents...5 Shipping and storage...5 Handling...6 Quality control...6 Reagents and equipment to
More informationTaqMan Pseudomonas aeruginosa Detection Kit
TaqMan Pseudomonas aeruginosa Detection Kit Protocol November 26, 2007 7:08 pm, TMB Pseud_Title.fm Copyright 2005, 2007, 2010 Applied Biosystems. All rights reserved. NOTICE TO PURCHASER: LIMITED LICENSE
More informationGel Extraction Mini Spin Column Kit. UltraPrep Gel-Ex. Purification of DNA fragments and plasmids from agarose gels
Gel Extraction Mini Spin Column Kit UltraPrep Gel-Ex Purification of DNA fragments and plasmids from agarose gels 2006 Molzym, all rights reserved 1 UltraPrep Gel-Ex Manual 01/2006 Contents Kit contents
More informationVetMAX -Plus Multiplex One-Step RT-PCR Kit TaqMan probe-based multiplex one-step real-time RT-PCR amplification of RNA targets.
VetMAX -Plus Multiplex One-Step RT-PCR Kit TaqMan probe-based multiplex one-step real-time RT-PCR amplification of RNA targets Protocol Copyright 2010, Life Technologies Corporation. All rights reserved.
More information10x Hot-Taq Buffer 1 ml 1 ml x 2ea 1 ml x 10ea. dntp Mix (each 10 mm) None / 0.2 ml None / 0.4 ml None / 0.4 ml x 5ea
HelixAmp TM Hot-Taq Polymerase (Ver. 2.0) CERTIFICATE OF ANALYSIS (1603-V01R03) Contents HelixAmp TM Hot-Taq Polymerase (Ver. 2.0) Cat. No. HT250/HT250N HT500/HT500N HT2500/HT2500N Hot-Taq (2.5 units/μl)
More information